Multiple sequence alignment - TraesCS5B01G201600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G201600 chr5B 100.000 2555 0 0 1 2555 365413001 365410447 0.000000e+00 4719
1 TraesCS5B01G201600 chr5B 99.178 2555 21 0 1 2555 365454120 365451566 0.000000e+00 4602
2 TraesCS5B01G201600 chr2D 95.926 1988 74 5 4 1985 5632720 5630734 0.000000e+00 3216
3 TraesCS5B01G201600 chr2D 95.833 456 14 1 2081 2536 5630542 5630092 0.000000e+00 732
4 TraesCS5B01G201600 chr2A 93.970 1990 115 3 1 1985 105850386 105848397 0.000000e+00 3005
5 TraesCS5B01G201600 chr2A 94.096 1643 92 3 348 1985 105836040 105834398 0.000000e+00 2492
6 TraesCS5B01G201600 chr2A 94.192 551 27 2 1986 2536 105834249 105833704 0.000000e+00 835
7 TraesCS5B01G201600 chr2A 94.192 551 27 2 1986 2536 105848248 105847703 0.000000e+00 835
8 TraesCS5B01G201600 chr7A 94.625 1879 92 5 1 1873 365209167 365211042 0.000000e+00 2902
9 TraesCS5B01G201600 chr4A 94.468 1880 95 7 1 1873 465490238 465492115 0.000000e+00 2887
10 TraesCS5B01G201600 chr6B 96.258 1630 54 6 1 1625 341957022 341958649 0.000000e+00 2665
11 TraesCS5B01G201600 chr6B 96.130 1628 60 3 1 1625 341549216 341550843 0.000000e+00 2654
12 TraesCS5B01G201600 chr6B 94.213 553 25 4 1984 2536 341958904 341959449 0.000000e+00 837
13 TraesCS5B01G201600 chr6B 93.863 554 22 5 1985 2536 341551099 341551642 0.000000e+00 824
14 TraesCS5B01G201600 chr6B 96.078 102 4 0 1882 1983 341958653 341958754 1.570000e-37 167
15 TraesCS5B01G201600 chr6B 93.269 104 7 0 1882 1985 341550847 341550950 1.220000e-33 154
16 TraesCS5B01G201600 chr3A 93.584 1465 84 6 523 1981 405566067 405564607 0.000000e+00 2176
17 TraesCS5B01G201600 chr3A 91.519 566 30 6 1984 2536 405564457 405563897 0.000000e+00 763
18 TraesCS5B01G201600 chr1B 97.865 562 12 0 1424 1985 4828420 4828981 0.000000e+00 972
19 TraesCS5B01G201600 chr1B 96.774 558 13 1 1984 2536 4829123 4829680 0.000000e+00 926
20 TraesCS5B01G201600 chr5A 95.315 555 16 7 1984 2536 704539961 704539415 0.000000e+00 872
21 TraesCS5B01G201600 chr1A 93.638 503 24 4 2045 2547 19983940 19984434 0.000000e+00 745
22 TraesCS5B01G201600 chr1A 90.678 118 8 2 1848 1964 5867092 5867207 1.220000e-33 154
23 TraesCS5B01G201600 chr1D 94.286 105 6 0 1984 2088 446304446 446304342 7.320000e-36 161


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G201600 chr5B 365410447 365413001 2554 True 4719.000000 4719 100.000000 1 2555 1 chr5B.!!$R1 2554
1 TraesCS5B01G201600 chr5B 365451566 365454120 2554 True 4602.000000 4602 99.178000 1 2555 1 chr5B.!!$R2 2554
2 TraesCS5B01G201600 chr2D 5630092 5632720 2628 True 1974.000000 3216 95.879500 4 2536 2 chr2D.!!$R1 2532
3 TraesCS5B01G201600 chr2A 105847703 105850386 2683 True 1920.000000 3005 94.081000 1 2536 2 chr2A.!!$R2 2535
4 TraesCS5B01G201600 chr2A 105833704 105836040 2336 True 1663.500000 2492 94.144000 348 2536 2 chr2A.!!$R1 2188
5 TraesCS5B01G201600 chr7A 365209167 365211042 1875 False 2902.000000 2902 94.625000 1 1873 1 chr7A.!!$F1 1872
6 TraesCS5B01G201600 chr4A 465490238 465492115 1877 False 2887.000000 2887 94.468000 1 1873 1 chr4A.!!$F1 1872
7 TraesCS5B01G201600 chr6B 341957022 341959449 2427 False 1223.000000 2665 95.516333 1 2536 3 chr6B.!!$F2 2535
8 TraesCS5B01G201600 chr6B 341549216 341551642 2426 False 1210.666667 2654 94.420667 1 2536 3 chr6B.!!$F1 2535
9 TraesCS5B01G201600 chr3A 405563897 405566067 2170 True 1469.500000 2176 92.551500 523 2536 2 chr3A.!!$R1 2013
10 TraesCS5B01G201600 chr1B 4828420 4829680 1260 False 949.000000 972 97.319500 1424 2536 2 chr1B.!!$F1 1112
11 TraesCS5B01G201600 chr5A 704539415 704539961 546 True 872.000000 872 95.315000 1984 2536 1 chr5A.!!$R1 552

