Multiple sequence alignment - TraesCS5B01G244600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G244600 chr5B 100.000 2739 0 0 1 2739 426078367 426081105 0 5059
1 TraesCS5B01G244600 chr5B 97.225 2739 75 1 1 2739 570092424 570089687 0 4636
2 TraesCS5B01G244600 chr5B 95.703 2746 108 6 1 2739 49314733 49311991 0 4409
3 TraesCS5B01G244600 chr3B 97.481 2739 68 1 1 2739 170815811 170813074 0 4674
4 TraesCS5B01G244600 chr3B 97.191 2741 74 2 1 2739 12926464 12923725 0 4632
5 TraesCS5B01G244600 chr3B 96.648 2745 83 7 1 2739 725530481 725533222 0 4551
6 TraesCS5B01G244600 chr3B 96.564 2736 92 2 1 2736 770036483 770039216 0 4530
7 TraesCS5B01G244600 chr7B 97.410 2741 69 1 1 2739 379743842 379746582 0 4667
8 TraesCS5B01G244600 chr6B 97.251 2692 71 3 1 2690 673868878 673866188 0 4558


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G244600 chr5B 426078367 426081105 2738 False 5059 5059 100.000 1 2739 1 chr5B.!!$F1 2738
1 TraesCS5B01G244600 chr5B 570089687 570092424 2737 True 4636 4636 97.225 1 2739 1 chr5B.!!$R2 2738
2 TraesCS5B01G244600 chr5B 49311991 49314733 2742 True 4409 4409 95.703 1 2739 1 chr5B.!!$R1 2738
3 TraesCS5B01G244600 chr3B 170813074 170815811 2737 True 4674 4674 97.481 1 2739 1 chr3B.!!$R2 2738
4 TraesCS5B01G244600 chr3B 12923725 12926464 2739 True 4632 4632 97.191 1 2739 1 chr3B.!!$R1 2738
5 TraesCS5B01G244600 chr3B 725530481 725533222 2741 False 4551 4551 96.648 1 2739 1 chr3B.!!$F1 2738
6 TraesCS5B01G244600 chr3B 770036483 770039216 2733 False 4530 4530 96.564 1 2736 1 chr3B.!!$F2 2735
7 TraesCS5B01G244600 chr7B 379743842 379746582 2740 False 4667 4667 97.410 1 2739 1 chr7B.!!$F1 2738
8 TraesCS5B01G244600 chr6B 673866188 673868878 2690 True 4558 4558 97.251 1 2690 1 chr6B.!!$R1 2689

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
520 522 0.107017 CCGAGTCCATGAGGCCAAAT 60.107 55.000 5.01 0.00 33.74 2.32 F
1116 1122 1.064654 GAGGTGCTTGATTCAATCCGC 59.935 52.381 0.00 1.05 0.00 5.54 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1403 1409 1.580845 GCGCATGAAAGCCACAGTCT 61.581 55.000 0.30 0.0 0.0 3.24 R
2064 2071 3.369997 GGGAAACAAGTTGGAAAAAGGCA 60.370 43.478 7.96 0.0 0.0 4.75 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
27 28 1.591059 CAAGATCGAGGAGGCAGCG 60.591 63.158 0.00 0.00 0.00 5.18
121 122 0.911769 CATCAGAAGTGCCACCCCTA 59.088 55.000 0.00 0.00 0.00 3.53
290 291 3.472652 TGAAAGCGTAAATGACCACACT 58.527 40.909 0.00 0.00 0.00 3.55
520 522 0.107017 CCGAGTCCATGAGGCCAAAT 60.107 55.000 5.01 0.00 33.74 2.32
537 539 5.167845 GCCAAATGGTAAAATGTCGACAAT 58.832 37.500 24.13 12.15 37.57 2.71
698 700 4.072131 ACACGGTGAATTCAAGCTAACAT 58.928 39.130 16.29 0.00 0.00 2.71
884 888 6.402334 CGTGGCAATTTGATTGTAAAATGCAT 60.402 34.615 11.81 0.00 44.33 3.96
1116 1122 1.064654 GAGGTGCTTGATTCAATCCGC 59.935 52.381 0.00 1.05 0.00 5.54
1403 1409 3.554324 GTGTCTTTTTCTCGTGCAGTACA 59.446 43.478 0.00 0.00 0.00 2.90
1559 1565 1.300697 GTCCGGAGCACGTGAGTTT 60.301 57.895 22.23 0.20 46.40 2.66
1572 1578 2.288825 CGTGAGTTTGTGGAGGAAGCTA 60.289 50.000 0.00 0.00 0.00 3.32
2064 2071 1.063469 GCTGCGGTTTATGCACGTTAT 59.937 47.619 0.00 0.00 37.44 1.89
2314 2322 2.432510 GGCAGATCCAGTACAACTAGCT 59.567 50.000 0.00 0.00 34.01 3.32
2486 2498 3.795688 TTCCTTCCACTTCTGATGCTT 57.204 42.857 0.00 0.00 0.00 3.91
2489 2501 3.328931 TCCTTCCACTTCTGATGCTTCTT 59.671 43.478 0.88 0.00 0.00 2.52
2653 2668 4.597507 TCTCCAATCCTGACTTGTACCTTT 59.402 41.667 0.00 0.00 0.00 3.11
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
155 156 1.651240 CTCGTAGTCTTCCGCGGGAA 61.651 60.000 27.83 16.94 39.66 3.97
339 341 4.762251 AGCGCATCATGTATAGAGAGTACA 59.238 41.667 11.47 0.00 36.58 2.90
435 437 3.855255 TGGTTCTGTCCAAACATGAGA 57.145 42.857 0.00 0.00 34.13 3.27
520 522 7.356540 CAACTACAATTGTCGACATTTTACCA 58.643 34.615 20.80 2.15 0.00 3.25
537 539 1.378531 GATCCCGCATGCAACTACAA 58.621 50.000 19.57 0.00 0.00 2.41
884 888 1.489481 TGGGTGAACAAAATGTGCCA 58.511 45.000 0.00 0.00 0.00 4.92
1116 1122 3.731652 AGATCTGAATCAGCTTCCGAG 57.268 47.619 5.18 0.00 31.64 4.63
1371 1377 4.209288 CGAGAAAAAGACACAGACGAACAT 59.791 41.667 0.00 0.00 0.00 2.71
1377 1383 2.607635 TGCACGAGAAAAAGACACAGAC 59.392 45.455 0.00 0.00 0.00 3.51
1382 1388 3.787785 TGTACTGCACGAGAAAAAGACA 58.212 40.909 0.00 0.00 0.00 3.41
1403 1409 1.580845 GCGCATGAAAGCCACAGTCT 61.581 55.000 0.30 0.00 0.00 3.24
1559 1565 4.908601 TTTCTTGATAGCTTCCTCCACA 57.091 40.909 0.00 0.00 0.00 4.17
1572 1578 9.956720 CTTGTACTTCTTGTTGATTTTCTTGAT 57.043 29.630 0.00 0.00 0.00 2.57
1907 1913 7.225784 TGTATGTTGAACTACATTTGCCATT 57.774 32.000 7.12 0.00 39.39 3.16
2064 2071 3.369997 GGGAAACAAGTTGGAAAAAGGCA 60.370 43.478 7.96 0.00 0.00 4.75
2314 2322 8.620416 CATGCTACTTTGTACTAAATATGCCAA 58.380 33.333 0.00 0.00 0.00 4.52
2653 2668 3.388841 GGGTCGCCCAAGAGAGAA 58.611 61.111 9.72 0.00 44.65 2.87


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.