Multiple sequence alignment - TraesCS5B01G181100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G181100 chr5B 100.000 3688 0 0 1 3688 330428195 330431882 0.000000e+00 6811
1 TraesCS5B01G181100 chr5B 99.415 3587 18 3 1 3584 330118592 330122178 0.000000e+00 6505
2 TraesCS5B01G181100 chr5B 99.065 107 0 1 3583 3688 330122220 330122326 1.350000e-44 191
3 TraesCS5B01G181100 chr6B 85.503 2573 245 65 596 3063 95238132 95235583 0.000000e+00 2567
4 TraesCS5B01G181100 chr6B 83.124 1511 215 21 1066 2573 665417546 665416073 0.000000e+00 1341
5 TraesCS5B01G181100 chr6B 83.548 1009 148 9 1066 2070 665132261 665131267 0.000000e+00 928
6 TraesCS5B01G181100 chr6B 83.983 718 88 14 2121 2833 159703604 159704299 0.000000e+00 664
7 TraesCS5B01G181100 chr6B 95.055 182 9 0 1 182 712191341 712191160 1.680000e-73 287
8 TraesCS5B01G181100 chr6B 85.328 259 32 6 1066 1321 665162289 665162034 2.820000e-66 263
9 TraesCS5B01G181100 chr2D 82.437 1822 240 46 1066 2846 493883315 493881533 0.000000e+00 1519
10 TraesCS5B01G181100 chr6D 82.451 1795 244 38 1085 2842 84084302 84086062 0.000000e+00 1504
11 TraesCS5B01G181100 chr6D 84.572 713 100 8 2132 2840 440219803 440219097 0.000000e+00 699
12 TraesCS5B01G181100 chr6D 87.608 581 66 5 2145 2721 440209742 440209164 0.000000e+00 669
13 TraesCS5B01G181100 chr6D 95.506 178 8 0 1 178 345048614 345048437 6.030000e-73 285
14 TraesCS5B01G181100 chr6A 88.632 1038 100 7 1077 2104 52405825 52406854 0.000000e+00 1247
15 TraesCS5B01G181100 chr6A 87.462 997 108 11 2120 3104 52466256 52467247 0.000000e+00 1133
16 TraesCS5B01G181100 chr6A 83.046 1044 154 16 1066 2104 588354739 588353714 0.000000e+00 926
17 TraesCS5B01G181100 chr6A 83.357 697 110 4 2145 2840 588428722 588428031 1.120000e-179 640
18 TraesCS5B01G181100 chr6A 83.965 343 29 11 517 852 52403500 52403823 4.630000e-79 305
19 TraesCS5B01G181100 chr4A 84.244 1098 151 16 957 2034 661022593 661021498 0.000000e+00 1050
20 TraesCS5B01G181100 chr4A 89.253 549 58 1 2161 2708 661021496 661020948 0.000000e+00 686
21 TraesCS5B01G181100 chr7D 84.334 1066 142 12 992 2034 46910546 46909483 0.000000e+00 1020
22 TraesCS5B01G181100 chr2B 83.746 1009 146 14 1066 2067 246574762 246575759 0.000000e+00 939
23 TraesCS5B01G181100 chrUn 96.067 178 7 0 1 178 240285680 240285503 1.300000e-74 291
24 TraesCS5B01G181100 chr5A 96.067 178 7 0 1 178 683947150 683946973 1.300000e-74 291
25 TraesCS5B01G181100 chr5D 95.506 178 8 0 1 178 415748816 415748993 6.030000e-73 285
26 TraesCS5B01G181100 chr5D 95.000 180 9 0 1 180 543670843 543671022 2.170000e-72 283
27 TraesCS5B01G181100 chr3D 95.506 178 8 0 1 178 12368957 12368780 6.030000e-73 285
28 TraesCS5B01G181100 chr3B 95.506 178 8 0 1 178 160630542 160630365 6.030000e-73 285


