Multiple sequence alignment - TraesCS5B01G216500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G216500 chr5B 100.000 2459 0 0 1 2459 390522930 390525388 0.000000e+00 4542.0
1 TraesCS5B01G216500 chr5B 99.471 2459 13 0 1 2459 390402065 390404523 0.000000e+00 4470.0
2 TraesCS5B01G216500 chr5B 92.386 197 14 1 2099 2295 437687290 437687095 1.860000e-71 279.0
3 TraesCS5B01G216500 chr5B 84.286 140 18 2 2313 2448 472682784 472682645 1.530000e-27 134.0
4 TraesCS5B01G216500 chr5D 92.308 1313 52 17 520 1800 333978450 333979745 0.000000e+00 1820.0
5 TraesCS5B01G216500 chr5D 85.897 156 14 4 1952 2107 333979865 333980012 2.530000e-35 159.0
6 TraesCS5B01G216500 chr5D 84.768 151 18 3 2313 2459 391906907 391906758 1.970000e-31 147.0
7 TraesCS5B01G216500 chr5D 87.000 100 12 1 1318 1417 287402078 287402176 7.190000e-21 111.0
8 TraesCS5B01G216500 chr5A 92.651 762 37 5 717 1471 435475522 435476271 0.000000e+00 1079.0
9 TraesCS5B01G216500 chr5A 87.952 332 19 5 1470 1800 435476299 435476610 2.990000e-99 372.0
10 TraesCS5B01G216500 chr5A 85.870 276 27 9 1000 1272 662064160 662063894 1.440000e-72 283.0
11 TraesCS5B01G216500 chr5A 86.574 216 11 7 520 717 435471741 435471956 3.180000e-54 222.0
12 TraesCS5B01G216500 chr5A 82.041 245 31 10 1097 1333 661666749 661666988 1.930000e-46 196.0
13 TraesCS5B01G216500 chr5A 83.333 156 18 4 1952 2107 435476759 435476906 1.190000e-28 137.0
14 TraesCS5B01G216500 chr5A 82.759 87 6 3 1891 1968 435476619 435476705 4.390000e-08 69.4
15 TraesCS5B01G216500 chrUn 100.000 442 0 0 767 1208 475903559 475903118 0.000000e+00 817.0
16 TraesCS5B01G216500 chrUn 94.595 185 10 0 2105 2289 52887539 52887723 1.110000e-73 287.0
17 TraesCS5B01G216500 chrUn 94.595 185 10 0 2105 2289 311299404 311299588 1.110000e-73 287.0
18 TraesCS5B01G216500 chrUn 94.595 185 10 0 2105 2289 311303305 311303489 1.110000e-73 287.0
19 TraesCS5B01G216500 chr7B 89.655 377 37 2 1 375 485470836 485471212 1.710000e-131 479.0
20 TraesCS5B01G216500 chr7B 88.360 378 42 2 1 376 657537291 657536914 1.040000e-123 453.0
21 TraesCS5B01G216500 chr7B 84.507 142 21 1 1318 1459 63582651 63582791 3.300000e-29 139.0
22 TraesCS5B01G216500 chr2A 89.125 377 39 1 1 375 25342451 25342827 3.700000e-128 468.0
23 TraesCS5B01G216500 chr2A 88.859 377 40 2 1 375 25336960 25337336 1.720000e-126 462.0
24 TraesCS5B01G216500 chr2A 84.028 144 18 2 2314 2453 672507639 672507781 1.530000e-27 134.0
25 TraesCS5B01G216500 chr1A 88.859 377 40 1 1 375 62486103 62486479 1.720000e-126 462.0
26 TraesCS5B01G216500 chr1A 88.624 378 40 2 1 375 62480610 62480987 8.010000e-125 457.0
27 TraesCS5B01G216500 chr6A 88.594 377 41 1 1 375 457320153 457320529 8.010000e-125 457.0
28 TraesCS5B01G216500 chr6A 93.956 182 11 0 2108 2289 61705493 61705312 2.410000e-70 276.0
29 TraesCS5B01G216500 chr1D 88.564 376 41 1 2 375 474829517 474829892 2.880000e-124 455.0
30 TraesCS5B01G216500 chr4B 86.957 276 27 7 1000 1272 609575075 609575344 3.970000e-78 302.0
31 TraesCS5B01G216500 chr4B 89.865 148 11 4 1097 1241 610244401 610244255 1.160000e-43 187.0
