Multiple sequence alignment - TraesCS5B01G096900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G096900 chr5B 100.000 1724 0 0 1 1724 127854003 127855726 0.000000e+00 3184
1 TraesCS5B01G096900 chr5B 100.000 604 0 0 1892 2495 127855894 127856497 0.000000e+00 1116
2 TraesCS5B01G096900 chr3A 98.386 1735 17 2 1 1724 191856319 191858053 0.000000e+00 3038
3 TraesCS5B01G096900 chr3A 98.673 603 8 0 1893 2495 191858087 191858689 0.000000e+00 1070
4 TraesCS5B01G096900 chr3A 95.105 143 7 0 2353 2495 227634228 227634370 2.500000e-55 226
5 TraesCS5B01G096900 chr7A 97.157 1618 35 2 1 1608 563530711 563529095 0.000000e+00 2723
6 TraesCS5B01G096900 chr7A 98.023 1113 12 1 1 1103 60328240 60327128 0.000000e+00 1925
7 TraesCS5B01G096900 chr7A 97.857 140 3 0 2356 2495 211363364 211363225 2.480000e-60 243
8 TraesCS5B01G096900 chr1A 97.323 1606 32 2 1 1595 278507116 278508721 0.000000e+00 2717
9 TraesCS5B01G096900 chr1A 98.203 1113 10 1 1 1103 238108975 238107863 0.000000e+00 1936
10 TraesCS5B01G096900 chr1A 98.023 1113 12 1 1 1103 238154360 238153248 0.000000e+00 1925
11 TraesCS5B01G096900 chr1A 97.902 143 3 0 2353 2495 94581955 94582097 5.330000e-62 248
12 TraesCS5B01G096900 chr1A 99.248 133 1 0 2363 2495 94663018 94662886 8.920000e-60 241
13 TraesCS5B01G096900 chr5A 97.934 1113 13 1 1 1103 16577150 16576038 0.000000e+00 1919
14 TraesCS5B01G096900 chr6B 97.934 1113 12 2 1 1103 596656536 596655425 0.000000e+00 1917
15 TraesCS5B01G096900 chr6B 97.844 1113 12 3 1 1103 394497413 394498523 0.000000e+00 1912
16 TraesCS5B01G096900 chr2D 97.844 1113 14 1 1 1103 642938554 642939666 0.000000e+00 1914
17 TraesCS5B01G096900 chr3B 97.664 1113 15 2 1 1103 483373085 483374196 0.000000e+00 1901
18 TraesCS5B01G096900 chr3B 96.970 99 3 0 2397 2495 775450085 775450183 1.530000e-37 167
19 TraesCS5B01G096900 chrUn 97.664 1113 13 2 1 1103 237257060 237255951 0.000000e+00 1899
20 TraesCS5B01G096900 chrUn 96.765 1113 10 2 1 1103 182414240 182413144 0.000000e+00 1832
21 TraesCS5B01G096900 chrUn 97.633 845 10 1 1 835 399834348 399833504 0.000000e+00 1441
22 TraesCS5B01G096900 chrUn 87.321 418 45 4 1893 2303 229490920 229491336 2.900000e-129 472
23 TraesCS5B01G096900 chrUn 100.000 103 0 0 1502 1604 325544762 325544660 9.110000e-45 191
24 TraesCS5B01G096900 chrUn 100.000 103 0 0 1502 1604 325547858 325547756 9.110000e-45 191
25 TraesCS5B01G096900 chrUn 95.960 99 4 0 2397 2495 406859804 406859902 7.140000e-36 161
26 TraesCS5B01G096900 chrUn 96.296 81 3 0 2356 2436 369464447 369464367 1.560000e-27 134
27 TraesCS5B01G096900 chrUn 96.296 81 3 0 2356 2436 443029488 443029408 1.560000e-27 134
28 TraesCS5B01G096900 chrUn 84.496 129 11 7 2304 2430 229491317 229491438 4.360000e-23 119
29 TraesCS5B01G096900 chr4D 97.289 922 14 2 1 911 123663557 123662636 0.000000e+00 1554
30 TraesCS5B01G096900 chr4A 96.289 539 19 1 1070 1608 275502889 275502352 0.000000e+00 883
31 TraesCS5B01G096900 chr1D 94.136 324 15 2 1292 1615 461637087 461636768 8.020000e-135 490
32 TraesCS5B01G096900 chr2A 96.863 255 8 0 1018 1272 588457946 588458200 6.380000e-116 427
33 TraesCS5B01G096900 chr2A 97.857 140 3 0 2356 2495 423417788 423417649 2.480000e-60 243
34 TraesCS5B01G096900 chr7B 100.000 119 0 0 1323 1441 740000501 740000383 1.160000e-53 220
35 TraesCS5B01G096900 chr7B 95.960 99 4 0 2397 2495 743103523 743103425 7.140000e-36 161
36 TraesCS5B01G096900 chr2B 95.385 130 3 1 1502 1631 357443756 357443630 1.170000e-48 204
37 TraesCS5B01G096900 chr2B 93.846 130 5 1 1502 1631 357569666 357569792 2.530000e-45 193
38 TraesCS5B01G096900 chr6D 96.296 81 3 0 2356 2436 246666786 246666706 1.560000e-27 134


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G096900 chr5B 127854003 127856497 2494 False 2150.0 3184 100.0000 1 2495 2 chr5B.!!$F1 2494
1 TraesCS5B01G096900 chr3A 191856319 191858689 2370 False 2054.0 3038 98.5295 1 2495 2 chr3A.!!$F2 2494
