Multiple sequence alignment - TraesCS5B01G234900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G234900 chr5B 100.000 2246 0 0 1 2246 413608964 413611209 0.000000e+00 4148
1 TraesCS5B01G234900 chr5B 95.376 2249 71 14 1 2246 432878248 432880466 0.000000e+00 3546
2 TraesCS5B01G234900 chr5B 94.982 2252 52 17 1 2246 429038208 429040404 0.000000e+00 3476
3 TraesCS5B01G234900 chr2D 97.315 2272 33 6 1 2246 33935337 33937606 0.000000e+00 3832
4 TraesCS5B01G234900 chr2D 97.313 2270 34 7 1 2246 630271813 630274079 0.000000e+00 3829
5 TraesCS5B01G234900 chr3B 96.889 2250 43 8 1 2246 201559247 201557021 0.000000e+00 3742
6 TraesCS5B01G234900 chr3B 94.812 2024 85 13 228 2246 703007384 703005376 0.000000e+00 3138
7 TraesCS5B01G234900 chr3B 92.089 1757 62 24 83 1834 260376862 260378546 0.000000e+00 2403
8 TraesCS5B01G234900 chr3B 88.365 318 13 2 1 318 576663230 576662937 5.900000e-96 361
9 TraesCS5B01G234900 chr3B 94.521 146 8 0 1897 2042 654704668 654704813 2.240000e-55 226
10 TraesCS5B01G234900 chr3B 90.551 127 12 0 1854 1980 540191266 540191140 3.840000e-38 169
11 TraesCS5B01G234900 chr3B 96.471 85 3 0 2048 2132 378346937 378346853 8.360000e-30 141
12 TraesCS5B01G234900 chr5A 98.183 1761 26 5 489 2246 482027372 482025615 0.000000e+00 3070
13 TraesCS5B01G234900 chr4A 94.516 1951 78 12 297 2246 219308174 219306252 0.000000e+00 2983
14 TraesCS5B01G234900 chr4D 96.459 1666 53 6 1 1665 245650208 245651868 0.000000e+00 2745
15 TraesCS5B01G234900 chrUn 96.693 1119 13 3 1 1097 371049974 371051090 0.000000e+00 1840
16 TraesCS5B01G234900 chr3A 97.631 971 16 4 1 967 672876907 672875940 0.000000e+00 1659


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G234900 chr5B 413608964 413611209 2245 False 4148 4148 100.000 1 2246 1 chr5B.!!$F1 2245
1 TraesCS5B01G234900 chr5B 432878248 432880466 2218 False 3546 3546 95.376 1 2246 1 chr5B.!!$F3 2245
2 TraesCS5B01G234900 chr5B 429038208 429040404 2196 False 3476 3476 94.982 1 2246 1 chr5B.!!$F2 2245
3 TraesCS5B01G234900 chr2D 33935337 33937606 2269 False 3832 3832 97.315 1 2246 1 chr2D.!!$F1 2245
4 TraesCS5B01G234900 chr2D 630271813 630274079 2266 False 3829 3829 97.313 1 2246 1 chr2D.!!$F2 2245
5 TraesCS5B01G234900 chr3B 201557021 201559247 2226 True 3742 3742 96.889 1 2246 1 chr3B.!!$R1 2245
6 TraesCS5B01G234900 chr3B 703005376 703007384 2008 True 3138 3138 94.812 228 2246 1 chr3B.!!$R5 2018
7 TraesCS5B01G234900 chr3B 260376862 260378546 1684 False 2403 2403 92.089 83 1834 1 chr3B.!!$F1 1751
8 TraesCS5B01G234900 chr5A 482025615 482027372 1757 True 3070 3070 98.183 489 2246 1 chr5A.!!$R1 1757
9 TraesCS5B01G234900 chr4A 219306252 219308174 1922 True 2983 2983 94.516 297 2246 1 chr4A.!!$R1 1949
10 TraesCS5B01G234900 chr4D 245650208 245651868 1660 False 2745 2745 96.459 1 1665 1 chr4D.!!$F1 1664
11 TraesCS5B01G234900 chrUn 371049974 371051090 1116 False 1840 1840 96.693 1 1097 1 chrUn.!!$F1 1096
12 TraesCS5B01G234900 chr3A 672875940 672876907 967 True 1659 1659 97.631 1 967 1 chr3A.!!$R1 966

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
110 111 4.269183 CCATCTACTGCCAACAAATACCA 58.731 43.478 0.0 0.0 0.0 3.25 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2066 2138 1.140312 TGCTTCCCCATGGGTATCTC 58.86 55.0 29.33 14.1 44.74 2.75 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
110 111 4.269183 CCATCTACTGCCAACAAATACCA 58.731 43.478 0.00 0.00 0.00 3.25
1148 1201 2.367241 TGAGAACCGAAGATTGTGTGGA 59.633 45.455 0.00 0.00 0.00 4.02
1238 1292 3.198068 CAACACGTAGCATGGCTCTATT 58.802 45.455 0.00 0.00 40.44 1.73
1440 1497 9.908152 AGGTTCATTAATTTTCTTTTTACCTCG 57.092 29.630 0.00 0.00 0.00 4.63
1850 1921 1.351350 GGGGAAGAGGCGCCTATATTT 59.649 52.381 32.97 20.99 37.84 1.40
2003 2075 5.804979 CCGCAACCTTGGAAATACTTTTATG 59.195 40.000 0.00 0.00 0.00 1.90
2021 2093 8.428852 ACTTTTATGTTTTGGCTTCCTTATTGT 58.571 29.630 0.00 0.00 0.00 2.71
2115 2187 1.676006 ACATGTATGCTTTTAGCGGGC 59.324 47.619 0.00 0.00 46.26 6.13
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1148 1201 5.821470 CAGGCAGATTCACATCTCTTACAAT 59.179 40.000 0.00 0.00 37.71 2.71
1440 1497 5.049886 CACCTAACGACTTTGTTTCCCTTAC 60.050 44.000 0.00 0.00 33.32 2.34
1501 1558 6.828502 TGATAACAGAACGCATAAGTCATC 57.171 37.500 0.00 0.00 0.00 2.92
1832 1900 3.055747 AGCTAAATATAGGCGCCTCTTCC 60.056 47.826 36.73 14.03 0.00 3.46
1833 1901 4.195225 AGCTAAATATAGGCGCCTCTTC 57.805 45.455 36.73 14.16 0.00 2.87
1834 1902 4.527038 TGTAGCTAAATATAGGCGCCTCTT 59.473 41.667 36.73 24.31 0.00 2.85
1980 2052 6.386654 ACATAAAAGTATTTCCAAGGTTGCG 58.613 36.000 0.00 0.00 37.28 4.85
2003 2075 6.873605 AGCATAAACAATAAGGAAGCCAAAAC 59.126 34.615 0.00 0.00 0.00 2.43
2021 2093 4.717233 ATCGGCAATTTGACAGCATAAA 57.283 36.364 2.62 0.00 0.00 1.40
2066 2138 1.140312 TGCTTCCCCATGGGTATCTC 58.860 55.000 29.33 14.10 44.74 2.75


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.