32 TraesCS5B01G216500 chr4B 82.843 204 21 10 1034 1234 610098185 610097993 1.170000e-38 171.0
33 TraesCS5B01G216500 chr4B 78.231 147 25 5 2305 2444 653423685 653423539 1.210000e-13 87.9
34 TraesCS5B01G216500 chr3B 93.401 197 12 1 2099 2295 827034250 827034055 8.600000e-75 291.0
35 TraesCS5B01G216500 chr3B 93.401 197 12 1 2099 2295 827580302 827580107 8.600000e-75 291.0
36 TraesCS5B01G216500 chr7D 94.022 184 11 0 2106 2289 55191340 55191523 1.860000e-71 279.0
37 TraesCS5B01G216500 chr4D 84.783 276 30 7 1000 1272 481338663 481338929 1.450000e-67 267.0
38 TraesCS5B01G216500 chr6B 90.780 141 11 2 381 519 54656482 54656342 1.160000e-43 187.0
39 TraesCS5B01G216500 chr7A 84.153 183 21 8 1034 1215 718294751 718294576 1.170000e-38 171.0
40 TraesCS5B01G216500 chr1B 90.476 126 8 4 390 512 29085735 29085859 1.960000e-36 163.0
41 TraesCS5B01G216500 chr1B 86.275 51 6 1 1823 1873 6540867 6540916 1.000000e-03 54.7
42 TraesCS5B01G216500 chr4A 88.550 131 9 5 390 516 11834704 11834832 1.180000e-33 154.0
43 TraesCS5B01G216500 chr4A 85.106 141 15 4 2313 2448 581272428 581272567 3.300000e-29 139.0
44 TraesCS5B01G216500 chr4A 85.106 141 15 4 2312 2448 692086315 692086453 3.300000e-29 139.0
45 TraesCS5B01G216500 chr2B 85.507 138 17 2 2314 2448 797586565 797586702 9.170000e-30 141.0
46 TraesCS5B01G216500 chr2B 82.394 142 24 1 1318 1459 772711400 772711260 3.320000e-24 122.0
47 TraesCS5B01G216500 chr2B 95.652 46 2 0 2399 2444 448261391 448261436 9.430000e-10 75.0
48 TraesCS5B01G216500 chr3A 85.821 134 15 4 390 519 744678075 744678208 3.300000e-29 139.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G216500 chr5B 390522930 390525388 2458 False 4542.00 4542 100.0000 1 2459 1 chr5B.!!$F2 2458
1 TraesCS5B01G216500 chr5B 390402065 390404523 2458 False 4470.00 4470 99.4710 1 2459 1 chr5B.!!$F1 2458
2 TraesCS5B01G216500 chr5D 333978450 333980012 1562 False 989.50 1820 89.1025 520 2107 2 chr5D.!!$F2 1587
3 TraesCS5B01G216500 chr5A 435471741 435476906 5165 False 375.88 1079 86.6538 520 2107 5 chr5A.!!$F2 1587
4 TraesCS5B01G216500 chrUn 311299404 311303489 4085 False 287.00 287 94.5950 2105 2289 2 chrUn.!!$F2 184

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
27 28 0.529992 GGTTTATGGGGAGCGTCTCG 60.53 60.0 1.64 0.0 0.0 4.04 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2237 9836 1.525197 GCGGCAACCTTTAAAAACAGC 59.475 47.619 0.0 0.0 0.0 4.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
27 28 0.529992 GGTTTATGGGGAGCGTCTCG 60.530 60.000 1.64 0.0 0.00 4.04
335 336 2.027285 TGCCATGCTTACTGCTTACTCA 60.027 45.455 0.00 0.0 43.37 3.41
2311 9910 8.783660 TTGTTATAAGAGATATCACCTCAGGT 57.216 34.615 5.32 0.0 35.62 4.00
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
27 28 3.628280 GACCGGGAGCAGTCGTGTC 62.628 68.421 6.32 0.0 0.0 3.67
335 336 6.483640 GCACTTTTCCGATTAGACTAATCCAT 59.516 38.462 23.51 0.0 41.1 3.41
2237 9836 1.525197 GCGGCAACCTTTAAAAACAGC 59.475 47.619 0.00 0.0 0.0 4.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.