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G181100 chr5B 330428195 330431882 3687 False 6811 6811 100.0000 1 3688 1 chr5B.!!$F1 3687
1 TraesCS5B01G181100 chr5B 330118592 330122326 3734 False 3348 6505 99.2400 1 3688 2 chr5B.!!$F2 3687
2 TraesCS5B01G181100 chr6B 95235583 95238132 2549 True 2567 2567 85.5030 596 3063 1 chr6B.!!$R1 2467
3 TraesCS5B01G181100 chr6B 665416073 665417546 1473 True 1341 1341 83.1240 1066 2573 1 chr6B.!!$R4 1507
4 TraesCS5B01G181100 chr6B 665131267 665132261 994 True 928 928 83.5480 1066 2070 1 chr6B.!!$R2 1004
5 TraesCS5B01G181100 chr6B 159703604 159704299 695 False 664 664 83.9830 2121 2833 1 chr6B.!!$F1 712
6 TraesCS5B01G181100 chr2D 493881533 493883315 1782 True 1519 1519 82.4370 1066 2846 1 chr2D.!!$R1 1780
7 TraesCS5B01G181100 chr6D 84084302 84086062 1760 False 1504 1504 82.4510 1085 2842 1 chr6D.!!$F1 1757
8 TraesCS5B01G181100 chr6D 440219097 440219803 706 True 699 699 84.5720 2132 2840 1 chr6D.!!$R3 708
9 TraesCS5B01G181100 chr6D 440209164 440209742 578 True 669 669 87.6080 2145 2721 1 chr6D.!!$R2 576
10 TraesCS5B01G181100 chr6A 52466256 52467247 991 False 1133 1133 87.4620 2120 3104 1 chr6A.!!$F1 984
11 TraesCS5B01G181100 chr6A 588353714 588354739 1025 True 926 926 83.0460 1066 2104 1 chr6A.!!$R1 1038
12 TraesCS5B01G181100 chr6A 52403500 52406854 3354 False 776 1247 86.2985 517 2104 2 chr6A.!!$F2 1587
13 TraesCS5B01G181100 chr6A 588428031 588428722 691 True 640 640 83.3570 2145 2840 1 chr6A.!!$R2 695
14 TraesCS5B01G181100 chr4A 661020948 661022593 1645 True 868 1050 86.7485 957 2708 2 chr4A.!!$R1 1751
15 TraesCS5B01G181100 chr7D 46909483 46910546 1063 True 1020 1020 84.3340 992 2034 1 chr7D.!!$R1 1042
16 TraesCS5B01G181100 chr2B 246574762 246575759 997 False 939 939 83.7460 1066 2067 1 chr2B.!!$F1 1001

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
108 109 0.583438 CCAGGAATAATGCGAGCACG 59.417 55.0 0.00 0.0 42.93 5.34 F
111 112 0.861837 GGAATAATGCGAGCACGAGG 59.138 55.0 8.01 0.0 42.66 4.63 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2376 4239 2.301870 TCCACTTCACGTCTGCCTTATT 59.698 45.455 0.0 0.0 0.00 1.40 R
2981 4876 1.843368 CACCACAGGGATCAAGCAAT 58.157 50.000 0.0 0.0 38.05 3.56 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
108 109 0.583438 CCAGGAATAATGCGAGCACG 59.417 55.000 0.00 0.00 42.93 5.34
111 112 0.861837 GGAATAATGCGAGCACGAGG 59.138 55.000 8.01 0.00 42.66 4.63
167 168 3.338249 CACCTAACCATCTCAACCACAG 58.662 50.000 0.00 0.00 0.00 3.66
200 201 4.236935 CGCACAAATAAGATTTTGCCTGT 58.763 39.130 10.61 0.00 39.65 4.00
2136 3997 2.166254 CCCACAACTTGCACTGAGTTTT 59.834 45.455 0.00 0.00 35.26 2.43
2140 4001 6.042143 CCACAACTTGCACTGAGTTTTAAAT 58.958 36.000 0.00 0.00 35.26 1.40
2142 4003 7.393327 CACAACTTGCACTGAGTTTTAAATTG 58.607 34.615 0.00 0.00 35.26 2.32
2143 4004 7.063308 CACAACTTGCACTGAGTTTTAAATTGT 59.937 33.333 0.00 0.00 35.26 2.71
2376 4239 2.295909 CGGAAGGAAAATGGTTTCTGCA 59.704 45.455 0.00 0.00 42.45 4.41
2834 4726 6.549364 TCTTTCCCTTCAATTCAAGCTTGTAA 59.451 34.615 25.19 17.72 0.00 2.41
2835 4727 5.705609 TCCCTTCAATTCAAGCTTGTAAC 57.294 39.130 25.19 0.00 0.00 2.50
2981 4876 4.814234 GTGGGATAATTACATTGCGACTCA 59.186 41.667 0.00 0.00 0.00 3.41
3540 5447 8.303156 GCTGAATCAGTACTACATCAGATATGT 58.697 37.037 24.25 0.00 37.14 2.29
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
108 109 0.036875 CCACCAGGGTTCAAGTCCTC 59.963 60.000 0.00 0.0 0.00 3.71
167 168 0.109319 ATTTGTGCGGCGAATCAACC 60.109 50.000 12.98 0.0 0.00 3.77
200 201 7.855784 ACCCTGATAAGTGTCATATATGTGA 57.144 36.000 12.42 0.0 0.00 3.58
2376 4239 2.301870 TCCACTTCACGTCTGCCTTATT 59.698 45.455 0.00 0.0 0.00 1.40
2981 4876 1.843368 CACCACAGGGATCAAGCAAT 58.157 50.000 0.00 0.0 38.05 3.56
3128 5034 0.764890 CTCCAACTTCCTGGACACCA 59.235 55.000 0.00 0.0 40.71 4.17
3355 5261 3.139850 CTCTGCATTGGAGCCTCATAAG 58.860 50.000 0.00 0.0 0.00 1.73


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.