Multiple sequence alignment - TraesCS5B01G245200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G245200 chr5B 100.000 2264 0 0 1 2264 426532763 426535026 0.000000e+00 4181
1 TraesCS5B01G245200 chr5B 98.739 1744 21 1 1 1744 658084103 658085845 0.000000e+00 3097
2 TraesCS5B01G245200 chr5B 97.159 528 7 3 1744 2264 658086877 658087403 0.000000e+00 885
3 TraesCS5B01G245200 chr6A 97.575 1732 40 1 1 1730 387215232 387216963 0.000000e+00 2964
4 TraesCS5B01G245200 chr4A 95.903 1733 46 7 1 1730 698023514 698021804 0.000000e+00 2784
5 TraesCS5B01G245200 chr4A 94.634 1733 89 3 1 1730 514407624 514405893 0.000000e+00 2682
6 TraesCS5B01G245200 chr7D 94.977 1732 79 4 1 1730 16799691 16797966 0.000000e+00 2710
7 TraesCS5B01G245200 chr2B 93.966 1740 92 11 1 1730 579908105 579909841 0.000000e+00 2619
8 TraesCS5B01G245200 chr2B 93.174 1714 98 5 1 1713 649657455 649655760 0.000000e+00 2499
9 TraesCS5B01G245200 chr2B 96.780 528 9 3 1744 2264 717654913 717655439 0.000000e+00 874
10 TraesCS5B01G245200 chr3B 93.826 1733 96 6 1 1730 40993580 40991856 0.000000e+00 2597
11 TraesCS5B01G245200 chr3B 97.159 528 7 3 1744 2264 393331945 393332471 0.000000e+00 885
12 TraesCS5B01G245200 chr3B 100.000 60 0 0 1668 1727 393330792 393330851 6.610000e-21 111
13 TraesCS5B01G245200 chr4B 93.448 1740 98 9 1 1730 598448944 598447211 0.000000e+00 2567
14 TraesCS5B01G245200 chr7B 97.159 528 7 3 1744 2264 335929976 335930502 0.000000e+00 885
15 TraesCS5B01G245200 chr7B 96.571 525 10 3 1747 2264 130336822 130337345 0.000000e+00 863
16 TraesCS5B01G245200 chr7B 96.571 525 10 3 1747 2264 235455229 235454706 0.000000e+00 863
17 TraesCS5B01G245200 chrUn 96.591 528 10 3 1744 2264 17581435 17581961 0.000000e+00 869
18 TraesCS5B01G245200 chr6B 96.381 525 9 4 1747 2264 650643801 650643280 0.000000e+00 856
19 TraesCS5B01G245200 chr6B 97.024 504 7 3 1747 2243 114141978 114141476 0.000000e+00 841


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G245200 chr5B 426532763 426535026 2263 False 4181 4181 100.0000 1 2264 1 chr5B.!!$F1 2263
1 TraesCS5B01G245200 chr5B 658084103 658087403 3300 False 1991 3097 97.9490 1 2264 2 chr5B.!!$F2 2263
2 TraesCS5B01G245200 chr6A 387215232 387216963 1731 False 2964 2964 97.5750 1 1730 1 chr6A.!!$F1 1729
3 TraesCS5B01G245200 chr4A 698021804 698023514 1710 True 2784 2784 95.9030 1 1730 1 chr4A.!!$R2 1729
4 TraesCS5B01G245200 chr4A 514405893 514407624 1731 True 2682 2682 94.6340 1 1730 1 chr4A.!!$R1 1729
5 TraesCS5B01G245200 chr7D 16797966 16799691 1725 True 2710 2710 94.9770 1 1730 1 chr7D.!!$R1 1729
6 TraesCS5B01G245200 chr2B 579908105 579909841 1736 False 2619 2619 93.9660 1 1730 1 chr2B.!!$F1 1729
7 TraesCS5B01G245200 chr2B 649655760 649657455 1695 True 2499 2499 93.1740 1 1713 1 chr2B.!!$R1 1712
8 TraesCS5B01G245200 chr2B 717654913 717655439 526 False 874 874 96.7800 1744 2264 1 chr2B.!!$F2 520
9 TraesCS5B01G245200 chr3B 40991856 40993580 1724 True 2597 2597 93.8260 1 1730 1 chr3B.!!$R1 1729
10 TraesCS5B01G245200 chr3B 393330792 393332471 1679 False 498 885 98.5795 1668 2264 2 chr3B.!!$F1 596
11 TraesCS5B01G245200 chr4B 598447211 598448944 1733 True 2567 2567 93.4480 1 1730 1 chr4B.!!$R1 1729
12 TraesCS5B01G245200 chr7B 335929976 335930502 526 False 885 885 97.1590 1744 2264 1 chr7B.!!$F2 520
13 TraesCS5B01G245200 chr7B 130336822 130337345 523 False 863 863 96.5710 1747 2264 1 chr7B.!!$F1 517
14 TraesCS5B01G245200 chr7B 235454706 235455229 523 True 863 863 96.5710 1747 2264 1 chr7B.!!$R1 517
15 TraesCS5B01G245200 chrUn 17581435 17581961 526 False 869 869 96.5910 1744 2264 1 chrUn.!!$F1 520
16 TraesCS5B01G245200 chr6B 650643280 650643801 521 True 856 856 96.3810 1747 2264 1 chr6B.!!$R2 517
17 TraesCS5B01G245200 chr6B 114141476 114141978 502 True 841 841 97.0240 1747 2243 1 chr6B.!!$R1 496

