Multiple sequence alignment - TraesCS5B01G098500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G098500 chr5B 100.000 2411 0 0 1 2411 130568755 130571165 0 4453
1 TraesCS5B01G098500 chr5B 99.088 2411 18 1 1 2411 130614901 130612495 0 4327
2 TraesCS5B01G098500 chr5B 99.046 2411 18 2 1 2411 130609877 130607472 0 4320
3 TraesCS5B01G098500 chrUn 99.170 2411 15 2 1 2411 45100792 45098387 0 4337
4 TraesCS5B01G098500 chrUn 99.129 2411 18 2 1 2411 261513064 261515471 0 4333
5 TraesCS5B01G098500 chrUn 98.839 2411 20 3 1 2411 186163779 186161377 0 4290
6 TraesCS5B01G098500 chr3A 99.005 2411 20 2 1 2411 66030313 66032719 0 4316
7 TraesCS5B01G098500 chr7B 98.798 2413 24 2 1 2411 743033700 743036109 0 4290
8 TraesCS5B01G098500 chr5A 98.465 2411 36 1 1 2411 238861455 238859046 0 4246
9 TraesCS5B01G098500 chr5A 98.134 2411 40 4 1 2411 238828027 238830432 0 4198


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G098500 chr5B 130568755 130571165 2410 False 4453.0 4453 100.000 1 2411 1 chr5B.!!$F1 2410
1 TraesCS5B01G098500 chr5B 130607472 130614901 7429 True 4323.5 4327 99.067 1 2411 2 chr5B.!!$R1 2410
2 TraesCS5B01G098500 chrUn 45098387 45100792 2405 True 4337.0 4337 99.170 1 2411 1 chrUn.!!$R1 2410
3 TraesCS5B01G098500 chrUn 261513064 261515471 2407 False 4333.0 4333 99.129 1 2411 1 chrUn.!!$F1 2410
4 TraesCS5B01G098500 chrUn 186161377 186163779 2402 True 4290.0 4290 98.839 1 2411 1 chrUn.!!$R2 2410
5 TraesCS5B01G098500 chr3A 66030313 66032719 2406 False 4316.0 4316 99.005 1 2411 1 chr3A.!!$F1 2410
6 TraesCS5B01G098500 chr7B 743033700 743036109 2409 False 4290.0 4290 98.798 1 2411 1 chr7B.!!$F1 2410
7 TraesCS5B01G098500 chr5A 238859046 238861455 2409 True 4246.0 4246 98.465 1 2411 1 chr5A.!!$R1 2410
8 TraesCS5B01G098500 chr5A 238828027 238830432 2405 False 4198.0 4198 98.134 1 2411 1 chr5A.!!$F1 2410

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
176 177 1.732809 GGTCGCTCCTTTAGTTGAAGC 59.267 52.381 0.0 0.0 0.0 3.86 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1589 1594 1.559682 GAACCTTAGCATGGGAGGACA 59.44 52.381 0.0 0.0 34.61 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
176 177 1.732809 GGTCGCTCCTTTAGTTGAAGC 59.267 52.381 0.00 0.00 0.00 3.86
323 324 3.117246 TCGAAGACCCATACCATAGGACT 60.117 47.826 0.00 0.00 0.00 3.85
479 480 2.425143 TGATCGGTAGTAGTCCGGTT 57.575 50.000 0.00 0.00 46.82 4.44
1125 1126 0.106419 TTGGGGCGTCTTTCTTTGGT 60.106 50.000 0.00 0.00 0.00 3.67
1147 1148 1.385528 TACTATCAAGCCAGACGCGA 58.614 50.000 15.93 0.00 44.76 5.87
1326 1327 3.696051 TCCAAGAAGAATTGTGCTATGCC 59.304 43.478 0.00 0.00 0.00 4.40
1327 1328 3.181483 CCAAGAAGAATTGTGCTATGCCC 60.181 47.826 0.00 0.00 0.00 5.36
1498 1503 3.059884 CGGTCGCACATTCATAATAGCT 58.940 45.455 0.00 0.00 0.00 3.32
1589 1594 1.692411 GGCGGCAAAAGGATTAGGAT 58.308 50.000 3.07 0.00 0.00 3.24
1797 1802 5.534207 TGAATGAGCAAAATGAAGGTTGT 57.466 34.783 0.00 0.00 0.00 3.32
2290 7320 0.107703 GATGTGAATGAGGCCGGTCA 60.108 55.000 9.71 2.15 0.00 4.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
176 177 1.248101 AACGAAAAAGGGGCCCGATG 61.248 55.000 18.95 7.82 0.00 3.84
479 480 4.527944 TGGAATATTATTGTTCGGGTGCA 58.472 39.130 0.00 0.00 0.00 4.57
892 893 2.111043 CACGTGTGGTTCTGGCCT 59.889 61.111 7.58 0.00 0.00 5.19
1125 1126 2.927477 CGCGTCTGGCTTGATAGTAAAA 59.073 45.455 0.00 0.00 40.44 1.52
1147 1148 1.873591 GATGATAATGCGAAAGGGCGT 59.126 47.619 0.00 0.00 35.06 5.68
1498 1503 1.610624 GGAAGGCACATGAGTCCGAAA 60.611 52.381 0.00 0.00 0.00 3.46
1547 1552 2.027169 GCCGGCTAATCGTACGCT 59.973 61.111 22.15 0.00 0.00 5.07
1589 1594 1.559682 GAACCTTAGCATGGGAGGACA 59.440 52.381 0.00 0.00 34.61 4.02
1797 1802 7.690454 TCCCCAGAGATCTTTATCATTAACA 57.310 36.000 0.00 0.00 34.28 2.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.