Multiple sequence alignment - TraesCS5B01G135900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G135900 chr5B 100.000 2285 0 0 1 2285 255655681 255657965 0.000000e+00 4220
1 TraesCS5B01G135900 chr5B 97.016 1977 31 2 337 2285 524582648 524580672 0.000000e+00 3299
2 TraesCS5B01G135900 chr5B 91.842 380 19 2 1917 2285 396075843 396075465 9.360000e-144 520
3 TraesCS5B01G135900 chr5B 88.665 397 16 3 1917 2285 516275331 516274936 7.440000e-125 457
4 TraesCS5B01G135900 chr3A 97.499 2199 26 3 116 2285 627956835 627954637 0.000000e+00 3729
5 TraesCS5B01G135900 chr3A 97.453 2199 25 5 116 2285 514529055 514531251 0.000000e+00 3722
6 TraesCS5B01G135900 chr3A 99.167 120 1 0 1 120 514528811 514528930 1.370000e-52 217
7 TraesCS5B01G135900 chr6A 97.317 2199 30 3 116 2285 214163003 214160805 0.000000e+00 3707
8 TraesCS5B01G135900 chr6A 99.167 120 1 0 1 120 157652252 157652371 1.370000e-52 217
9 TraesCS5B01G135900 chr6A 99.167 120 1 0 1 120 214163247 214163128 1.370000e-52 217
10 TraesCS5B01G135900 chr7A 97.271 2199 31 3 116 2285 613755162 613752964 0.000000e+00 3701
11 TraesCS5B01G135900 chr7A 99.167 120 1 0 1 120 613755406 613755287 1.370000e-52 217
12 TraesCS5B01G135900 chr6B 97.271 2199 30 4 116 2285 439442859 439440662 0.000000e+00 3701
13 TraesCS5B01G135900 chr6B 99.167 120 1 0 1 120 439443103 439442984 1.370000e-52 217
14 TraesCS5B01G135900 chr6B 99.167 120 1 0 1 120 693565238 693565119 1.370000e-52 217
15 TraesCS5B01G135900 chr6B 86.190 210 1 2 2104 2285 635284195 635284404 3.850000e-48 202
16 TraesCS5B01G135900 chr7B 96.817 2199 39 4 116 2285 577195604 577193408 0.000000e+00 3644
17 TraesCS5B01G135900 chr7B 87.909 397 19 6 1917 2285 33889885 33889490 7.490000e-120 440
18 TraesCS5B01G135900 chr1A 96.680 2199 44 3 116 2285 64891272 64889074 0.000000e+00 3629
19 TraesCS5B01G135900 chr1A 99.167 120 1 0 1 120 64891517 64891398 1.370000e-52 217
20 TraesCS5B01G135900 chr1B 96.078 2167 70 7 131 2285 631842973 631845136 0.000000e+00 3517
21 TraesCS5B01G135900 chr1B 88.442 398 16 4 1917 2285 551877134 551876738 9.620000e-124 453
22 TraesCS5B01G135900 chr1B 87.909 397 19 3 1917 2285 670666017 670666412 7.490000e-120 440
23 TraesCS5B01G135900 chr1B 99.167 120 1 0 1 120 602251930 602252049 1.370000e-52 217
24 TraesCS5B01G135900 chr4A 96.746 1629 40 3 668 2285 740141427 740139801 0.000000e+00 2702
25 TraesCS5B01G135900 chr2B 96.309 298 8 3 116 412 708697747 708697452 9.490000e-134 486
26 TraesCS5B01G135900 chr2B 88.384 396 17 3 1918 2285 9226227 9225833 1.240000e-122 449
27 TraesCS5B01G135900 chr2B 86.709 316 13 3 1998 2285 166035755 166036069 7.870000e-85 324
28 TraesCS5B01G135900 chrUn 89.701 301 3 7 2013 2285 3675028 3675328 2.160000e-95 359
29 TraesCS5B01G135900 chr3B 86.121 281 10 3 2033 2285 499181387 499181666 2.240000e-70 276
30 TraesCS5B01G135900 chr5A 99.167 120 1 0 1 120 617986789 617986908 1.370000e-52 217


