Multiple sequence alignment - TraesCS5B01G113100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G113100 chr5B 100.000 2924 0 0 1 2924 179227000 179229923 0 5400
1 TraesCS5B01G113100 chr5B 99.044 2928 23 5 1 2924 406870617 406867691 0 5247
2 TraesCS5B01G113100 chr6B 99.146 2927 22 3 1 2924 704850705 704847779 0 5264
3 TraesCS5B01G113100 chr6B 99.043 2926 25 3 1 2924 408661941 408664865 0 5245
4 TraesCS5B01G113100 chr2A 99.145 2925 23 2 1 2924 719453775 719456698 0 5262
5 TraesCS5B01G113100 chr2A 99.043 2927 23 5 1 2924 43380269 43383193 0 5245
6 TraesCS5B01G113100 chr7B 99.111 2926 22 4 1 2924 528879482 528882405 0 5256
7 TraesCS5B01G113100 chr4B 98.771 2929 31 5 1 2924 194219136 194222064 0 5204
8 TraesCS5B01G113100 chr7A 98.532 2929 19 10 1 2924 171418630 171421539 0 5149
9 TraesCS5B01G113100 chr1A 99.184 2328 18 1 597 2924 567477549 567475223 0 4193


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G113100 chr5B 179227000 179229923 2923 False 5400 5400 100.000 1 2924 1 chr5B.!!$F1 2923
1 TraesCS5B01G113100 chr5B 406867691 406870617 2926 True 5247 5247 99.044 1 2924 1 chr5B.!!$R1 2923
2 TraesCS5B01G113100 chr6B 704847779 704850705 2926 True 5264 5264 99.146 1 2924 1 chr6B.!!$R1 2923
3 TraesCS5B01G113100 chr6B 408661941 408664865 2924 False 5245 5245 99.043 1 2924 1 chr6B.!!$F1 2923
4 TraesCS5B01G113100 chr2A 719453775 719456698 2923 False 5262 5262 99.145 1 2924 1 chr2A.!!$F2 2923
5 TraesCS5B01G113100 chr2A 43380269 43383193 2924 False 5245 5245 99.043 1 2924 1 chr2A.!!$F1 2923
6 TraesCS5B01G113100 chr7B 528879482 528882405 2923 False 5256 5256 99.111 1 2924 1 chr7B.!!$F1 2923
7 TraesCS5B01G113100 chr4B 194219136 194222064 2928 False 5204 5204 98.771 1 2924 1 chr4B.!!$F1 2923
8 TraesCS5B01G113100 chr7A 171418630 171421539 2909 False 5149 5149 98.532 1 2924 1 chr7A.!!$F1 2923
9 TraesCS5B01G113100 chr1A 567475223 567477549 2326 True 4193 4193 99.184 597 2924 1 chr1A.!!$R1 2327

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1220 1231 1.077501 CCCTTGATGGCACGGATGT 60.078 57.895 0.0 0.0 35.54 3.06 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2785 2800 2.875933 CTCTTGCCTAACGAAACCACAA 59.124 45.455 0.0 0.0 0.0 3.33 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1220 1231 1.077501 CCCTTGATGGCACGGATGT 60.078 57.895 0.0 0.0 35.54 3.06
1387 1398 2.818130 TGCCTTGCAGATTGGTTTTC 57.182 45.000 0.0 0.0 33.32 2.29
2141 2154 1.368374 ACCTGCCTACCTGCCTTTTA 58.632 50.000 0.0 0.0 0.00 1.52
2785 2800 3.448934 TGGGCAATCATTTATGTTGGGT 58.551 40.909 0.0 0.0 0.00 4.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
595 606 2.811855 CAGCAGCATGTTTTGTGTCAA 58.188 42.857 0.00 0.0 39.31 3.18
1220 1231 0.389296 CACACTTGTATCACCCGCGA 60.389 55.000 8.23 0.0 0.00 5.87
2620 2635 5.995446 ACCCAGAAAATATTCTCCACTCTC 58.005 41.667 0.00 0.0 44.11 3.20
2785 2800 2.875933 CTCTTGCCTAACGAAACCACAA 59.124 45.455 0.00 0.0 0.00 3.33


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.