Multiple sequence alignment - TraesCS5B01G229700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G229700 chr5B 100.000 2617 0 0 1 2617 406870218 406867602 0 4833
1 TraesCS5B01G229700 chr5B 99.160 2618 20 2 1 2617 179227396 179230012 0 4711
2 TraesCS5B01G229700 chr2A 99.159 2617 22 0 1 2617 719454171 719456787 0 4711
3 TraesCS5B01G229700 chr2A 99.121 2618 20 3 1 2617 43380667 43383282 0 4704
4 TraesCS5B01G229700 chr7B 99.083 2617 22 2 1 2617 528879880 528882494 0 4698
5 TraesCS5B01G229700 chr6B 99.083 2617 23 1 1 2617 408662339 408664954 0 4698
6 TraesCS5B01G229700 chr6B 99.007 2619 23 3 1 2617 704850307 704847690 0 4689
7 TraesCS5B01G229700 chr4B 98.779 2621 27 5 1 2617 194219534 194222153 0 4658
8 TraesCS5B01G229700 chr7A 98.358 2618 23 7 1 2617 171419030 171421628 0 4578
9 TraesCS5B01G229700 chr1A 99.050 2420 22 1 198 2617 567477552 567475134 0 4340


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G229700 chr5B 406867602 406870218 2616 True 4833 4833 100.000 1 2617 1 chr5B.!!$R1 2616
1 TraesCS5B01G229700 chr5B 179227396 179230012 2616 False 4711 4711 99.160 1 2617 1 chr5B.!!$F1 2616
2 TraesCS5B01G229700 chr2A 719454171 719456787 2616 False 4711 4711 99.159 1 2617 1 chr2A.!!$F2 2616
3 TraesCS5B01G229700 chr2A 43380667 43383282 2615 False 4704 4704 99.121 1 2617 1 chr2A.!!$F1 2616
4 TraesCS5B01G229700 chr7B 528879880 528882494 2614 False 4698 4698 99.083 1 2617 1 chr7B.!!$F1 2616
5 TraesCS5B01G229700 chr6B 408662339 408664954 2615 False 4698 4698 99.083 1 2617 1 chr6B.!!$F1 2616
6 TraesCS5B01G229700 chr6B 704847690 704850307 2617 True 4689 4689 99.007 1 2617 1 chr6B.!!$R1 2616
7 TraesCS5B01G229700 chr4B 194219534 194222153 2619 False 4658 4658 98.779 1 2617 1 chr4B.!!$F1 2616
8 TraesCS5B01G229700 chr7A 171419030 171421628 2598 False 4578 4578 98.358 1 2617 1 chr7A.!!$F1 2616
9 TraesCS5B01G229700 chr1A 567475134 567477552 2418 True 4340 4340 99.050 198 2617 1 chr1A.!!$R1 2419

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
790 792 0.250234 ACCTGCAGCGCAAGAATCTA 59.75 50.0 11.47 0.0 38.41 1.98 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2335 2342 0.523966 CAATAAACGGCGCAAAGGGA 59.476 50.0 10.83 0.0 0.0 4.2 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
541 543 5.067954 GCCTGGGTTTAGTTTCTTACTTGA 58.932 41.667 0.00 0.00 38.33 3.02
591 593 7.201688 GGTTTTTCTGGTTTAAATGTTGCACAT 60.202 33.333 0.00 0.00 41.31 3.21
790 792 0.250234 ACCTGCAGCGCAAGAATCTA 59.750 50.000 11.47 0.00 38.41 1.98
1099 1101 2.989639 CTGATGACGGAGGGGCAA 59.010 61.111 0.00 0.00 0.00 4.52
1363 1365 3.895232 AGTACTTGAGATCGCACCAAT 57.105 42.857 0.00 0.00 0.00 3.16
1738 1741 6.923199 TGTATATTTACTACCTGCCTACCC 57.077 41.667 0.00 0.00 0.00 3.69
2510 2517 1.597797 CCAGGACATTGCAATGGCGT 61.598 55.000 35.85 33.07 45.60 5.68
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
541 543 7.448469 ACCAAAGCTAGTTAGTTTGATGTCAAT 59.552 33.333 9.30 0.0 35.55 2.57
790 792 1.898863 AGGGTATGGCCATCAGTCTT 58.101 50.000 24.80 0.0 39.65 3.01
1363 1365 3.561313 GCCTTTTCTTCTGGTGGGATACA 60.561 47.826 0.00 0.0 39.74 2.29
2335 2342 0.523966 CAATAAACGGCGCAAAGGGA 59.476 50.000 10.83 0.0 0.00 4.20


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.