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G135900 chr5B 255655681 255657965 2284 False 4220.0 4220 100.0000 1 2285 1 chr5B.!!$F1 2284
1 TraesCS5B01G135900 chr5B 524580672 524582648 1976 True 3299.0 3299 97.0160 337 2285 1 chr5B.!!$R3 1948
2 TraesCS5B01G135900 chr3A 627954637 627956835 2198 True 3729.0 3729 97.4990 116 2285 1 chr3A.!!$R1 2169
3 TraesCS5B01G135900 chr3A 514528811 514531251 2440 False 1969.5 3722 98.3100 1 2285 2 chr3A.!!$F1 2284
4 TraesCS5B01G135900 chr6A 214160805 214163247 2442 True 1962.0 3707 98.2420 1 2285 2 chr6A.!!$R1 2284
5 TraesCS5B01G135900 chr7A 613752964 613755406 2442 True 1959.0 3701 98.2190 1 2285 2 chr7A.!!$R1 2284
6 TraesCS5B01G135900 chr6B 439440662 439443103 2441 True 1959.0 3701 98.2190 1 2285 2 chr6B.!!$R2 2284
7 TraesCS5B01G135900 chr7B 577193408 577195604 2196 True 3644.0 3644 96.8170 116 2285 1 chr7B.!!$R2 2169
8 TraesCS5B01G135900 chr1A 64889074 64891517 2443 True 1923.0 3629 97.9235 1 2285 2 chr1A.!!$R1 2284
9 TraesCS5B01G135900 chr1B 631842973 631845136 2163 False 3517.0 3517 96.0780 131 2285 1 chr1B.!!$F2 2154
10 TraesCS5B01G135900 chr4A 740139801 740141427 1626 True 2702.0 2702 96.7460 668 2285 1 chr4A.!!$R1 1617

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
777 909 4.516698 CCCTCGTTTTCATCCATAGGAATG 59.483 45.833 0.0 0.0 34.34 2.67 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1997 2130 1.737236 CAACATTTAGGCGCTGCACTA 59.263 47.619 7.64 0.0 0.0 2.74 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
777 909 4.516698 CCCTCGTTTTCATCCATAGGAATG 59.483 45.833 0.00 0.00 34.34 2.67
1107 1240 5.511386 AGGTGAAGGAGAAAGATGTCAAT 57.489 39.130 0.00 0.00 0.00 2.57
1177 1310 1.270625 ACCGAAAGAAAGCATGGACGA 60.271 47.619 0.00 0.00 0.00 4.20
1821 1954 4.955925 ATGAACATCGTCGGCATAAAAA 57.044 36.364 0.00 0.00 0.00 1.94
1902 2035 1.486726 AGTAGCCATGGGAGTAACTGC 59.513 52.381 15.13 4.31 0.00 4.40
1997 2130 1.674322 GTTGGGCGCCACACAGTAT 60.674 57.895 30.85 0.00 30.78 2.12
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
404 536 2.832661 AGTGTGCAGCGCCCAAAA 60.833 55.556 2.29 0.00 0.00 2.44
777 909 3.427233 GCAAGATCTGAGCAAATGTGACC 60.427 47.826 13.83 0.00 0.00 4.02
1107 1240 1.458398 CACACCAACATTGCGGGATA 58.542 50.000 1.54 0.00 0.00 2.59
1177 1310 4.278419 GCATACAAAATATCTCCGCCCTTT 59.722 41.667 0.00 0.00 0.00 3.11
1821 1954 6.747125 TCACAGCAATATGAACAAACACAAT 58.253 32.000 0.00 0.00 0.00 2.71
1945 2078 3.121030 GTACAGTGCAGCGCCCTG 61.121 66.667 2.29 8.15 42.13 4.45
1997 2130 1.737236 CAACATTTAGGCGCTGCACTA 59.263 47.619 7.64 0.00 0.00 2.74


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.