Multiple sequence alignment - TraesCS5B01G196100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G196100 chr5B 100.000 2638 0 0 1 2638 353930731 353928094 0.000000e+00 4872.0
1 TraesCS5B01G196100 chr5B 98.032 2642 44 4 1 2638 18184116 18186753 0.000000e+00 4584.0
2 TraesCS5B01G196100 chr5B 94.350 2124 62 22 1 2071 123786978 123789096 0.000000e+00 3205.0
3 TraesCS5B01G196100 chr5B 93.854 602 23 9 2039 2638 123789100 123789689 0.000000e+00 894.0
4 TraesCS5B01G196100 chr5B 93.012 601 31 4 2039 2638 514052848 514053438 0.000000e+00 867.0
5 TraesCS5B01G196100 chr5B 87.556 675 64 15 1969 2638 705248983 705248324 0.000000e+00 763.0
6 TraesCS5B01G196100 chr5B 90.909 253 22 1 1819 2071 514052593 514052844 3.250000e-89 339.0
7 TraesCS5B01G196100 chr5B 89.412 85 9 0 1859 1943 123789096 123789180 9.980000e-20 108.0
8 TraesCS5B01G196100 chr3B 98.275 2203 36 1 1 2203 734227361 734225161 0.000000e+00 3856.0
9 TraesCS5B01G196100 chr3B 91.724 1752 127 9 1 1748 21644991 21646728 0.000000e+00 2416.0
10 TraesCS5B01G196100 chr3B 99.467 375 1 1 2264 2638 734224816 734224443 0.000000e+00 680.0
11 TraesCS5B01G196100 chr7B 98.689 1755 21 2 1 1755 666615846 666617598 0.000000e+00 3112.0
12 TraesCS5B01G196100 chr7B 97.331 1761 39 5 1 1760 535437146 535435393 0.000000e+00 2985.0
13 TraesCS5B01G196100 chr7B 97.412 1584 38 3 1 1584 664951465 664949885 0.000000e+00 2695.0
14 TraesCS5B01G196100 chr7B 96.625 563 15 3 1684 2243 666617562 666618123 0.000000e+00 931.0
15 TraesCS5B01G196100 chr7B 88.449 606 51 10 2039 2638 692398972 692399564 0.000000e+00 713.0
16 TraesCS5B01G196100 chr7B 94.118 102 6 0 1757 1858 535435342 535435241 3.520000e-34 156.0
17 TraesCS5B01G196100 chr3D 94.926 1754 75 9 1 1748 581472633 581474378 0.000000e+00 2734.0
18 TraesCS5B01G196100 chr3D 98.113 53 1 0 1756 1808 581474426 581474478 2.800000e-15 93.5
19 TraesCS5B01G196100 chr6B 91.695 1758 128 8 1 1751 715471832 715470086 0.000000e+00 2422.0
20 TraesCS5B01G196100 chr6B 90.909 583 39 8 2058 2638 77326134 77325564 0.000000e+00 771.0
21 TraesCS5B01G196100 chr4A 95.180 1141 31 6 688 1808 692376407 692375271 0.000000e+00 1781.0
22 TraesCS5B01G196100 chr4A 93.482 583 23 7 2059 2638 692374961 692374391 0.000000e+00 852.0
23 TraesCS5B01G196100 chr4A 87.444 223 23 3 1852 2071 692375205 692374985 4.360000e-63 252.0
24 TraesCS5B01G196100 chr4B 95.167 600 24 4 2039 2638 522405949 522406543 0.000000e+00 942.0
25 TraesCS5B01G196100 chr4B 94.629 391 16 4 1684 2071 522405557 522405945 3.760000e-168 601.0
26 TraesCS5B01G196100 chr2D 87.059 680 58 12 1969 2638 126687720 126687061 0.000000e+00 741.0
27 TraesCS5B01G196100 chr2D 86.813 91 12 0 1866 1956 126687717 126687627 4.650000e-18 102.0
28 TraesCS5B01G196100 chr2D 98.113 53 1 0 1756 1808 126687965 126687913 2.800000e-15 93.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G196100 chr5B 353928094 353930731 2637 True 4872.000000 4872 100.000000 1 2638 1 chr5B.!!$R1 2637
1 TraesCS5B01G196100 chr5B 18184116 18186753 2637 False 4584.000000 4584 98.032000 1 2638 1 chr5B.!!$F1 2637
2 TraesCS5B01G196100 chr5B 123786978 123789689 2711 False 1402.333333 3205 92.538667 1 2638 3 chr5B.!!$F2 2637
3 TraesCS5B01G196100 chr5B 705248324 705248983 659 True 763.000000 763 87.556000 1969 2638 1 chr5B.!!$R2 669
