Multiple sequence alignment - TraesCS5B01G181000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G181000 chr5B 100.000 3482 0 0 1 3482 330118592 330122073 0.000000e+00 6431
1 TraesCS5B01G181000 chr5B 99.454 3482 17 2 1 3482 330428195 330431674 0.000000e+00 6324
2 TraesCS5B01G181000 chr5B 95.580 181 8 0 1 181 324301970 324302150 1.220000e-74 291
3 TraesCS5B01G181000 chr6B 85.625 2574 242 56 596 3065 95238132 95235583 0.000000e+00 2586
4 TraesCS5B01G181000 chr6B 82.356 1808 241 44 1066 2834 159702531 159704299 0.000000e+00 1500
5 TraesCS5B01G181000 chr6B 83.058 1511 217 19 1066 2574 665417546 665416073 0.000000e+00 1336
6 TraesCS5B01G181000 chr6B 83.548 1009 148 9 1066 2070 665132261 665131267 0.000000e+00 928
7 TraesCS5B01G181000 chr6B 87.681 552 66 2 2144 2695 665035870 665035321 2.930000e-180 641
8 TraesCS5B01G181000 chr6B 85.328 259 32 6 1066 1321 665162289 665162034 2.670000e-66 263
9 TraesCS5B01G181000 chr2D 82.447 1823 240 48 1066 2848 493883315 493881533 0.000000e+00 1520
10 TraesCS5B01G181000 chr6D 82.517 1796 243 39 1085 2844 84084302 84086062 0.000000e+00 1511
11 TraesCS5B01G181000 chr6D 84.637 703 98 8 2144 2842 440219793 440219097 0.000000e+00 691
12 TraesCS5B01G181000 chr6D 87.435 581 67 5 2146 2722 440209742 440209164 0.000000e+00 664
13 TraesCS5B01G181000 chr6D 96.067 178 7 0 1 178 345048614 345048437 1.220000e-74 291
14 TraesCS5B01G181000 chr6A 88.632 1038 100 7 1077 2104 52405825 52406854 0.000000e+00 1247
15 TraesCS5B01G181000 chr6A 83.046 1044 154 16 1066 2104 588354739 588353714 0.000000e+00 926
16 TraesCS5B01G181000 chr6A 83.405 699 107 7 2146 2842 588428722 588428031 1.050000e-179 640
17 TraesCS5B01G181000 chr6A 83.965 343 29 11 517 852 52403500 52403823 4.370000e-79 305
18 TraesCS5B01G181000 chr4A 84.244 1098 151 16 957 2034 661022593 661021498 0.000000e+00 1050
19 TraesCS5B01G181000 chr4A 88.889 549 60 1 2162 2709 661021496 661020948 0.000000e+00 675
20 TraesCS5B01G181000 chr7D 84.334 1066 142 12 992 2034 46910546 46909483 0.000000e+00 1020
21 TraesCS5B01G181000 chr2B 83.746 1009 146 14 1066 2067 246574762 246575759 0.000000e+00 939
22 TraesCS5B01G181000 chrUn 96.629 178 6 0 1 178 240285680 240285503 2.630000e-76 296
23 TraesCS5B01G181000 chr5A 96.629 178 6 0 1 178 683947150 683946973 2.630000e-76 296
24 TraesCS5B01G181000 chr3A 95.604 182 8 0 1 182 721565371 721565190 3.400000e-75 292
25 TraesCS5B01G181000 chr5D 96.067 178 7 0 1 178 415748816 415748993 1.220000e-74 291
26 TraesCS5B01G181000 chr3D 96.067 178 7 0 1 178 12368957 12368780 1.220000e-74 291
27 TraesCS5B01G181000 chr1A 96.067 178 7 0 1 178 516695342 516695519 1.220000e-74 291


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G181000 chr5B 330118592 330122073 3481 False 6431.0 6431 100.0000 1 3482 1 chr5B.!!$F2 3481
1 TraesCS5B01G181000 chr5B 330428195 330431674 3479 False 6324.0 6324 99.4540 1 3482 1 chr5B.!!$F3 3481
2 TraesCS5B01G181000 chr6B 95235583 95238132 2549 True 2586.0 2586 85.6250 596 3065 1 chr6B.!!$R1 2469
3 TraesCS5B01G181000 chr6B 159702531 159704299 1768 False 1500.0 1500 82.3560 1066 2834 1 chr6B.!!$F1 1768
4 TraesCS5B01G181000 chr6B 665416073 665417546 1473 True 1336.0 1336 83.0580 1066 2574 1 chr6B.!!$R5 1508
5 TraesCS5B01G181000 chr6B 665131267 665132261 994 True 928.0 928 83.5480 1066 2070 1 chr6B.!!$R3 1004
6 TraesCS5B01G181000 chr6B 665035321 665035870 549 True 641.0 641 87.6810 2144 2695 1 chr6B.!!$R2 551
7 TraesCS5B01G181000 chr2D 493881533 493883315 1782 True 1520.0 1520 82.4470 1066 2848 1 chr2D.!!$R1 1782
8 TraesCS5B01G181000 chr6D 84084302 84086062 1760 False 1511.0 1511 82.5170 1085 2844 1 chr6D.!!$F1 1759
9 TraesCS5B01G181000 chr6D 440219097 440219793 696 True 691.0 691 84.6370 2144 2842 1 chr6D.!!$R3 698
10 TraesCS5B01G181000 chr6D 440209164 440209742 578 True 664.0 664 87.4350 2146 2722 1 chr6D.!!$R2 576
11 TraesCS5B01G181000 chr6A 588353714 588354739 1025 True 926.0 926 83.0460 1066 2104 1 chr6A.!!$R1 1038
12 TraesCS5B01G181000 chr6A 52403500 52406854 3354 False 776.0 1247 86.2985 517 2104 2 chr6A.!!$F1 1587
13 TraesCS5B01G181000 chr6A 588428031 588428722 691 True 640.0 640 83.4050 2146 2842 1 chr6A.!!$R2 696
14 TraesCS5B01G181000 chr4A 661020948 661022593 1645 True 862.5 1050 86.5665 957 2709 2 chr4A.!!$R1 1752
15 TraesCS5B01G181000 chr7D 46909483 46910546 1063 True 1020.0 1020 84.3340 992 2034 1 chr7D.!!$R1 1042
16 TraesCS5B01G181000 chr2B 246574762 246575759 997 False 939.0 939 83.7460 1066 2067 1 chr2B.!!$F1 1001

