Multiple sequence alignment - TraesCS5B01G096700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G096700 chr5B 100.000 2372 0 0 1 2372 127808630 127811001 0.000000e+00 4381.0
1 TraesCS5B01G096700 chr5B 98.567 2373 33 1 1 2372 44989097 44991469 0.000000e+00 4193.0
2 TraesCS5B01G096700 chr3B 98.693 2372 31 0 1 2372 201615153 201617524 0.000000e+00 4209.0
3 TraesCS5B01G096700 chr3B 98.842 259 3 0 1353 1611 524468319 524468061 1.660000e-126 462.0
4 TraesCS5B01G096700 chr1B 98.398 2372 37 1 1 2372 638728835 638731205 0.000000e+00 4169.0
5 TraesCS5B01G096700 chr1B 97.138 2376 63 2 1 2372 135053758 135051384 0.000000e+00 4006.0
6 TraesCS5B01G096700 chr2B 97.246 2179 58 2 1 2179 1454223 1452047 0.000000e+00 3690.0
7 TraesCS5B01G096700 chr7B 99.083 1418 13 0 1 1418 662726601 662728018 0.000000e+00 2547.0
8 TraesCS5B01G096700 chr7B 94.986 698 29 1 1675 2372 47246657 47247348 0.000000e+00 1090.0
9 TraesCS5B01G096700 chr3D 98.944 1421 15 0 1 1421 589263329 589261909 0.000000e+00 2542.0
10 TraesCS5B01G096700 chr3A 98.944 1421 15 0 1 1421 66004936 66003516 0.000000e+00 2542.0
11 TraesCS5B01G096700 chr6D 98.874 1421 16 0 1 1421 389245625 389244205 0.000000e+00 2536.0
12 TraesCS5B01G096700 chr2A 97.095 964 27 1 1409 2372 53948986 53948024 0.000000e+00 1624.0
13 TraesCS5B01G096700 chr4A 97.674 86 2 0 2206 2291 670459470 670459385 5.280000e-32 148.0
14 TraesCS5B01G096700 chr4B 95.238 42 1 1 1867 1907 104460384 104460425 5.470000e-07 65.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G096700 chr5B 127808630 127811001 2371 False 4381 4381 100.000 1 2372 1 chr5B.!!$F2 2371
1 TraesCS5B01G096700 chr5B 44989097 44991469 2372 False 4193 4193 98.567 1 2372 1 chr5B.!!$F1 2371
2 TraesCS5B01G096700 chr3B 201615153 201617524 2371 False 4209 4209 98.693 1 2372 1 chr3B.!!$F1 2371
3 TraesCS5B01G096700 chr1B 638728835 638731205 2370 False 4169 4169 98.398 1 2372 1 chr1B.!!$F1 2371
4 TraesCS5B01G096700 chr1B 135051384 135053758 2374 True 4006 4006 97.138 1 2372 1 chr1B.!!$R1 2371
5 TraesCS5B01G096700 chr2B 1452047 1454223 2176 True 3690 3690 97.246 1 2179 1 chr2B.!!$R1 2178
6 TraesCS5B01G096700 chr7B 662726601 662728018 1417 False 2547 2547 99.083 1 1418 1 chr7B.!!$F2 1417
7 TraesCS5B01G096700 chr7B 47246657 47247348 691 False 1090 1090 94.986 1675 2372 1 chr7B.!!$F1 697
8 TraesCS5B01G096700 chr3D 589261909 589263329 1420 True 2542 2542 98.944 1 1421 1 chr3D.!!$R1 1420
9 TraesCS5B01G096700 chr3A 66003516 66004936 1420 True 2542 2542 98.944 1 1421 1 chr3A.!!$R1 1420
10 TraesCS5B01G096700 chr6D 389244205 389245625 1420 True 2536 2536 98.874 1 1421 1 chr6D.!!$R1 1420
11 TraesCS5B01G096700 chr2A 53948024 53948986 962 True 1624 1624 97.095 1409 2372 1 chr2A.!!$R1 963

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
346 348 3.760684 GAGACAAAAAGATGGGCTGTCAT 59.239 43.478 3.61 0.0 39.08 3.06 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1930 1936 0.450184 CAACTTTTGTATCCGCGGGG 59.55 55.0 27.83 13.31 0.0 5.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
346 348 3.760684 GAGACAAAAAGATGGGCTGTCAT 59.239 43.478 3.61 0.00 39.08 3.06
1008 1014 1.447217 CCTATGGCGGATGTCAGCA 59.553 57.895 7.40 0.00 38.83 4.41
1204 1210 1.527433 AAAGAGGAAAGGCTTGCGGC 61.527 55.000 0.00 0.00 40.90 6.53
1221 1227 2.880380 GCGGATACCTAGGCACCCC 61.880 68.421 9.30 4.35 0.00 4.95
1284 1290 7.001073 GGGGAGTTGAAAATAAGCATAGATCT 58.999 38.462 0.00 0.00 0.00 2.75
1504 1510 2.478292 CCCCCAACAGATACCAGTACT 58.522 52.381 0.00 0.00 0.00 2.73
1664 1670 5.050490 CACTATCCAAAATCGGTAGACAGG 58.950 45.833 0.00 0.00 0.00 4.00
1868 1874 7.839680 AAGATGGACTTGTTACTTTGGAATT 57.160 32.000 0.00 0.00 37.45 2.17
1930 1936 8.588982 GACTTTAGTCAAATTAATGAAGCGAC 57.411 34.615 5.04 0.00 44.18 5.19
1970 1976 4.893608 TGTGTTTGAAGTATGAGCTGCTA 58.106 39.130 0.15 0.00 0.00 3.49
2122 2128 5.347342 CCACTGTAGAAGATGATCACACTC 58.653 45.833 0.00 0.00 0.00 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
346 348 4.140758 CCCATCCTACCTCCTCTACCTTTA 60.141 50.000 0.00 0.00 0.00 1.85
1008 1014 1.677052 GGAGATAAGCGGACTCGAACT 59.323 52.381 0.00 0.00 39.00 3.01
1091 1097 7.172019 CGTCCATGAATGTGAAATCATAGATCA 59.828 37.037 0.00 2.51 34.61 2.92
1204 1210 2.571216 CGGGGTGCCTAGGTATCCG 61.571 68.421 21.65 22.18 31.41 4.18
1221 1227 2.049475 CTACGCCCTTCCTCGTCTCG 62.049 65.000 0.00 0.00 39.79 4.04
1284 1290 4.325030 GGTTGACCTATTTGGGAATCTCCA 60.325 45.833 0.00 0.00 38.64 3.86
1571 1577 1.960417 TGGTCATTTGACGCAACTCA 58.040 45.000 4.72 0.00 45.65 3.41
1868 1874 5.609284 TCCCAGCTGCCCTAATAAGTTTATA 59.391 40.000 8.66 0.00 0.00 0.98
1930 1936 0.450184 CAACTTTTGTATCCGCGGGG 59.550 55.000 27.83 13.31 0.00 5.73
1943 1949 6.498304 CAGCTCATACTTCAAACACAACTTT 58.502 36.000 0.00 0.00 0.00 2.66
1970 1976 3.806625 AATGTTGTTTTCAGCAGCAGT 57.193 38.095 0.00 0.00 43.65 4.40
2122 2128 2.948979 ACAGCGACTATCTCTCTTCCAG 59.051 50.000 0.00 0.00 0.00 3.86


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.