Multiple sequence alignment - TraesCS5B01G096800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G096800 chr5B 100.000 2558 0 0 1 2558 127825765 127823208 0 4724
1 TraesCS5B01G096800 chr5B 98.437 2559 39 1 1 2558 713088994 713091552 0 4503
2 TraesCS5B01G096800 chr5B 98.242 2559 44 1 1 2558 713119732 713117174 0 4475
3 TraesCS5B01G096800 chrUn 98.985 2561 23 2 1 2558 246703763 246701203 0 4582
4 TraesCS5B01G096800 chr6B 98.984 2560 24 2 1 2558 128896750 128894191 0 4582
5 TraesCS5B01G096800 chr7B 98.867 2560 27 2 1 2558 698133378 698130819 0 4566
6 TraesCS5B01G096800 chr7B 98.750 2560 30 2 1 2558 742930718 742933277 0 4549
7 TraesCS5B01G096800 chr7B 98.281 2560 42 2 1 2558 716802612 716800053 0 4482
8 TraesCS5B01G096800 chr2B 98.008 2560 49 2 1 2558 760900740 760898181 0 4444
9 TraesCS5B01G096800 chr2B 97.818 1421 27 2 1 1420 526494002 526492585 0 2449
10 TraesCS5B01G096800 chr2B 98.009 1155 22 1 1405 2558 391176538 391175384 0 2004


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G096800 chr5B 127823208 127825765 2557 True 4724 4724 100.000 1 2558 1 chr5B.!!$R1 2557
1 TraesCS5B01G096800 chr5B 713088994 713091552 2558 False 4503 4503 98.437 1 2558 1 chr5B.!!$F1 2557
2 TraesCS5B01G096800 chr5B 713117174 713119732 2558 True 4475 4475 98.242 1 2558 1 chr5B.!!$R2 2557
3 TraesCS5B01G096800 chrUn 246701203 246703763 2560 True 4582 4582 98.985 1 2558 1 chrUn.!!$R1 2557
4 TraesCS5B01G096800 chr6B 128894191 128896750 2559 True 4582 4582 98.984 1 2558 1 chr6B.!!$R1 2557
5 TraesCS5B01G096800 chr7B 698130819 698133378 2559 True 4566 4566 98.867 1 2558 1 chr7B.!!$R1 2557
6 TraesCS5B01G096800 chr7B 742930718 742933277 2559 False 4549 4549 98.750 1 2558 1 chr7B.!!$F1 2557
7 TraesCS5B01G096800 chr7B 716800053 716802612 2559 True 4482 4482 98.281 1 2558 1 chr7B.!!$R2 2557
8 TraesCS5B01G096800 chr2B 760898181 760900740 2559 True 4444 4444 98.008 1 2558 1 chr2B.!!$R3 2557
9 TraesCS5B01G096800 chr2B 526492585 526494002 1417 True 2449 2449 97.818 1 1420 1 chr2B.!!$R2 1419
10 TraesCS5B01G096800 chr2B 391175384 391176538 1154 True 2004 2004 98.009 1405 2558 1 chr2B.!!$R1 1153

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
621 625 9.277783 AGGTAATGGAATTGATAGAGAAATTCG 57.722 33.333 0.0 0.0 41.6 3.34 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1696 1700 1.070134 CTGGAACAAGAAGGGTCGTCA 59.93 52.381 0.0 0.0 38.7 4.35 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
621 625 9.277783 AGGTAATGGAATTGATAGAGAAATTCG 57.722 33.333 0.00 0.0 41.60 3.34
1051 1055 4.818546 CCAGAAAATCGATTATGCTCCTGT 59.181 41.667 11.83 0.0 0.00 4.00
1185 1189 0.674534 GCAGATGTAGTAGGGGTCGG 59.325 60.000 0.00 0.0 0.00 4.79
1324 1328 2.279741 GTGCTATGAGCGGACAATTCA 58.720 47.619 0.00 0.0 46.26 2.57
1325 1329 2.874701 GTGCTATGAGCGGACAATTCAT 59.125 45.455 0.00 0.0 46.26 2.57
1554 1558 3.080300 ACCAAGTTTGTTCAGTGGTCA 57.920 42.857 0.00 0.0 38.16 4.02
1814 1818 1.136690 GAAGCGTGATGTTGTCGTGA 58.863 50.000 0.00 0.0 0.00 4.35
1825 1829 2.877786 TGTTGTCGTGATGTCAGCAATT 59.122 40.909 0.00 0.0 0.00 2.32
1874 1878 4.738124 TGCGTTGTTTCAATTTCTGTTCA 58.262 34.783 0.00 0.0 0.00 3.18
1909 1913 1.153489 GCTGCAGCTCGATCTTGGA 60.153 57.895 31.33 0.0 38.21 3.53
2434 2439 1.667236 CAATTGCGCCCTAGTGATGA 58.333 50.000 4.18 0.0 0.00 2.92
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
228 229 5.420409 GAAATGATTGAGAACTAGGACGGT 58.580 41.667 0.00 0.0 0.00 4.83
360 364 0.955905 GCTCGGGCCAAACACTTTTA 59.044 50.000 4.39 0.0 0.00 1.52
621 625 8.586744 CAATTTTCCTATCCTACCTAGGTCTAC 58.413 40.741 20.32 0.0 44.02 2.59
1027 1031 5.059161 CAGGAGCATAATCGATTTTCTGGA 58.941 41.667 17.19 0.0 0.00 3.86
1051 1055 4.769688 TCCGTTACGAGTAGATACTTCCA 58.230 43.478 6.24 0.0 36.50 3.53
1185 1189 1.002773 AGTTGTGTACCATCCGGTTCC 59.997 52.381 0.00 0.0 46.31 3.62
1554 1558 5.697082 TCCCCACTAACCAATTACGTTAT 57.303 39.130 0.00 0.0 0.00 1.89
1696 1700 1.070134 CTGGAACAAGAAGGGTCGTCA 59.930 52.381 0.00 0.0 38.70 4.35
1874 1878 2.915349 CAGCCACAGCAATCAGAGTAT 58.085 47.619 0.00 0.0 43.56 2.12


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.