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
108 109 0.947244 CCAGGAATAATGCGAGCACC 59.053 55.000 0.00 0.0 0.00 5.01 F
111 112 1.486310 AGGAATAATGCGAGCACCAGA 59.514 47.619 0.00 0.0 0.00 3.86 F
200 201 3.061161 CGCACAAATAAGATTTTGCCTGC 59.939 43.478 10.61 0.0 39.65 4.85 F
2197 4065 3.660111 GCCCGAAACTGCTTGCGT 61.660 61.111 0.00 0.0 0.00 5.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2197 4065 2.759191 CTGTAGTTTGCTGAGCACAGA 58.241 47.619 15.88 0.00 46.03 3.41 R
2424 4294 5.755409 TGGTGAGCTTAACCAGATTCTTA 57.245 39.130 16.13 0.00 42.82 2.10 R
2479 4351 4.211920 TCCACGACACACCTGATATATCA 58.788 43.478 14.64 14.64 35.16 2.15 R
3130 5040 0.320771 CTCCAACTTCCTGGACACCG 60.321 60.000 0.00 0.00 40.71 4.94 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
108 109 0.947244 CCAGGAATAATGCGAGCACC 59.053 55.000 0.00 0.00 0.00 5.01
111 112 1.486310 AGGAATAATGCGAGCACCAGA 59.514 47.619 0.00 0.00 0.00 3.86
167 168 3.308402 CCACCTAACCATCTCAACCACAT 60.308 47.826 0.00 0.00 0.00 3.21
200 201 3.061161 CGCACAAATAAGATTTTGCCTGC 59.939 43.478 10.61 0.00 39.65 4.85
2197 4065 3.660111 GCCCGAAACTGCTTGCGT 61.660 61.111 0.00 0.00 0.00 5.24
2424 4294 4.529377 CCATATGCCCCTAATTTCAAGCAT 59.471 41.667 0.00 9.65 43.04 3.79
2479 4351 2.620115 CAGCCTGATGACAACTTTGTGT 59.380 45.455 0.00 0.00 42.43 3.72
2634 4506 0.972134 CTGCTGAGGAGAGGACACAA 59.028 55.000 0.00 0.00 0.00 3.33
2835 4732 6.549364 TCTTTCCCTTCAATTCAAGCTTGTAA 59.451 34.615 25.19 17.72 0.00 2.41
2880 4777 5.236478 CGTTGGAGTATATTTGATGTGTCCC 59.764 44.000 0.00 0.00 0.00 4.46
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
108 109 1.609208 CCACCAGGGTTCAAGTTCTG 58.391 55.000 0.00 0.00 0.00 3.02
167 168 0.595588 ATTTGTGCGGCGAATCAACA 59.404 45.000 12.98 3.20 0.00 3.33
200 201 7.009179 ACCCTGATAAGTGTCATATATGTGG 57.991 40.000 12.42 1.94 0.00 4.17
2197 4065 2.759191 CTGTAGTTTGCTGAGCACAGA 58.241 47.619 15.88 0.00 46.03 3.41
2424 4294 5.755409 TGGTGAGCTTAACCAGATTCTTA 57.245 39.130 16.13 0.00 42.82 2.10
2479 4351 4.211920 TCCACGACACACCTGATATATCA 58.788 43.478 14.64 14.64 35.16 2.15
2634 4506 2.629617 CAAACCCAAATCCTCAGTTGCT 59.370 45.455 0.00 0.00 0.00 3.91
2880 4777 1.280133 TGGACAGCCTCAAGATGAAGG 59.720 52.381 0.00 0.00 34.31 3.46
3130 5040 0.320771 CTCCAACTTCCTGGACACCG 60.321 60.000 0.00 0.00 40.71 4.94
3357 5267 2.877168 CTCTGCATTGGAGCCTCATAAC 59.123 50.000 0.00 0.00 0.00 1.89


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.