Multiple sequence alignment - TraesCS5B01G093800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G093800 chr5B 100.000 2813 0 0 1 2813 123215095 123217907 0.000000e+00 5195.0
1 TraesCS5B01G093800 chr5B 98.161 2284 33 4 1 2280 123432625 123434903 0.000000e+00 3976.0
2 TraesCS5B01G093800 chr5B 95.142 2141 83 13 1 2132 544542196 544544324 0.000000e+00 3358.0
3 TraesCS5B01G093800 chr5B 91.320 1394 95 12 753 2132 452227429 452228810 0.000000e+00 1881.0
4 TraesCS5B01G093800 chr5B 97.993 548 10 1 2267 2813 123435409 123435956 0.000000e+00 950.0
5 TraesCS5B01G093800 chr5B 97.248 109 1 1 2133 2239 544544371 544544479 1.720000e-42 183.0
6 TraesCS5B01G093800 chr7B 95.093 2140 88 10 1 2132 131084462 131082332 0.000000e+00 3354.0
7 TraesCS5B01G093800 chr7B 88.946 389 35 5 2257 2644 122843515 122843896 9.120000e-130 473.0
8 TraesCS5B01G093800 chr7B 97.297 111 3 0 2138 2248 131082278 131082168 3.700000e-44 189.0
9 TraesCS5B01G093800 chr6B 95.402 1740 67 7 1 1736 516542356 516540626 0.000000e+00 2758.0
10 TraesCS5B01G093800 chr6B 90.402 448 35 5 2325 2769 303956598 303957040 1.450000e-162 582.0
11 TraesCS5B01G093800 chr6B 88.470 451 43 6 2322 2769 303954397 303954841 1.150000e-148 536.0
12 TraesCS5B01G093800 chr6B 89.378 386 33 5 2260 2644 250789561 250789183 1.960000e-131 479.0
13 TraesCS5B01G093800 chr6B 100.000 45 0 0 2769 2813 215728600 215728556 1.800000e-12 84.2
14 TraesCS5B01G093800 chr5A 91.617 1694 122 11 453 2132 671869074 671867387 0.000000e+00 2324.0
15 TraesCS5B01G093800 chr5A 96.471 85 3 0 2158 2242 149207187 149207103 1.050000e-29 141.0
16 TraesCS5B01G093800 chr1D 91.046 1396 93 12 753 2132 465905461 465904082 0.000000e+00 1857.0
17 TraesCS5B01G093800 chr1B 90.961 1394 102 10 753 2132 642703791 642702408 0.000000e+00 1855.0
18 TraesCS5B01G093800 chr1B 88.294 299 30 3 157 454 628861807 628862101 1.240000e-93 353.0
19 TraesCS5B01G093800 chr1B 86.957 299 34 3 157 454 77632443 77632737 5.810000e-87 331.0
20 TraesCS5B01G093800 chr2A 90.309 1424 98 22 453 1845 763359060 763357646 0.000000e+00 1829.0
21 TraesCS5B01G093800 chr2A 89.811 795 69 9 453 1238 635602509 635603300 0.000000e+00 1009.0
22 TraesCS5B01G093800 chr2A 89.262 298 31 1 157 454 743537379 743537083 3.420000e-99 372.0
23 TraesCS5B01G093800 chr2A 95.402 87 4 0 2154 2240 763348547 763348461 3.780000e-29 139.0
24 TraesCS5B01G093800 chr5D 91.235 1255 84 13 893 2132 439394934 439393691 0.000000e+00 1685.0
25 TraesCS5B01G093800 chr5D 89.152 507 40 9 2260 2757 482148123 482147623 3.980000e-173 617.0
26 TraesCS5B01G093800 chr5D 91.176 102 5 4 2150 2248 439393638 439393538 4.890000e-28 135.0
27 TraesCS5B01G093800 chr2D 91.878 1182 72 12 967 2132 459841631 459840458 0.000000e+00 1629.0
28 TraesCS5B01G093800 chr2D 91.371 1182 79 9 967 2132 579155143 579153969 0.000000e+00 1596.0
29 TraesCS5B01G093800 chr2D 90.380 1185 89 12 964 2132 46318708 46317533 0.000000e+00 1533.0
