Multiple sequence alignment - TraesCS5B01G098400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G098400 chr5B 100.000 3444 0 0 1 3444 130571636 130568193 0 6360
1 TraesCS5B01G098400 chr5B 99.072 3448 23 3 1 3444 130606997 130610439 0 6181
2 TraesCS5B01G098400 chr5B 99.261 3385 21 1 60 3444 130612083 130615463 0 6109
3 TraesCS5B01G098400 chrUn 99.245 3444 22 3 1 3444 261515941 261512502 0 6213
4 TraesCS5B01G098400 chrUn 99.216 3444 19 4 1 3444 45097919 45101354 0 6204
5 TraesCS5B01G098400 chrUn 98.985 3448 23 4 1 3444 186160902 186164341 0 6163
6 TraesCS5B01G098400 chr3A 99.100 3444 25 3 1 3444 66033188 66029751 0 6183
7 TraesCS5B01G098400 chr7B 98.868 3446 34 2 1 3444 743036580 743033138 0 6143
8 TraesCS5B01G098400 chr2B 98.606 3444 42 4 1 3444 112866238 112869675 0 6089
9 TraesCS5B01G098400 chr2A 98.403 3444 42 4 1 3444 735226340 735222910 0 6043


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G098400 chr5B 130568193 130571636 3443 True 6360 6360 100.0000 1 3444 1 chr5B.!!$R1 3443
1 TraesCS5B01G098400 chr5B 130606997 130615463 8466 False 6145 6181 99.1665 1 3444 2 chr5B.!!$F1 3443
2 TraesCS5B01G098400 chrUn 261512502 261515941 3439 True 6213 6213 99.2450 1 3444 1 chrUn.!!$R1 3443
3 TraesCS5B01G098400 chrUn 45097919 45101354 3435 False 6204 6204 99.2160 1 3444 1 chrUn.!!$F1 3443
4 TraesCS5B01G098400 chrUn 186160902 186164341 3439 False 6163 6163 98.9850 1 3444 1 chrUn.!!$F2 3443
5 TraesCS5B01G098400 chr3A 66029751 66033188 3437 True 6183 6183 99.1000 1 3444 1 chr3A.!!$R1 3443
6 TraesCS5B01G098400 chr7B 743033138 743036580 3442 True 6143 6143 98.8680 1 3444 1 chr7B.!!$R1 3443
7 TraesCS5B01G098400 chr2B 112866238 112869675 3437 False 6089 6089 98.6060 1 3444 1 chr2B.!!$F1 3443
8 TraesCS5B01G098400 chr2A 735222910 735226340 3430 True 6043 6043 98.4030 1 3444 1 chr2A.!!$R1 3443

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
462 463 4.858680 GAGCCTGCCTTACCGCCC 62.859 72.222 0.0 0.0 0.00 6.13 F
1292 6326 1.559682 GAACCTTAGCATGGGAGGACA 59.440 52.381 0.0 0.0 34.61 4.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1756 6792 0.106419 TTGGGGCGTCTTTCTTTGGT 60.106 50.000 0.0 0.0 0.0 3.67 R
2705 7741 1.732809 GGTCGCTCCTTTAGTTGAAGC 59.267 52.381 0.0 0.0 0.0 3.86 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
462 463 4.858680 GAGCCTGCCTTACCGCCC 62.859 72.222 0.00 0.00 0.00 6.13
1084 6118 7.690454 TCCCCAGAGATCTTTATCATTAACA 57.310 36.000 0.00 0.00 34.28 2.41
1292 6326 1.559682 GAACCTTAGCATGGGAGGACA 59.440 52.381 0.00 0.00 34.61 4.02
1334 6368 2.027169 GCCGGCTAATCGTACGCT 59.973 61.111 22.15 0.00 0.00 5.07
1383 6417 1.610624 GGAAGGCACATGAGTCCGAAA 60.611 52.381 0.00 0.00 0.00 3.46
1547 6581 4.882427 TCTTTCGCTCTATAGGGATATCGG 59.118 45.833 2.98 0.00 43.51 4.18
1734 6770 1.873591 GATGATAATGCGAAAGGGCGT 59.126 47.619 0.00 0.00 35.06 5.68
1756 6792 2.927477 CGCGTCTGGCTTGATAGTAAAA 59.073 45.455 0.00 0.00 40.44 1.52
1989 7025 2.111043 CACGTGTGGTTCTGGCCT 59.889 61.111 7.58 0.00 0.00 5.19
2402 7438 4.527944 TGGAATATTATTGTTCGGGTGCA 58.472 39.130 0.00 0.00 0.00 4.57
2705 7741 1.248101 AACGAAAAAGGGGCCCGATG 61.248 55.000 18.95 7.82 0.00 3.84
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
591 600 0.107703 GATGTGAATGAGGCCGGTCA 60.108 55.000 9.71 2.15 0.00 4.02
1084 6118 5.534207 TGAATGAGCAAAATGAAGGTTGT 57.466 34.783 0.00 0.00 0.00 3.32
1292 6326 1.692411 GGCGGCAAAAGGATTAGGAT 58.308 50.000 3.07 0.00 0.00 3.24
1383 6417 3.059884 CGGTCGCACATTCATAATAGCT 58.940 45.455 0.00 0.00 0.00 3.32
1734 6770 1.385528 TACTATCAAGCCAGACGCGA 58.614 50.000 15.93 0.00 44.76 5.87
1756 6792 0.106419 TTGGGGCGTCTTTCTTTGGT 60.106 50.000 0.00 0.00 0.00 3.67
2402 7438 2.425143 TGATCGGTAGTAGTCCGGTT 57.575 50.000 0.00 0.00 46.82 4.44
2558 7594 3.117246 TCGAAGACCCATACCATAGGACT 60.117 47.826 0.00 0.00 0.00 3.85
2705 7741 1.732809 GGTCGCTCCTTTAGTTGAAGC 59.267 52.381 0.00 0.00 0.00 3.86


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.