Multiple sequence alignment - TraesCS5B01G233600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G233600 chr5B 100.000 3108 0 0 1 3108 411793920 411797027 0 5740
1 TraesCS5B01G233600 chr2A 98.778 3109 36 2 1 3108 305827729 305824622 0 5529
2 TraesCS5B01G233600 chr2A 96.890 2122 63 3 1 2119 628570215 628572336 0 3550
3 TraesCS5B01G233600 chr2A 96.843 2122 62 5 1 2119 374484085 374486204 0 3542
4 TraesCS5B01G233600 chr2A 94.458 1624 78 7 1490 3108 756945365 756943749 0 2490
5 TraesCS5B01G233600 chr4B 93.301 3120 188 15 1 3108 256159485 256156375 0 4584
6 TraesCS5B01G233600 chr7B 99.122 2164 15 4 1 2162 630136366 630134205 0 3888
7 TraesCS5B01G233600 chr7D 97.314 2122 52 5 1 2119 474677356 474679475 0 3598
8 TraesCS5B01G233600 chr1B 97.124 2121 59 2 1 2119 95492451 95494571 0 3578
9 TraesCS5B01G233600 chr1B 96.890 2122 62 4 1 2119 530763714 530761594 0 3550
10 TraesCS5B01G233600 chr2B 96.747 2121 67 2 1 2119 424684607 424682487 0 3533
11 TraesCS5B01G233600 chr7A 95.068 1622 69 7 1490 3108 2870254 2871867 0 2542
12 TraesCS5B01G233600 chr7A 94.277 1625 80 7 1490 3108 85878818 85877201 0 2473
13 TraesCS5B01G233600 chr6A 94.516 1623 78 7 1490 3108 604391783 604393398 0 2494
14 TraesCS5B01G233600 chr3A 94.390 1622 80 7 1490 3108 26421876 26420263 0 2481
15 TraesCS5B01G233600 chr4A 94.338 1625 79 7 1490 3108 684408419 684410036 0 2479
16 TraesCS5B01G233600 chr6B 95.349 1118 50 2 1992 3108 519185413 519186529 0 1775


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G233600 chr5B 411793920 411797027 3107 False 5740 5740 100.000 1 3108 1 chr5B.!!$F1 3107
1 TraesCS5B01G233600 chr2A 305824622 305827729 3107 True 5529 5529 98.778 1 3108 1 chr2A.!!$R1 3107
2 TraesCS5B01G233600 chr2A 628570215 628572336 2121 False 3550 3550 96.890 1 2119 1 chr2A.!!$F2 2118
3 TraesCS5B01G233600 chr2A 374484085 374486204 2119 False 3542 3542 96.843 1 2119 1 chr2A.!!$F1 2118
4 TraesCS5B01G233600 chr2A 756943749 756945365 1616 True 2490 2490 94.458 1490 3108 1 chr2A.!!$R2 1618
5 TraesCS5B01G233600 chr4B 256156375 256159485 3110 True 4584 4584 93.301 1 3108 1 chr4B.!!$R1 3107
6 TraesCS5B01G233600 chr7B 630134205 630136366 2161 True 3888 3888 99.122 1 2162 1 chr7B.!!$R1 2161
7 TraesCS5B01G233600 chr7D 474677356 474679475 2119 False 3598 3598 97.314 1 2119 1 chr7D.!!$F1 2118
8 TraesCS5B01G233600 chr1B 95492451 95494571 2120 False 3578 3578 97.124 1 2119 1 chr1B.!!$F1 2118
9 TraesCS5B01G233600 chr1B 530761594 530763714 2120 True 3550 3550 96.890 1 2119 1 chr1B.!!$R1 2118
10 TraesCS5B01G233600 chr2B 424682487 424684607 2120 True 3533 3533 96.747 1 2119 1 chr2B.!!$R1 2118
11 TraesCS5B01G233600 chr7A 2870254 2871867 1613 False 2542 2542 95.068 1490 3108 1 chr7A.!!$F1 1618
12 TraesCS5B01G233600 chr7A 85877201 85878818 1617 True 2473 2473 94.277 1490 3108 1 chr7A.!!$R1 1618
13 TraesCS5B01G233600 chr6A 604391783 604393398 1615 False 2494 2494 94.516 1490 3108 1 chr6A.!!$F1 1618
14 TraesCS5B01G233600 chr3A 26420263 26421876 1613 True 2481 2481 94.390 1490 3108 1 chr3A.!!$R1 1618
15 TraesCS5B01G233600 chr4A 684408419 684410036 1617 False 2479 2479 94.338 1490 3108 1 chr4A.!!$F1 1618
16 TraesCS5B01G233600 chr6B 519185413 519186529 1116 False 1775 1775 95.349 1992 3108 1 chr6B.!!$F1 1116

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
345 346 2.933878 AAGGAGTTTGCACGCGGTCA 62.934 55.000 12.47 4.48 0.00 4.02 F
1764 1774 6.072175 GGAGGTGTATGTGCAAGAAAACATTA 60.072 38.462 0.00 0.00 38.05 1.90 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1766 1776 1.515521 GAGTTTGTTGGGGCTCCACG 61.516 60.0 3.6 0.0 43.94 4.94 R
3019 3035 5.121611 TGCTAATCCATACACAAAGACAACG 59.878 40.0 0.0 0.0 0.00 4.10 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
345 346 2.933878 AAGGAGTTTGCACGCGGTCA 62.934 55.000 12.47 4.48 0.00 4.02
925 933 6.352823 GGTCTCCCAAAGGTAATAAACTAGCT 60.353 42.308 0.00 0.00 0.00 3.32
1764 1774 6.072175 GGAGGTGTATGTGCAAGAAAACATTA 60.072 38.462 0.00 0.00 38.05 1.90
1766 1776 5.861787 GGTGTATGTGCAAGAAAACATTACC 59.138 40.000 0.00 0.00 38.05 2.85
2794 2809 6.374333 GCTAAACCATATTCTGAAAGTGACCA 59.626 38.462 0.00 0.00 33.76 4.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
345 346 1.002659 TGTGATTTTGGGGTCGACGAT 59.997 47.619 9.92 0.0 0.00 3.73
925 933 5.713389 TCCCGACTAGAGAAATAAAGTCACA 59.287 40.000 0.00 0.0 38.60 3.58
1764 1774 3.063197 TTTGTTGGGGCTCCACGGT 62.063 57.895 3.60 0.0 43.94 4.83
1766 1776 1.515521 GAGTTTGTTGGGGCTCCACG 61.516 60.000 3.60 0.0 43.94 4.94
2762 2777 9.770097 CTTTCAGAATATGGTTTAGCATCTCTA 57.230 33.333 0.00 0.0 0.00 2.43
3019 3035 5.121611 TGCTAATCCATACACAAAGACAACG 59.878 40.000 0.00 0.0 0.00 4.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.