Multiple sequence alignment - TraesCS5B01G093900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G093900 chr5B 100.000 2627 0 0 1 2627 123220493 123217867 0.000000e+00 4852.0
1 TraesCS5B01G093900 chr5B 98.108 2008 36 2 621 2627 123437922 123435916 0.000000e+00 3496.0
2 TraesCS5B01G093900 chr5B 96.259 1283 34 11 966 2245 123014109 123012838 0.000000e+00 2091.0
3 TraesCS5B01G093900 chr5B 98.455 971 14 1 1 970 123023102 123022132 0.000000e+00 1709.0
4 TraesCS5B01G093900 chr5B 90.029 1033 88 7 633 1651 88340259 88341290 0.000000e+00 1323.0
5 TraesCS5B01G093900 chr5B 85.606 792 84 12 846 1629 88211463 88212232 0.000000e+00 804.0
6 TraesCS5B01G093900 chr5B 85.593 236 30 3 621 852 88211060 88211295 7.260000e-61 244.0
7 TraesCS5B01G093900 chr5B 89.349 169 8 4 281 440 123438293 123438126 1.230000e-48 204.0
8 TraesCS5B01G093900 chr5B 82.237 152 16 8 1961 2111 483951630 483951771 1.280000e-23 121.0
9 TraesCS5B01G093900 chr5B 89.535 86 7 2 2149 2233 250223299 250223215 9.940000e-20 108.0
10 TraesCS5B01G093900 chr5A 90.909 1012 86 5 623 1629 74863164 74864174 0.000000e+00 1354.0
11 TraesCS5B01G093900 chr5A 88.629 299 30 2 1 295 504565345 504565643 6.910000e-96 361.0
12 TraesCS5B01G093900 chr5A 95.139 144 7 0 2267 2410 604994115 604994258 7.310000e-56 228.0
13 TraesCS5B01G093900 chr5D 86.396 1132 122 19 621 1722 78503963 78505092 0.000000e+00 1208.0
14 TraesCS5B01G093900 chr5D 91.693 638 52 1 623 1259 78594520 78595157 0.000000e+00 883.0
15 TraesCS5B01G093900 chr5D 85.867 750 92 9 892 1629 78371229 78371976 0.000000e+00 785.0
16 TraesCS5B01G093900 chr5D 87.745 408 48 2 1251 1657 78602935 78603341 2.370000e-130 475.0
17 TraesCS5B01G093900 chr5D 86.380 279 34 3 621 895 78361838 78362116 4.250000e-78 302.0
18 TraesCS5B01G093900 chr5D 78.986 276 41 10 1969 2232 37662002 37662272 3.480000e-39 172.0
19 TraesCS5B01G093900 chr5D 85.366 82 7 4 395 473 78594211 78594290 2.170000e-11 80.5
20 TraesCS5B01G093900 chr5D 88.889 54 5 1 2213 2266 216058034 216058086 6.070000e-07 65.8
21 TraesCS5B01G093900 chr7A 98.157 217 4 0 2411 2627 211292414 211292198 1.910000e-101 379.0
22 TraesCS5B01G093900 chr7A 78.879 232 36 8 1961 2184 543430444 543430218 7.580000e-31 145.0
23 TraesCS5B01G093900 chr7A 89.908 109 10 1 112 219 147925045 147924937 3.530000e-29 139.0
24 TraesCS5B01G093900 chr4D 98.157 217 4 0 2411 2627 123508047 123508263 1.910000e-101 379.0
25 TraesCS5B01G093900 chr4D 98.157 217 4 0 2411 2627 123737543 123737759 1.910000e-101 379.0
26 TraesCS5B01G093900 chr4D 97.696 217 5 0 2411 2627 123654746 123654962 8.880000e-100 374.0
27 TraesCS5B01G093900 chr2B 98.157 217 4 0 2411 2627 357244934 357245150 1.910000e-101 379.0
28 TraesCS5B01G093900 chr1D 98.157 217 4 0 2411 2627 212467754 212467970 1.910000e-101 379.0
29 TraesCS5B01G093900 chr1D 79.907 214 28 10 2028 2232 462387478 462387685 2.730000e-30 143.0
30 TraesCS5B01G093900 chr1D 78.974 195 32 4 1967 2154 420859347 420859155 9.870000e-25 124.0
31 TraesCS5B01G093900 chr2D 89.632 299 27 1 1 295 549723669 549723967 6.860000e-101 377.0
