Multiple sequence alignment - TraesCS5B01G234800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G234800 chr5B 100.000 2306 0 0 1 2306 413608181 413610486 0 4259
1 TraesCS5B01G234800 chr5B 95.839 2307 73 12 1 2306 432877470 432879754 0 3707
2 TraesCS5B01G234800 chr2D 97.295 2329 30 6 1 2306 33934562 33936880 0 3921
3 TraesCS5B01G234800 chr2D 97.251 2328 31 7 1 2306 630271039 630273355 0 3914
4 TraesCS5B01G234800 chr3B 97.270 2308 40 7 1 2306 201560028 201557742 0 3892
5 TraesCS5B01G234800 chr3B 95.605 1297 49 8 1011 2305 703007384 703006094 0 2073
6 TraesCS5B01G234800 chr4D 96.489 2307 71 9 1 2306 245649429 245651726 0 3803
7 TraesCS5B01G234800 chr4A 94.972 2307 90 10 1 2306 310763152 310765433 0 3594
8 TraesCS5B01G234800 chr4A 94.055 1228 49 11 1080 2306 219308174 219306970 0 1842
9 TraesCS5B01G234800 chr1A 95.597 2044 59 11 265 2306 371922144 371924158 0 3247
10 TraesCS5B01G234800 chrUn 97.511 1808 20 4 95 1880 371049286 371051090 0 3066
11 TraesCS5B01G234800 chr3A 97.491 1754 33 7 1 1750 672877686 672875940 0 2985
12 TraesCS5B01G234800 chr5D 96.671 1382 38 7 1 1380 432291974 432290599 0 2290
13 TraesCS5B01G234800 chr1B 98.006 1304 22 3 1 1304 633728118 633726819 0 2261
14 TraesCS5B01G234800 chr3D 94.452 1442 47 10 866 2306 182097139 182098548 0 2189
15 TraesCS5B01G234800 chr5A 98.454 1035 13 3 1272 2305 482027372 482026340 0 1820


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G234800 chr5B 413608181 413610486 2305 False 4259 4259 100.000 1 2306 1 chr5B.!!$F1 2305
1 TraesCS5B01G234800 chr5B 432877470 432879754 2284 False 3707 3707 95.839 1 2306 1 chr5B.!!$F2 2305
2 TraesCS5B01G234800 chr2D 33934562 33936880 2318 False 3921 3921 97.295 1 2306 1 chr2D.!!$F1 2305
3 TraesCS5B01G234800 chr2D 630271039 630273355 2316 False 3914 3914 97.251 1 2306 1 chr2D.!!$F2 2305
4 TraesCS5B01G234800 chr3B 201557742 201560028 2286 True 3892 3892 97.270 1 2306 1 chr3B.!!$R1 2305
5 TraesCS5B01G234800 chr3B 703006094 703007384 1290 True 2073 2073 95.605 1011 2305 1 chr3B.!!$R2 1294
6 TraesCS5B01G234800 chr4D 245649429 245651726 2297 False 3803 3803 96.489 1 2306 1 chr4D.!!$F1 2305
7 TraesCS5B01G234800 chr4A 310763152 310765433 2281 False 3594 3594 94.972 1 2306 1 chr4A.!!$F1 2305
8 TraesCS5B01G234800 chr4A 219306970 219308174 1204 True 1842 1842 94.055 1080 2306 1 chr4A.!!$R1 1226
9 TraesCS5B01G234800 chr1A 371922144 371924158 2014 False 3247 3247 95.597 265 2306 1 chr1A.!!$F1 2041
10 TraesCS5B01G234800 chrUn 371049286 371051090 1804 False 3066 3066 97.511 95 1880 1 chrUn.!!$F1 1785
11 TraesCS5B01G234800 chr3A 672875940 672877686 1746 True 2985 2985 97.491 1 1750 1 chr3A.!!$R1 1749
12 TraesCS5B01G234800 chr5D 432290599 432291974 1375 True 2290 2290 96.671 1 1380 1 chr5D.!!$R1 1379
13 TraesCS5B01G234800 chr1B 633726819 633728118 1299 True 2261 2261 98.006 1 1304 1 chr1B.!!$R1 1303
14 TraesCS5B01G234800 chr3D 182097139 182098548 1409 False 2189 2189 94.452 866 2306 1 chr3D.!!$F1 1440
15 TraesCS5B01G234800 chr5A 482026340 482027372 1032 True 1820 1820 98.454 1272 2305 1 chr5A.!!$R1 1033

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
551 553 3.515602 ATTGGACTATTGGAGATGGGC 57.484 47.619 0.0 0.0 0.0 5.36 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2223 2308 5.049886 CACCTAACGACTTTGTTTCCCTTAC 60.05 44.0 0.0 0.0 33.32 2.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
551 553 3.515602 ATTGGACTATTGGAGATGGGC 57.484 47.619 0.0 0.0 0.00 5.36
573 575 5.062308 GGCTCACTTCACTCGTTTGTATAAG 59.938 44.000 0.0 0.0 0.00 1.73
793 795 4.576463 ACTATGGCTCGGCAATAAGAAAAG 59.424 41.667 0.0 0.0 0.00 2.27
893 895 4.269183 CCATCTACTGCCAACAAATACCA 58.731 43.478 0.0 0.0 0.00 3.25
1931 1998 2.367241 TGAGAACCGAAGATTGTGTGGA 59.633 45.455 0.0 0.0 0.00 4.02
2021 2089 3.198068 CAACACGTAGCATGGCTCTATT 58.802 45.455 0.0 0.0 40.44 1.73
2223 2308 9.908152 AGGTTCATTAATTTTCTTTTTACCTCG 57.092 29.630 0.0 0.0 0.00 4.63
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
360 362 3.009143 AGAACTAATCCCAGCGAAAAGGT 59.991 43.478 0.0 0.0 0.00 3.50
551 553 8.912787 ATACTTATACAAACGAGTGAAGTGAG 57.087 34.615 0.0 0.0 33.65 3.51
702 704 6.972722 TCAAACGGAAGATAAAAATCGGTTT 58.027 32.000 0.0 0.0 43.16 3.27
1931 1998 5.821470 CAGGCAGATTCACATCTCTTACAAT 59.179 40.000 0.0 0.0 37.71 2.71
2223 2308 5.049886 CACCTAACGACTTTGTTTCCCTTAC 60.050 44.000 0.0 0.0 33.32 2.34


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.