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
698 701 0.178932 AGTGCTAGAGGTGGTGGTCA 60.179 55.0 0.0 0.0 0.0 4.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2161 3407 0.032678 CTTGGCGTCTGGCTATCGAT 59.967 55.0 2.16 2.16 42.94 3.59 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
104 105 3.611057 GCTGCATTTGAGGTGAAACTGAG 60.611 47.826 0.00 0.0 36.74 3.35
698 701 0.178932 AGTGCTAGAGGTGGTGGTCA 60.179 55.000 0.00 0.0 0.00 4.02
761 800 0.966370 GCTAGAGGTGGTGGTCGAGT 60.966 60.000 0.00 0.0 0.00 4.18
1228 1303 0.530288 TGCACATGATCGTCGAAGGA 59.470 50.000 0.00 0.0 0.00 3.36
1487 1562 1.587054 CGTCGTGAGAAGGAGGCTT 59.413 57.895 0.00 0.0 45.01 4.35
1744 1831 4.319046 CCATGAACTGTCGAGACTTTGTTG 60.319 45.833 4.78 0.0 0.00 3.33
1745 1832 3.194861 TGAACTGTCGAGACTTTGTTGG 58.805 45.455 4.78 0.0 0.00 3.77
2161 3407 3.935818 TTACCCTGTTTCTGGTGTCAA 57.064 42.857 0.00 0.0 36.04 3.18
2202 3448 3.966543 CTGGCGTTTGGTCCCCCT 61.967 66.667 0.00 0.0 0.00 4.79
2203 3449 2.529643 TGGCGTTTGGTCCCCCTA 60.530 61.111 0.00 0.0 0.00 3.53
2226 3472 1.717032 TATAGCCAGACGCCAAGGAT 58.283 50.000 0.00 0.0 38.78 3.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
104 105 3.626924 ACTGGCACCACCGAGTCC 61.627 66.667 0.00 0.00 43.94 3.85
761 800 1.550524 CACCTCTAGCACTTGTGCCTA 59.449 52.381 20.39 11.79 34.90 3.93
1228 1303 5.522460 GTGGTATGTCATATGCGTTAGTTGT 59.478 40.000 0.00 0.00 0.00 3.32
1744 1831 5.678107 GCATTTCTTGGATCTTGTCATCACC 60.678 44.000 0.00 0.00 0.00 4.02
1745 1832 5.125097 AGCATTTCTTGGATCTTGTCATCAC 59.875 40.000 0.00 0.00 0.00 3.06
2161 3407 0.032678 CTTGGCGTCTGGCTATCGAT 59.967 55.000 2.16 2.16 42.94 3.59
2201 3447 3.728076 TGGCGTCTGGCTATAAGTTAG 57.272 47.619 0.00 0.00 42.94 2.34
2202 3448 3.181469 CCTTGGCGTCTGGCTATAAGTTA 60.181 47.826 0.00 0.00 42.94 2.24
2203 3449 2.420129 CCTTGGCGTCTGGCTATAAGTT 60.420 50.000 0.00 0.00 42.94 2.66


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.