Multiple sequence alignment - TraesCS5B01G196000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G196000 chr5B 100.000 3469 0 0 1 3469 353924417 353927885 0.000000e+00 6407
1 TraesCS5B01G196000 chr5B 98.559 3469 50 0 1 3469 18190430 18186962 0.000000e+00 6130
2 TraesCS5B01G196000 chr5B 96.876 3489 83 14 1 3469 123793380 123789898 0.000000e+00 5816
3 TraesCS5B01G196000 chr5B 96.312 3444 88 6 1 3406 34299684 34296242 0.000000e+00 5620
4 TraesCS5B01G196000 chr5B 94.349 1221 44 6 2269 3469 514054862 514053647 0.000000e+00 1849
5 TraesCS5B01G196000 chr3B 97.964 3487 52 2 1 3469 734220749 734224234 0.000000e+00 6028
6 TraesCS5B01G196000 chr7B 97.734 3487 61 6 1 3469 666622403 666618917 0.000000e+00 5986
7 TraesCS5B01G196000 chr7B 97.592 3489 62 10 1 3469 664945958 664949444 0.000000e+00 5958
8 TraesCS5B01G196000 chr7B 98.625 2545 33 2 1 2545 379917862 379915320 0.000000e+00 4505
9 TraesCS5B01G196000 chr4B 97.093 2752 57 3 1 2729 522410189 522407438 0.000000e+00 4617
10 TraesCS5B01G196000 chr3D 93.787 2881 139 19 1 2854 581478978 581476111 0.000000e+00 4292
11 TraesCS5B01G196000 chr4A 95.702 605 26 0 2865 3469 692373578 692374182 0.000000e+00 974
12 TraesCS5B01G196000 chr4A 89.920 377 26 7 2344 2714 692372915 692373285 3.130000e-130 475
13 TraesCS5B01G196000 chr4A 89.352 216 20 3 2641 2854 692373272 692373486 5.710000e-68 268
14 TraesCS5B01G196000 chr6B 94.545 605 33 0 2865 3469 77324752 77325356 0.000000e+00 935


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G196000 chr5B 353924417 353927885 3468 False 6407.000000 6407 100.000 1 3469 1 chr5B.!!$F1 3468
1 TraesCS5B01G196000 chr5B 18186962 18190430 3468 True 6130.000000 6130 98.559 1 3469 1 chr5B.!!$R1 3468
2 TraesCS5B01G196000 chr5B 123789898 123793380 3482 True 5816.000000 5816 96.876 1 3469 1 chr5B.!!$R3 3468
3 TraesCS5B01G196000 chr5B 34296242 34299684 3442 True 5620.000000 5620 96.312 1 3406 1 chr5B.!!$R2 3405
4 TraesCS5B01G196000 chr5B 514053647 514054862 1215 True 1849.000000 1849 94.349 2269 3469 1 chr5B.!!$R4 1200
5 TraesCS5B01G196000 chr3B 734220749 734224234 3485 False 6028.000000 6028 97.964 1 3469 1 chr3B.!!$F1 3468
6 TraesCS5B01G196000 chr7B 666618917 666622403 3486 True 5986.000000 5986 97.734 1 3469 1 chr7B.!!$R2 3468
7 TraesCS5B01G196000 chr7B 664945958 664949444 3486 False 5958.000000 5958 97.592 1 3469 1 chr7B.!!$F1 3468
8 TraesCS5B01G196000 chr7B 379915320 379917862 2542 True 4505.000000 4505 98.625 1 2545 1 chr7B.!!$R1 2544
9 TraesCS5B01G196000 chr4B 522407438 522410189 2751 True 4617.000000 4617 97.093 1 2729 1 chr4B.!!$R1 2728
10 TraesCS5B01G196000 chr3D 581476111 581478978 2867 True 4292.000000 4292 93.787 1 2854 1 chr3D.!!$R1 2853
11 TraesCS5B01G196000 chr4A 692372915 692374182 1267 False 572.333333 974 91.658 2344 3469 3 chr4A.!!$F1 1125
12 TraesCS5B01G196000 chr6B 77324752 77325356 604 False 935.000000 935 94.545 2865 3469 1 chr6B.!!$F1 604

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1805 1812 2.425539 GGTTGGAACCGTTCGGAATTA 58.574 47.619 18.28 0.0 39.66 1.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2766 2971 3.527434 CGTCTAGGGGAAAAACGCT 57.473 52.632 0.0 0.0 37.42 5.07 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1805 1812 2.425539 GGTTGGAACCGTTCGGAATTA 58.574 47.619 18.28 0.00 39.66 1.40
2192 2201 3.692593 TCGTGAGTCGATTCCACAAGATA 59.307 43.478 5.38 0.00 44.01 1.98
2434 2449 0.822944 CCATCACAGCCCACACAACA 60.823 55.000 0.00 0.00 0.00 3.33
2507 2545 7.797819 AGATTCTCACGAACTTTGTTATGTTC 58.202 34.615 0.00 0.00 39.15 3.18
2766 2971 1.319541 GCTAGACGCCATGGTCTCTA 58.680 55.000 14.67 15.37 43.63 2.43
3000 3297 7.705752 TGACATACACAGTACAAACTTTAACGA 59.294 33.333 0.00 0.00 31.97 3.85
3098 3395 5.348418 TCTTGCGTGAATTCTCTTTCTTG 57.652 39.130 7.05 0.00 0.00 3.02
3197 3494 0.747255 GTAGCATCGAGGAGCTTGGA 59.253 55.000 13.89 0.00 42.05 3.53
3212 3509 5.068460 GGAGCTTGGATCGATATATAGCAGT 59.932 44.000 17.92 4.35 0.00 4.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
474 479 2.462456 TCTCTCCACATGACAAGTGC 57.538 50.000 5.28 0.00 35.69 4.40
550 555 2.112297 GGTGGTGCCGGTCAAAGA 59.888 61.111 1.90 0.00 0.00 2.52
736 743 5.876651 AACAGATACCACAGATATGCTCA 57.123 39.130 0.00 0.00 0.00 4.26
926 933 3.627395 ATTGTTGATAAGAGGTCCGCA 57.373 42.857 0.00 0.00 0.00 5.69
1143 1150 0.911769 CCATCTCCCAACAGTAGGCA 59.088 55.000 0.00 0.00 0.00 4.75
1337 1344 1.138069 TCAGCCGGAAAGCATAATCGA 59.862 47.619 5.05 0.00 34.23 3.59
1805 1812 2.165437 GCTCTCACGATCCAACTCTTCT 59.835 50.000 0.00 0.00 0.00 2.85
2109 2116 4.036734 GTCAAAAGTGTGCAAAGATGGAGA 59.963 41.667 0.00 0.00 0.00 3.71
2507 2545 6.848800 TCAAACATAACAAAGTTCACGAATCG 59.151 34.615 0.00 0.00 0.00 3.34
2766 2971 3.527434 CGTCTAGGGGAAAAACGCT 57.473 52.632 0.00 0.00 37.42 5.07
3197 3494 7.041030 CCCGACTTATCACTGCTATATATCGAT 60.041 40.741 2.16 2.16 0.00 3.59
3212 3509 5.105716 GCTAGATTATGAGCCCGACTTATCA 60.106 44.000 0.00 0.00 32.25 2.15
3433 3730 5.594725 TGTAGAAGTGATCTAGGTAGGCAAG 59.405 44.000 0.00 0.00 41.31 4.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.