Multiple sequence alignment - TraesCS5B01G250000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G250000 chr5B 100.000 2177 0 0 1 2177 432719976 432717800 0 4021
1 TraesCS5B01G250000 chr6D 97.279 2205 31 11 1 2177 389254925 389252722 0 3712
2 TraesCS5B01G250000 chr6D 97.104 2072 32 10 1 2045 389250130 389248060 0 3469
3 TraesCS5B01G250000 chr5D 97.234 2205 31 12 1 2177 503238782 503236580 0 3707
4 TraesCS5B01G250000 chr5D 97.143 2205 30 13 1 2177 503243028 503240829 0 3692
5 TraesCS5B01G250000 chr5D 98.003 1903 26 6 1 1895 503229001 503227103 0 3293
6 TraesCS5B01G250000 chr5D 98.003 1903 23 6 1 1895 503267546 503269441 0 3290
7 TraesCS5B01G250000 chr5D 95.415 807 12 7 1396 2177 503227069 503226263 0 1262
8 TraesCS5B01G250000 chr5D 95.291 807 13 7 1396 2177 503269475 503270281 0 1256
9 TraesCS5B01G250000 chrUn 97.230 2202 36 10 1 2177 216508362 216510563 0 3705
10 TraesCS5B01G250000 chrUn 96.821 1447 21 7 756 2177 397077306 397078752 0 2394
11 TraesCS5B01G250000 chr3A 97.188 2205 32 12 1 2177 66007376 66009578 0 3701
12 TraesCS5B01G250000 chr7B 98.108 1903 27 5 1 1895 662724160 662722259 0 3306
13 TraesCS5B01G250000 chr6A 96.169 992 14 6 1210 2177 608869208 608870199 0 1600


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G250000 chr5B 432717800 432719976 2176 True 4021.0 4021 100.0000 1 2177 1 chr5B.!!$R1 2176
1 TraesCS5B01G250000 chr6D 389248060 389254925 6865 True 3590.5 3712 97.1915 1 2177 2 chr6D.!!$R1 2176
2 TraesCS5B01G250000 chr5D 503236580 503243028 6448 True 3699.5 3707 97.1885 1 2177 2 chr5D.!!$R2 2176
3 TraesCS5B01G250000 chr5D 503226263 503229001 2738 True 2277.5 3293 96.7090 1 2177 2 chr5D.!!$R1 2176
4 TraesCS5B01G250000 chr5D 503267546 503270281 2735 False 2273.0 3290 96.6470 1 2177 2 chr5D.!!$F1 2176
5 TraesCS5B01G250000 chrUn 216508362 216510563 2201 False 3705.0 3705 97.2300 1 2177 1 chrUn.!!$F1 2176
6 TraesCS5B01G250000 chrUn 397077306 397078752 1446 False 2394.0 2394 96.8210 756 2177 1 chrUn.!!$F2 1421
7 TraesCS5B01G250000 chr3A 66007376 66009578 2202 False 3701.0 3701 97.1880 1 2177 1 chr3A.!!$F1 2176
8 TraesCS5B01G250000 chr7B 662722259 662724160 1901 True 3306.0 3306 98.1080 1 1895 1 chr7B.!!$R1 1894
9 TraesCS5B01G250000 chr6A 608869208 608870199 991 False 1600.0 1600 96.1690 1210 2177 1 chr6A.!!$F1 967

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
911 915 1.143073 ACGCCCTTTTCTTGAGACCTT 59.857 47.619 0.0 0.0 0.0 3.5 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1991 2019 1.749634 CACTCCGTCCCGAAGACTAAT 59.25 52.381 4.39 0.0 43.91 1.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
59 60 1.372004 CGCGTTACTCACCCGTTCA 60.372 57.895 0.00 0.00 0.00 3.18
242 243 4.275936 GGATAACTTGTATCCATGCGCTTT 59.724 41.667 9.73 0.00 42.29 3.51
263 264 6.992715 GCTTTAGATTATTAGCCTGGAGTTCA 59.007 38.462 0.00 0.00 0.00 3.18
386 388 5.112129 ACTCACATTGGGTTTAGGGATAC 57.888 43.478 0.00 0.00 0.00 2.24
653 657 7.066887 TCGCACATGGTTTCATAAAATCTGTAT 59.933 33.333 0.00 0.00 31.33 2.29
911 915 1.143073 ACGCCCTTTTCTTGAGACCTT 59.857 47.619 0.00 0.00 0.00 3.50
965 969 9.533831 AGGAACACATACAAGAAAAAGGATAAT 57.466 29.630 0.00 0.00 0.00 1.28
1057 1061 5.163913 CCGAGACAGAATTTAGAACTTGCTG 60.164 44.000 0.00 0.00 0.00 4.41
1125 1129 5.722021 TTCATTCGGATCGATATGAGGAA 57.278 39.130 0.00 4.94 36.08 3.36
1289 1293 6.477033 CGATAGTTCATCACGGAAGAAAGAAT 59.523 38.462 0.00 0.00 32.71 2.40
1636 1644 4.651962 TCGGGATTTTTCTTGGGAAGTTTT 59.348 37.500 0.00 0.00 32.61 2.43
1882 1891 4.523083 CAAGGGGATTGATACCGAGAAAA 58.477 43.478 0.00 0.00 41.83 2.29
1984 2012 7.490962 AGAACATGAAAACGTGACTCAATTA 57.509 32.000 0.00 0.00 0.00 1.40
2090 2118 3.709653 AGGAGCCGTATGAGGTGAAAATA 59.290 43.478 0.00 0.00 0.00 1.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
242 243 5.903010 TGGTGAACTCCAGGCTAATAATCTA 59.097 40.000 0.00 0.00 33.19 1.98
263 264 1.065418 GTTGGCTATACTGCTGGTGGT 60.065 52.381 0.00 0.00 0.00 4.16
386 388 1.476085 AGTCATCAGTTCGAGCCTGAG 59.524 52.381 18.15 12.10 41.91 3.35
426 428 3.576648 GGATATAACTCAGCGGTACAGC 58.423 50.000 10.25 10.25 37.41 4.40
429 431 4.321824 GGAAGGGATATAACTCAGCGGTAC 60.322 50.000 0.00 0.00 0.00 3.34
911 915 7.939039 AGAGAAGTAATTTGTCCTCATGTTTCA 59.061 33.333 0.00 0.00 29.54 2.69
1289 1293 2.892640 CGATCCCGGCTCTGTGAA 59.107 61.111 0.00 0.00 0.00 3.18
1410 1414 5.803237 ATAGAACGGGGAAAGTATACAGG 57.197 43.478 5.50 0.00 0.00 4.00
1636 1644 7.993349 ATTATTCCATTCCAATTTCTTCCCA 57.007 32.000 0.00 0.00 0.00 4.37
1796 1805 7.779754 TTCCATTTCTTCATTTGGAATCTGA 57.220 32.000 0.00 0.00 41.95 3.27
1897 1924 9.573133 GAAGATTGTTCTTTACCAAACATATGG 57.427 33.333 7.80 0.00 42.34 2.74
1984 2012 4.097589 CCGTCCCGAAGACTAATTAAGACT 59.902 45.833 4.39 0.00 43.91 3.24
1991 2019 1.749634 CACTCCGTCCCGAAGACTAAT 59.250 52.381 4.39 0.00 43.91 1.73
2090 2118 4.468510 TCCCTTTACAGAACCGTACATGAT 59.531 41.667 0.00 0.00 0.00 2.45


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.