Multiple sequence alignment - TraesCS5B01G185800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G185800 chr5B 100.000 2897 0 0 1 2897 337439068 337436172 0 5350
1 TraesCS5B01G185800 chr7B 96.999 2899 84 3 1 2897 654664604 654667501 0 4868
2 TraesCS5B01G185800 chr7B 94.024 2778 152 10 123 2897 112225593 112222827 0 4198
3 TraesCS5B01G185800 chr7B 92.205 2835 186 24 75 2891 33771600 33768783 0 3978
4 TraesCS5B01G185800 chr7B 92.180 2826 192 19 82 2891 449123719 449126531 0 3967
5 TraesCS5B01G185800 chr4B 96.185 2831 105 3 69 2897 349261051 349263880 0 4626
6 TraesCS5B01G185800 chr4B 95.312 2837 116 15 70 2897 102937921 102940749 0 4486
7 TraesCS5B01G185800 chr4B 93.933 2901 161 7 1 2897 560839097 560836208 0 4368
8 TraesCS5B01G185800 chr2B 93.393 2906 168 18 1 2897 606226536 606223646 0 4281
9 TraesCS5B01G185800 chr2B 91.652 2839 194 30 75 2891 749453498 749456315 0 3890


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G185800 chr5B 337436172 337439068 2896 True 5350 5350 100.000 1 2897 1 chr5B.!!$R1 2896
1 TraesCS5B01G185800 chr7B 654664604 654667501 2897 False 4868 4868 96.999 1 2897 1 chr7B.!!$F2 2896
2 TraesCS5B01G185800 chr7B 112222827 112225593 2766 True 4198 4198 94.024 123 2897 1 chr7B.!!$R2 2774
3 TraesCS5B01G185800 chr7B 33768783 33771600 2817 True 3978 3978 92.205 75 2891 1 chr7B.!!$R1 2816
4 TraesCS5B01G185800 chr7B 449123719 449126531 2812 False 3967 3967 92.180 82 2891 1 chr7B.!!$F1 2809
5 TraesCS5B01G185800 chr4B 349261051 349263880 2829 False 4626 4626 96.185 69 2897 1 chr4B.!!$F2 2828
6 TraesCS5B01G185800 chr4B 102937921 102940749 2828 False 4486 4486 95.312 70 2897 1 chr4B.!!$F1 2827
7 TraesCS5B01G185800 chr4B 560836208 560839097 2889 True 4368 4368 93.933 1 2897 1 chr4B.!!$R1 2896
8 TraesCS5B01G185800 chr2B 606223646 606226536 2890 True 4281 4281 93.393 1 2897 1 chr2B.!!$R1 2896
9 TraesCS5B01G185800 chr2B 749453498 749456315 2817 False 3890 3890 91.652 75 2891 1 chr2B.!!$F1 2816

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
868 881 0.531974 TTTCGTTCAGCGTGAAGGCT 60.532 50.0 12.51 0.0 46.13 4.58 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2515 2534 2.368548 CCGATCCCAGGAACATGACATA 59.631 50.0 0.0 0.0 0.0 2.29 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
119 122 9.230122 TCTGCATTCATCTCTTAAAATTGTGTA 57.770 29.630 0.00 0.0 0.00 2.90
596 609 5.651387 TTGGTTCAACAACATCAGTTTGA 57.349 34.783 0.00 0.0 35.28 2.69
868 881 0.531974 TTTCGTTCAGCGTGAAGGCT 60.532 50.000 12.51 0.0 46.13 4.58
934 947 3.321039 AGATGTCCTAATCATGGGCTCA 58.679 45.455 0.00 0.0 0.00 4.26
949 962 2.769095 GGGCTCAAGAGATGGTTAGAGT 59.231 50.000 0.32 0.0 0.00 3.24
976 989 8.965819 TGCAGATATTCTATAGAGGATTGACTC 58.034 37.037 2.02 0.0 37.77 3.36
1196 1209 3.430098 CCTCTATCTCAGTGTGACAAGGC 60.430 52.174 0.00 0.0 0.00 4.35
1233 1246 8.150296 TGGATTATATTTGACGATGATGACACT 58.850 33.333 0.00 0.0 0.00 3.55
1307 1320 8.525316 AGATTCAGTTTTGCATTGTGATGATTA 58.475 29.630 0.00 0.0 35.16 1.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
119 122 4.589374 ACTATGCTCGGCTAAATCTAGGTT 59.411 41.667 0.00 0.00 0.00 3.50
596 609 3.529319 AGGATCTTCATTAGGCAACCCTT 59.471 43.478 0.00 0.00 42.87 3.95
868 881 3.200605 TCCCAAGCATCATTCAAGCTCTA 59.799 43.478 0.00 0.00 37.70 2.43
934 947 5.690464 ATCTGCAACTCTAACCATCTCTT 57.310 39.130 0.00 0.00 0.00 2.85
949 962 9.319060 AGTCAATCCTCTATAGAATATCTGCAA 57.681 33.333 3.57 0.00 0.00 4.08
976 989 2.186076 GACATAAGCTCGAGTGTTCGG 58.814 52.381 15.13 6.62 46.67 4.30
1196 1209 7.082602 GTCAAATATAATCCATGCAAGCTCAG 58.917 38.462 0.00 0.00 0.00 3.35
1233 1246 4.514781 AGCGTGTGTGTCAACTAGAATA 57.485 40.909 0.00 0.00 0.00 1.75
1307 1320 3.137446 GCTCTGGCTCATCCATGTTAT 57.863 47.619 0.00 0.00 45.50 1.89
2515 2534 2.368548 CCGATCCCAGGAACATGACATA 59.631 50.000 0.00 0.00 0.00 2.29
2586 2605 6.126997 TGGTATACACCTGGTTCGACAATTAT 60.127 38.462 5.01 0.00 45.98 1.28


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.