Multiple sequence alignment - TraesCS5B01G218300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G218300 chr5B 100.000 2375 0 0 1 2375 392056161 392058535 0.000000e+00 4386
1 TraesCS5B01G218300 chr5B 98.695 2375 30 1 1 2375 392100001 392102374 0.000000e+00 4213
2 TraesCS5B01G218300 chr5B 98.681 2350 31 0 1 2350 392041140 392043489 0.000000e+00 4169
3 TraesCS5B01G218300 chr5B 100.000 1583 0 0 2737 4319 392058897 392060479 0.000000e+00 2924
4 TraesCS5B01G218300 chr5B 98.800 1583 19 0 2737 4319 392102408 392103990 0.000000e+00 2819
5 TraesCS5B01G218300 chr5B 98.658 1565 19 2 2756 4319 392043689 392045252 0.000000e+00 2772
6 TraesCS5B01G218300 chr3A 93.959 2152 130 0 224 2375 601342346 601340195 0.000000e+00 3254
7 TraesCS5B01G218300 chr3A 95.016 1585 76 3 2737 4319 601340161 601338578 0.000000e+00 2486
8 TraesCS5B01G218300 chr2A 93.123 2152 130 4 224 2375 718926329 718924196 0.000000e+00 3138
9 TraesCS5B01G218300 chr2A 94.760 1584 81 2 2737 4319 718924162 718922580 0.000000e+00 2464
10 TraesCS5B01G218300 chr2A 94.529 1572 84 2 2749 4319 678126321 678127891 0.000000e+00 2425
11 TraesCS5B01G218300 chr2A 92.912 1298 88 3 1080 2375 207350187 207348892 0.000000e+00 1884
12 TraesCS5B01G218300 chr2A 93.786 1207 72 1 1172 2375 678124781 678125987 0.000000e+00 1810
13 TraesCS5B01G218300 chr1B 98.359 1584 25 1 2737 4319 42064864 42063281 0.000000e+00 2780
14 TraesCS5B01G218300 chr1B 97.143 805 19 2 1572 2375 42065699 42064898 0.000000e+00 1356
15 TraesCS5B01G218300 chr3B 97.050 1593 37 2 2737 4319 373619446 373617854 0.000000e+00 2673
16 TraesCS5B01G218300 chr3B 96.654 1584 52 1 2737 4319 28333463 28331880 0.000000e+00 2630
17 TraesCS5B01G218300 chr3B 96.015 527 21 0 1849 2375 28334022 28333496 0.000000e+00 857
18 TraesCS5B01G218300 chr6B 96.212 1584 53 3 2737 4319 602486818 602488395 0.000000e+00 2586
19 TraesCS5B01G218300 chr6B 93.242 873 55 4 1505 2375 663186274 663187144 0.000000e+00 1282
20 TraesCS5B01G218300 chrUn 99.584 1201 5 0 604 1804 426443589 426444789 0.000000e+00 2191
21 TraesCS5B01G218300 chrUn 99.584 1201 5 0 604 1804 426444890 426446090 0.000000e+00 2191
22 TraesCS5B01G218300 chrUn 100.000 1141 0 0 1 1141 429314997 429313857 0.000000e+00 2108
23 TraesCS5B01G218300 chrUn 100.000 542 0 0 1 542 435172869 435173410 0.000000e+00 1002
24 TraesCS5B01G218300 chr4A 84.960 1609 208 14 297 1895 722138936 722140520 0.000000e+00 1600
25 TraesCS5B01G218300 chr7A 79.594 2166 365 49 222 2374 500180632 500182733 0.000000e+00 1480
26 TraesCS5B01G218300 chr2D 90.710 183 16 1 1 183 568792902 568792721 4.320000e-60 243
27 TraesCS5B01G218300 chr5D 89.617 183 19 0 1 183 217054592 217054410 2.600000e-57 233
28 TraesCS5B01G218300 chr5D 89.071 183 20 0 1 183 502702898 502702716 1.210000e-55 228
29 TraesCS5B01G218300 chr1D 90.000 180 18 0 1 180 42005324 42005503 2.600000e-57 233
30 TraesCS5B01G218300 chr6D 89.189 185 18 1 1 183 7001287 7001103 3.360000e-56 230