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
326 327 1.225855 GTGCAACATCAAGACCACGA 58.774 50.0 0.0 0.0 36.32 4.35 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1625 1635 1.015109 CAGCCATGACATGAGACAGC 58.985 55.0 17.24 10.82 0.0 4.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
53 54 3.251484 AGTTCCAGTCTCTTGATTCCCA 58.749 45.455 0.00 0.00 0.00 4.37
326 327 1.225855 GTGCAACATCAAGACCACGA 58.774 50.000 0.00 0.00 36.32 4.35
367 368 5.180492 GTGGATTTTCATGTAAGGTGTTCGA 59.820 40.000 0.00 0.00 0.00 3.71
1051 1058 1.926108 AGCTAGAAGAACCACCGAGT 58.074 50.000 0.00 0.00 0.00 4.18
1334 1343 4.093850 CGTGTCATCTGAATCAGCATTCAA 59.906 41.667 5.18 0.00 46.35 2.69
1504 1513 9.777575 CTTTACTAGTAGACTGAGTAAGCTTTC 57.222 37.037 3.20 0.00 37.08 2.62
1625 1635 7.917505 GGACATTTGCATAGATTCAGTTTTAGG 59.082 37.037 0.00 0.00 0.00 2.69
1994 2162 5.220931 GCCAAAATACTCTGCAACCATAGAG 60.221 44.000 0.00 0.00 44.63 2.43
1995 2163 5.220931 CCAAAATACTCTGCAACCATAGAGC 60.221 44.000 0.00 0.00 43.26 4.09
2240 2420 6.362283 GTGTAACATCCAGCATTTTGTGTAAC 59.638 38.462 0.00 0.00 36.32 2.50
2416 2601 3.561503 GGTGGAAAACGCATGTAGTTTC 58.438 45.455 17.40 12.66 40.49 2.78
2458 2658 8.389779 AGCTTAATTATTTTGGTTTGGTTTGG 57.610 30.769 0.00 0.00 0.00 3.28
2459 2659 7.996066 AGCTTAATTATTTTGGTTTGGTTTGGT 59.004 29.630 0.00 0.00 0.00 3.67
2460 2660 8.625651 GCTTAATTATTTTGGTTTGGTTTGGTT 58.374 29.630 0.00 0.00 0.00 3.67
2546 2746 1.479323 CCCAGGTTTAGTAGTAGCGCA 59.521 52.381 11.47 0.00 0.00 6.09
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
53 54 5.976458 ACATGTTCAAGGTCAAACAAACAT 58.024 33.333 0.00 0.00 38.74 2.71
326 327 1.480137 CCACACCACCAAACAACATGT 59.520 47.619 0.00 0.00 0.00 3.21
642 646 2.509166 TAGTCCACTCCACATCGTCT 57.491 50.000 0.00 0.00 0.00 4.18
1051 1058 1.945394 GACTTGCCGAGATACCGAGTA 59.055 52.381 0.00 0.00 0.00 2.59
1334 1343 3.330701 TCCTAAAGTCCTTCCACTGCAAT 59.669 43.478 0.00 0.00 0.00 3.56
1456 1465 1.133482 AGTTTCCAGACCAAACAGGGG 60.133 52.381 0.00 0.00 43.89 4.79
1504 1513 7.915397 ACTTTCAAAGTACATGTTAAGCAACAG 59.085 33.333 2.30 0.00 43.14 3.16
1625 1635 1.015109 CAGCCATGACATGAGACAGC 58.985 55.000 17.24 10.82 0.00 4.40
1994 2162 4.384056 TGCAGGCTTAGAAGAATATCAGC 58.616 43.478 0.00 0.00 0.00 4.26
1995 2163 6.932356 TTTGCAGGCTTAGAAGAATATCAG 57.068 37.500 0.00 0.00 0.00 2.90
2240 2420 3.672808 TGCAGCATGGGGTTTAAAATTG 58.327 40.909 0.00 0.00 35.86 2.32
2416 2601 1.812571 AGCTAGCATCCAAACCAAACG 59.187 47.619 18.83 0.00 0.00 3.60
2457 2657 0.827368 TCCAGCAACCAAACCAAACC 59.173 50.000 0.00 0.00 0.00 3.27
2458 2658 1.202521 CCTCCAGCAACCAAACCAAAC 60.203 52.381 0.00 0.00 0.00 2.93
2459 2659 1.118838 CCTCCAGCAACCAAACCAAA 58.881 50.000 0.00 0.00 0.00 3.28
2460 2660 0.032615 ACCTCCAGCAACCAAACCAA 60.033 50.000 0.00 0.00 0.00 3.67
2461 2661 0.847373 TACCTCCAGCAACCAAACCA 59.153 50.000 0.00 0.00 0.00 3.67


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.