4 TraesCS5B01G196100 chr5B 514052593 514053438 845 False 603.000000 867 91.960500 1819 2638 2 chr5B.!!$F3 819
5 TraesCS5B01G196100 chr3B 21644991 21646728 1737 False 2416.000000 2416 91.724000 1 1748 1 chr3B.!!$F1 1747
6 TraesCS5B01G196100 chr3B 734224443 734227361 2918 True 2268.000000 3856 98.871000 1 2638 2 chr3B.!!$R1 2637
7 TraesCS5B01G196100 chr7B 664949885 664951465 1580 True 2695.000000 2695 97.412000 1 1584 1 chr7B.!!$R1 1583
8 TraesCS5B01G196100 chr7B 666615846 666618123 2277 False 2021.500000 3112 97.657000 1 2243 2 chr7B.!!$F2 2242
9 TraesCS5B01G196100 chr7B 535435241 535437146 1905 True 1570.500000 2985 95.724500 1 1858 2 chr7B.!!$R2 1857
10 TraesCS5B01G196100 chr7B 692398972 692399564 592 False 713.000000 713 88.449000 2039 2638 1 chr7B.!!$F1 599
11 TraesCS5B01G196100 chr3D 581472633 581474478 1845 False 1413.750000 2734 96.519500 1 1808 2 chr3D.!!$F1 1807
12 TraesCS5B01G196100 chr6B 715470086 715471832 1746 True 2422.000000 2422 91.695000 1 1751 1 chr6B.!!$R2 1750
13 TraesCS5B01G196100 chr6B 77325564 77326134 570 True 771.000000 771 90.909000 2058 2638 1 chr6B.!!$R1 580
14 TraesCS5B01G196100 chr4A 692374391 692376407 2016 True 961.666667 1781 92.035333 688 2638 3 chr4A.!!$R1 1950
15 TraesCS5B01G196100 chr4B 522405557 522406543 986 False 771.500000 942 94.898000 1684 2638 2 chr4B.!!$F1 954
16 TraesCS5B01G196100 chr2D 126687061 126687965 904 True 312.166667 741 90.661667 1756 2638 3 chr2D.!!$R1 882

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
943 954 9.921637 TCTTTTCTTGTTTTCTTGTATTGTGTT 57.078 25.926 0.0 0.0 0.0 3.32 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2031 2303 1.609239 CTGGCATCTAGGTGGGCAA 59.391 57.895 4.87 0.0 36.62 4.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
943 954 9.921637 TCTTTTCTTGTTTTCTTGTATTGTGTT 57.078 25.926 0.00 0.0 0.00 3.32
1170 1184 0.037232 CCACTGACCGGAAGAAGTCC 60.037 60.000 9.46 0.0 43.90 3.85
1175 1189 1.196012 GACCGGAAGAAGTCCTGGAT 58.804 55.000 9.46 0.0 45.36 3.41
1268 1283 3.941573 TCCCACCGGTATGTTAGAAAAC 58.058 45.455 6.87 0.0 36.07 2.43
1340 1355 1.133294 TGTGTGTAGTCACCTCCTCCA 60.133 52.381 0.00 0.0 43.26 3.86
1970 2166 2.948720 GCGTCTTCACCTCTGCCCT 61.949 63.158 0.00 0.0 0.00 5.19
2031 2303 4.223144 AGGTAATTTTGTGGTTGCTCCTT 58.777 39.130 0.00 0.0 37.07 3.36
2147 2491 1.646189 GCGTTTTGGTCCTTTTGCAA 58.354 45.000 0.00 0.0 0.00 4.08
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
431 437 3.655777 TCTGTCTGATTTTACCCTTGGGT 59.344 43.478 16.31 16.31 0.00 4.51
442 448 4.703897 TCTCAACCGTTTCTGTCTGATTT 58.296 39.130 0.00 0.00 0.00 2.17
1170 1184 7.559170 ACAAAATATCTTCTTCCTTCCATCCAG 59.441 37.037 0.00 0.00 0.00 3.86
1175 1189 7.004086 ACACACAAAATATCTTCTTCCTTCCA 58.996 34.615 0.00 0.00 0.00 3.53
1268 1283 7.429374 TGGATCATAATGGAGAATAGCCTAG 57.571 40.000 0.00 0.00 0.00 3.02
1733 1827 8.275040 AGTTCCCATCAAATAGCATAACTTAGT 58.725 33.333 0.00 0.00 0.00 2.24
1812 1980 3.058293 CAGAACAAAGCATTTCTGGCGTA 60.058 43.478 3.82 0.00 43.38 4.42
1970 2166 2.504920 CCATGGTCTCTGGCGTCTA 58.495 57.895 2.57 0.00 0.00 2.59
2031 2303 1.609239 CTGGCATCTAGGTGGGCAA 59.391 57.895 4.87 0.00 36.62 4.52
2419 3052 9.917129 CCGTATAAAACACTACATATGTATCCA 57.083 33.333 15.81 0.00 0.00 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.