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G218300 chr5B 392056161 392060479 4318 False 3655.0 4386 100.0000 1 4319 2 chr5B.!!$F2 4318
1 TraesCS5B01G218300 chr5B 392100001 392103990 3989 False 3516.0 4213 98.7475 1 4319 2 chr5B.!!$F3 4318
2 TraesCS5B01G218300 chr5B 392041140 392045252 4112 False 3470.5 4169 98.6695 1 4319 2 chr5B.!!$F1 4318
3 TraesCS5B01G218300 chr3A 601338578 601342346 3768 True 2870.0 3254 94.4875 224 4319 2 chr3A.!!$R1 4095
4 TraesCS5B01G218300 chr2A 718922580 718926329 3749 True 2801.0 3138 93.9415 224 4319 2 chr2A.!!$R2 4095
5 TraesCS5B01G218300 chr2A 678124781 678127891 3110 False 2117.5 2425 94.1575 1172 4319 2 chr2A.!!$F1 3147
6 TraesCS5B01G218300 chr2A 207348892 207350187 1295 True 1884.0 1884 92.9120 1080 2375 1 chr2A.!!$R1 1295
7 TraesCS5B01G218300 chr1B 42063281 42065699 2418 True 2068.0 2780 97.7510 1572 4319 2 chr1B.!!$R1 2747
8 TraesCS5B01G218300 chr3B 373617854 373619446 1592 True 2673.0 2673 97.0500 2737 4319 1 chr3B.!!$R1 1582
9 TraesCS5B01G218300 chr3B 28331880 28334022 2142 True 1743.5 2630 96.3345 1849 4319 2 chr3B.!!$R2 2470
10 TraesCS5B01G218300 chr6B 602486818 602488395 1577 False 2586.0 2586 96.2120 2737 4319 1 chr6B.!!$F1 1582
11 TraesCS5B01G218300 chr6B 663186274 663187144 870 False 1282.0 1282 93.2420 1505 2375 1 chr6B.!!$F2 870
12 TraesCS5B01G218300 chrUn 426443589 426446090 2501 False 2191.0 2191 99.5840 604 1804 2 chrUn.!!$F2 1200
13 TraesCS5B01G218300 chrUn 429313857 429314997 1140 True 2108.0 2108 100.0000 1 1141 1 chrUn.!!$R1 1140
14 TraesCS5B01G218300 chrUn 435172869 435173410 541 False 1002.0 1002 100.0000 1 542 1 chrUn.!!$F1 541
15 TraesCS5B01G218300 chr4A 722138936 722140520 1584 False 1600.0 1600 84.9600 297 1895 1 chr4A.!!$F1 1598
16 TraesCS5B01G218300 chr7A 500180632 500182733 2101 False 1480.0 1480 79.5940 222 2374 1 chr7A.!!$F1 2152

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1376 1378 0.891373 CGGCAACTCCTCTCTCTTCA 59.109 55.0 0.0 0.0 0.0 3.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3329 4116 0.250295 CGGACCAACACACATGGACT 60.25 55.0 0.0 0.0 40.56 3.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1376 1378 0.891373 CGGCAACTCCTCTCTCTTCA 59.109 55.000 0.00 0.0 0.00 3.02
2289 3018 0.389166 GAGGCTCGGACTGTGACAAG 60.389 60.000 0.00 0.0 0.00 3.16
3004 3782 1.152756 GAACAAGGGTGGTGCTGGT 60.153 57.895 0.00 0.0 0.00 4.00
3209 3987 2.507944 GACGCCCTCATCCAGCAT 59.492 61.111 0.00 0.0 0.00 3.79
3412 4200 1.391157 GGTTGTGTGTGGCATGTGGT 61.391 55.000 0.00 0.0 0.00 4.16
3482 4270 4.009370 TGTTATGTGTTGGAATGTCCGA 57.991 40.909 0.00 0.0 40.17 4.55
3528 4316 0.899019 TACTGTCAGCGCCACCATTA 59.101 50.000 2.29 0.0 0.00 1.90
4097 4886 2.740981 CACCACTTTCAGCACTCATCTC 59.259 50.000 0.00 0.0 0.00 2.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
2289 3018 1.227674 GATGGGACCGCCAGATGTC 60.228 63.158 0.00 0.00 35.15 3.06
2792 3523 2.895865 CCAGCTGGCTGCAGATCG 60.896 66.667 22.33 4.98 45.94 3.69
3209 3987 1.384502 CATAGCACCCTCCCCTCCA 60.385 63.158 0.00 0.00 0.00 3.86
3279 4066 5.436175 TCCAACTCAAAGACATCAACTTGA 58.564 37.500 0.00 0.00 0.00 3.02
3329 4116 0.250295 CGGACCAACACACATGGACT 60.250 55.000 0.00 0.00 40.56 3.85
3412 4200 2.960384 TGGAGTACACTTCCGAACTTGA 59.040 45.455 0.00 0.00 0.00 3.02
3482 4270 0.325296 TATCCGGACAGTTGAGGCCT 60.325 55.000 6.12 3.86 0.00 5.19
3528 4316 4.157289 CACAATATGGCAAGAAGAAGCAGT 59.843 41.667 0.00 0.00 0.00 4.40
3568 4356 1.995484 AGATGTCGACATTGTGAAGCG 59.005 47.619 30.46 0.00 36.57 4.68
4097 4886 2.182030 GACGAGAGGGCGTGAAGG 59.818 66.667 0.00 0.00 45.72 3.46


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.