32 TraesCS5B01G093900 chr2D 88.963 299 29 1 1 295 550222615 550222913 1.490000e-97 366.0
33 TraesCS5B01G093900 chr6B 97.696 217 5 0 2411 2627 215728380 215728596 8.880000e-100 374.0
34 TraesCS5B01G093900 chr6B 80.000 105 11 4 1208 1312 671658525 671658619 4.690000e-08 69.4
35 TraesCS5B01G093900 chr3B 97.696 217 5 0 2411 2627 39816880 39816664 8.880000e-100 374.0
36 TraesCS5B01G093900 chr3B 95.000 40 2 0 2226 2265 733416119 733416158 2.180000e-06 63.9
37 TraesCS5B01G093900 chr3D 83.813 278 31 9 1961 2232 517012054 517011785 4.340000e-63 252.0
38 TraesCS5B01G093900 chr3D 94.444 144 8 0 2267 2410 202633229 202633086 3.400000e-54 222.0
39 TraesCS5B01G093900 chr3D 78.777 278 37 12 1965 2232 126385816 126385551 1.620000e-37 167.0
40 TraesCS5B01G093900 chr3D 80.603 232 31 8 1961 2184 454744552 454744327 1.620000e-37 167.0
41 TraesCS5B01G093900 chrUn 94.444 144 8 0 2267 2410 206793358 206793215 3.400000e-54 222.0
42 TraesCS5B01G093900 chrUn 94.444 144 8 0 2267 2410 246706002 246705859 3.400000e-54 222.0
43 TraesCS5B01G093900 chrUn 94.444 144 8 0 2267 2410 266186159 266186016 3.400000e-54 222.0
44 TraesCS5B01G093900 chrUn 94.444 144 8 0 2267 2410 432754936 432754793 3.400000e-54 222.0
45 TraesCS5B01G093900 chrUn 89.908 109 10 1 111 218 92265971 92266079 3.530000e-29 139.0
46 TraesCS5B01G093900 chr6A 94.444 144 8 0 2267 2410 597219701 597219844 3.400000e-54 222.0
47 TraesCS5B01G093900 chr6A 92.157 51 2 2 2230 2278 194459375 194459325 1.300000e-08 71.3
48 TraesCS5B01G093900 chr1A 93.878 147 8 1 2267 2413 359901593 359901738 1.220000e-53 220.0
49 TraesCS5B01G093900 chr1A 79.741 232 36 7 1960 2184 65807737 65807964 9.730000e-35 158.0
50 TraesCS5B01G093900 chr7B 78.397 287 41 13 1961 2232 621455733 621456013 1.620000e-37 167.0
51 TraesCS5B01G093900 chr7B 87.500 56 6 1 2208 2263 695281667 695281721 2.180000e-06 63.9
52 TraesCS5B01G093900 chr3A 79.654 231 34 9 1998 2221 721673493 721673269 1.260000e-33 154.0
53 TraesCS5B01G093900 chr3A 78.448 232 37 7 1961 2183 675122441 675122214 3.530000e-29 139.0
54 TraesCS5B01G093900 chr3A 88.073 109 12 1 112 219 362208860 362208752 7.630000e-26 128.0
55 TraesCS5B01G093900 chr4B 78.277 267 37 14 1977 2232 517006847 517006591 4.530000e-33 152.0
56 TraesCS5B01G093900 chr4B 88.182 110 12 1 111 219 643807203 643807312 2.120000e-26 130.0
57 TraesCS5B01G093900 chr4B 80.769 104 10 1 1209 1312 644837291 644837384 3.630000e-09 73.1
58 TraesCS5B01G093900 chr2A 90.179 112 9 2 107 216 170599443 170599554 7.580000e-31 145.0
59 TraesCS5B01G093900 chr2A 92.157 51 2 2 2230 2278 474323792 474323742 1.300000e-08 71.3
60 TraesCS5B01G093900 chr2A 90.566 53 3 2 2211 2263 730128831 730128781 4.690000e-08 69.4
61 TraesCS5B01G093900 chr2A 90.385 52 3 2 2215 2266 657809346 657809297 1.690000e-07 67.6
62 TraesCS5B01G093900 chr4A 77.559 254 44 9 1984 2232 45737104 45737349 9.800000e-30 141.0
63 TraesCS5B01G093900 chr4A 77.519 258 39 12 1987 2232 589470866 589471116 1.270000e-28 137.0
64 TraesCS5B01G093900 chr4A 79.381 194 28 8 1977 2165 45467227 45467041 2.740000e-25 126.0