2 TraesCS5B01G096900 chr7A 563529095 563530711 1616 True 2723.0 2723 97.1570 1 1608 1 chr7A.!!$R3 1607
3 TraesCS5B01G096900 chr7A 60327128 60328240 1112 True 1925.0 1925 98.0230 1 1103 1 chr7A.!!$R1 1102
4 TraesCS5B01G096900 chr1A 278507116 278508721 1605 False 2717.0 2717 97.3230 1 1595 1 chr1A.!!$F2 1594
5 TraesCS5B01G096900 chr1A 238107863 238108975 1112 True 1936.0 1936 98.2030 1 1103 1 chr1A.!!$R2 1102
6 TraesCS5B01G096900 chr1A 238153248 238154360 1112 True 1925.0 1925 98.0230 1 1103 1 chr1A.!!$R3 1102
7 TraesCS5B01G096900 chr5A 16576038 16577150 1112 True 1919.0 1919 97.9340 1 1103 1 chr5A.!!$R1 1102
8 TraesCS5B01G096900 chr6B 596655425 596656536 1111 True 1917.0 1917 97.9340 1 1103 1 chr6B.!!$R1 1102
9 TraesCS5B01G096900 chr6B 394497413 394498523 1110 False 1912.0 1912 97.8440 1 1103 1 chr6B.!!$F1 1102
10 TraesCS5B01G096900 chr2D 642938554 642939666 1112 False 1914.0 1914 97.8440 1 1103 1 chr2D.!!$F1 1102
11 TraesCS5B01G096900 chr3B 483373085 483374196 1111 False 1901.0 1901 97.6640 1 1103 1 chr3B.!!$F1 1102
12 TraesCS5B01G096900 chrUn 237255951 237257060 1109 True 1899.0 1899 97.6640 1 1103 1 chrUn.!!$R2 1102
13 TraesCS5B01G096900 chrUn 182413144 182414240 1096 True 1832.0 1832 96.7650 1 1103 1 chrUn.!!$R1 1102
14 TraesCS5B01G096900 chrUn 399833504 399834348 844 True 1441.0 1441 97.6330 1 835 1 chrUn.!!$R4 834
15 TraesCS5B01G096900 chrUn 229490920 229491438 518 False 295.5 472 85.9085 1893 2430 2 chrUn.!!$F2 537
16 TraesCS5B01G096900 chr4D 123662636 123663557 921 True 1554.0 1554 97.2890 1 911 1 chr4D.!!$R1 910
17 TraesCS5B01G096900 chr4A 275502352 275502889 537 True 883.0 883 96.2890 1070 1608 1 chr4A.!!$R1 538

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
162 166 2.839486 TCCACATCTGAGCGTCTTTT 57.161 45.0 0.0 0.0 0.0 2.27 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1651 1667 1.070289 GAGGCATACGGGGTTAAGGAG 59.93 57.143 0.0 0.0 0.0 3.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
162 166 2.839486 TCCACATCTGAGCGTCTTTT 57.161 45.000 0.00 0.00 0.00 2.27
319 334 6.662865 TTTCCATTTGCTTCCAATAGTTCA 57.337 33.333 0.00 0.00 0.00 3.18
779 795 7.937942 ACCTAATTCAGCTCTACGTAAGATAGA 59.062 37.037 0.00 0.00 43.62 1.98
1170 1186 2.906389 TGAAGCGCATAGGGATAGGATT 59.094 45.455 11.47 0.00 0.00 3.01
1249 1265 0.107703 CCTTGCTTCCAGGATACGCA 60.108 55.000 4.85 4.85 46.39 5.24
1272 1288 7.230222 GCATCGAGATTAATAAAATCGTGGAG 58.770 38.462 9.12 2.29 35.05 3.86
1452 1468 3.936203 GTGAGGGACGTGTGGCCA 61.936 66.667 0.00 0.00 0.00 5.36
1624 1640 5.105797 TGGGAAATTCCAATGATTCTTCGTG 60.106 40.000 14.68 0.00 38.64 4.35
2232 2255 3.624861 GCGACTTGACTGATTGGATCAAT 59.375 43.478 0.00 0.00 39.11 2.57
2476 2499 2.000447 GTGGAAACGCTGTCTATGGTC 59.000 52.381 0.00 0.00 38.02 4.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
6 7 2.159627 CGCTAGTTGCTCAATCCGTTTT 59.840 45.455 0.00 0.00 40.11 2.43
7 8 1.732259 CGCTAGTTGCTCAATCCGTTT 59.268 47.619 0.00 0.00 40.11 3.60
319 334 4.157840 GCCGACAATTTTTCTGGATAGGTT 59.842 41.667 0.00 0.00 0.00 3.50
779 795 3.810941 TCGATTGCTCAACCGTACTTTTT 59.189 39.130 0.00 0.00 0.00 1.94
1040 1056 2.447244 GCTAGCTGCTTCCATATCGT 57.553 50.000 7.79 0.00 38.95 3.73
1249 1265 7.667557 TCCTCCACGATTTTATTAATCTCGAT 58.332 34.615 13.32 0.00 33.74 3.59
1272 1288 5.963736 GGTTAGCCAATACGGATCGATATCC 60.964 48.000 0.00 0.00 40.57 2.59
1624 1640 9.549078 GCCCCTAAGATAGTATAGAAATAATGC 57.451 37.037 0.00 0.00 0.00 3.56
1651 1667 1.070289 GAGGCATACGGGGTTAAGGAG 59.930 57.143 0.00 0.00 0.00 3.69
1891 1908 2.249139 AGAAGAGGCTCCGTTTGTAGT 58.751 47.619 11.71 0.00 0.00 2.73
2056 2079 6.729100 TGGAGAATTAGTCTTTCTAACTCCCA 59.271 38.462 15.31 9.81 43.67 4.37
2232 2255 8.514330 AAGTTTTAGGATTATGGCGTAAATGA 57.486 30.769 2.82 0.00 0.00 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.