65 TraesCS5B01G093900 chr7D 90.196 51 3 2 2229 2279 421880246 421880198 6.070000e-07 65.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G093900 chr5B 123217867 123220493 2626 True 4852.00 4852 100.0000 1 2627 1 chr5B.!!$R3 2626
1 TraesCS5B01G093900 chr5B 123012838 123014109 1271 True 2091.00 2091 96.2590 966 2245 1 chr5B.!!$R1 1279
2 TraesCS5B01G093900 chr5B 123435916 123438293 2377 True 1850.00 3496 93.7285 281 2627 2 chr5B.!!$R5 2346
3 TraesCS5B01G093900 chr5B 123022132 123023102 970 True 1709.00 1709 98.4550 1 970 1 chr5B.!!$R2 969
4 TraesCS5B01G093900 chr5B 88340259 88341290 1031 False 1323.00 1323 90.0290 633 1651 1 chr5B.!!$F1 1018
5 TraesCS5B01G093900 chr5B 88211060 88212232 1172 False 524.00 804 85.5995 621 1629 2 chr5B.!!$F3 1008
6 TraesCS5B01G093900 chr5A 74863164 74864174 1010 False 1354.00 1354 90.9090 623 1629 1 chr5A.!!$F1 1006
7 TraesCS5B01G093900 chr5D 78503963 78505092 1129 False 1208.00 1208 86.3960 621 1722 1 chr5D.!!$F4 1101
8 TraesCS5B01G093900 chr5D 78371229 78371976 747 False 785.00 785 85.8670 892 1629 1 chr5D.!!$F3 737
9 TraesCS5B01G093900 chr5D 78594211 78595157 946 False 481.75 883 88.5295 395 1259 2 chr5D.!!$F7 864

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
257 258 0.512952 CAAGTGTAGAACGGCACAGC 59.487 55.0 0.0 0.0 38.02 4.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2296 2658 2.432628 CGCCCTCACTGAACCGAC 60.433 66.667 0.0 0.0 0.0 4.79 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
17 18 4.280494 AACACCGACAGCGACGCT 62.280 61.111 18.46 18.46 40.77 5.07
134 135 3.627123 GCAAAAGGCACAAATTTGACCTT 59.373 39.130 28.90 28.90 44.27 3.50
137 138 6.279882 CAAAAGGCACAAATTTGACCTTAGA 58.720 36.000 31.79 0.00 42.82 2.10
190 191 5.643379 TGAAAATATTTCACCCAGCTGAC 57.357 39.130 17.39 0.00 0.00 3.51
193 194 0.623723 TATTTCACCCAGCTGACCCC 59.376 55.000 17.39 0.00 0.00 4.95
208 209 3.604667 CCCTTTGTGCAGCGCCAA 61.605 61.111 2.29 0.00 0.00 4.52
213 214 0.597118 TTTGTGCAGCGCCAAACATC 60.597 50.000 2.29 0.00 0.00 3.06
257 258 0.512952 CAAGTGTAGAACGGCACAGC 59.487 55.000 0.00 0.00 38.02 4.40
317 318 4.042187 AGTGAGGTAACAGAGATTTTGGCT 59.958 41.667 0.00 0.00 41.41 4.75
2164 2526 6.682423 TCGGTCGAAATAGTGTGAATAGTA 57.318 37.500 0.00 0.00 0.00 1.82
2489 2851 1.357137 GGATCCTCCCTCATTCTCCC 58.643 60.000 3.84 0.00 0.00 4.30
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
64 65 2.043852 TTGGCCAACACCACCGTT 60.044 55.556 16.05 0.0 40.19 4.44
174 175 0.623723 GGGGTCAGCTGGGTGAAATA 59.376 55.000 15.13 0.0 0.00 1.40
193 194 0.598158 ATGTTTGGCGCTGCACAAAG 60.598 50.000 16.57 0.0 37.27 2.77
213 214 7.707464 TGCTCAATTAACATTTCATATGCCTTG 59.293 33.333 0.00 0.0 0.00 3.61
368 375 0.609131 ATGGTTGGAGGCAAAGTCCG 60.609 55.000 0.00 0.0 36.82 4.79
2296 2658 2.432628 CGCCCTCACTGAACCGAC 60.433 66.667 0.00 0.0 0.00 4.79
2315 2677 0.109781 CCATTTGGTGACTTTCGCGG 60.110 55.000 6.13 0.0 0.00 6.46
2424 2786 0.179000 CAACCGGGATCTCCTTGAGG 59.821 60.000 6.32 0.0 35.95 3.86
2489 2851 2.736978 AGCGTCTTATCAAGATCTGCG 58.263 47.619 0.00 0.0 40.18 5.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.