30 TraesCS5B01G093800 chr2D 92.371 485 36 1 453 937 46321963 46321480 0.000000e+00 689.0
31 TraesCS5B01G093800 chr2D 94.505 91 5 0 2149 2239 432003357 432003267 1.050000e-29 141.0
32 TraesCS5B01G093800 chr3B 90.063 795 67 10 453 1238 8691697 8690906 0.000000e+00 1020.0
33 TraesCS5B01G093800 chr3B 88.235 527 55 5 2246 2769 6978371 6978893 8.560000e-175 623.0
34 TraesCS5B01G093800 chr3B 90.164 244 22 2 166 408 682119445 682119203 1.630000e-82 316.0
35 TraesCS5B01G093800 chr3B 92.000 100 7 1 2149 2248 598071448 598071546 3.780000e-29 139.0
36 TraesCS5B01G093800 chr3A 87.645 518 52 5 2260 2769 644327867 644327354 2.410000e-165 592.0
37 TraesCS5B01G093800 chr6A 86.639 479 56 6 2293 2769 133735988 133735516 8.930000e-145 523.0
38 TraesCS5B01G093800 chr1A 89.262 298 31 1 157 454 137693047 137692751 3.420000e-99 372.0
39 TraesCS5B01G093800 chr7D 98.750 80 1 0 2162 2241 27245377 27245298 2.920000e-30 143.0
40 TraesCS5B01G093800 chr7D 100.000 45 0 0 2769 2813 579029614 579029658 1.800000e-12 84.2
41 TraesCS5B01G093800 chrUn 100.000 45 0 0 2769 2813 415354615 415354659 1.800000e-12 84.2
42 TraesCS5B01G093800 chr7A 100.000 45 0 0 2769 2813 211292194 211292238 1.800000e-12 84.2
43 TraesCS5B01G093800 chr2B 100.000 45 0 0 2769 2813 357718749 357718705 1.800000e-12 84.2
44 TraesCS5B01G093800 chr6D 97.778 45 1 0 2769 2813 57921069 57921113 8.350000e-11 78.7
45 TraesCS5B01G093800 chr6D 97.778 45 1 0 2769 2813 108467598 108467642 8.350000e-11 78.7
46 TraesCS5B01G093800 chr4D 97.778 45 1 0 2769 2813 123508267 123508223 8.350000e-11 78.7


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G093800 chr5B 123215095 123217907 2812 False 5195.0 5195 100.0000 1 2813 1 chr5B.!!$F1 2812
1 TraesCS5B01G093800 chr5B 123432625 123435956 3331 False 2463.0 3976 98.0770 1 2813 2 chr5B.!!$F3 2812
2 TraesCS5B01G093800 chr5B 452227429 452228810 1381 False 1881.0 1881 91.3200 753 2132 1 chr5B.!!$F2 1379
3 TraesCS5B01G093800 chr5B 544542196 544544479 2283 False 1770.5 3358 96.1950 1 2239 2 chr5B.!!$F4 2238
4 TraesCS5B01G093800 chr7B 131082168 131084462 2294 True 1771.5 3354 96.1950 1 2248 2 chr7B.!!$R1 2247
5 TraesCS5B01G093800 chr6B 516540626 516542356 1730 True 2758.0 2758 95.4020 1 1736 1 chr6B.!!$R3 1735
6 TraesCS5B01G093800 chr6B 303954397 303957040 2643 False 559.0 582 89.4360 2322 2769 2 chr6B.!!$F1 447
7 TraesCS5B01G093800 chr5A 671867387 671869074 1687 True 2324.0 2324 91.6170 453 2132 1 chr5A.!!$R2 1679
8 TraesCS5B01G093800 chr1D 465904082 465905461 1379 True 1857.0 1857 91.0460 753 2132 1 chr1D.!!$R1 1379
9 TraesCS5B01G093800 chr1B 642702408 642703791 1383 True 1855.0 1855 90.9610 753 2132 1 chr1B.!!$R1 1379
10 TraesCS5B01G093800 chr2A 763357646 763359060 1414 True 1829.0 1829 90.3090 453 1845 1 chr2A.!!$R3 1392
11 TraesCS5B01G093800 chr2A 635602509 635603300 791 False 1009.0 1009 89.8110 453 1238 1 chr2A.!!$F1 785
12 TraesCS5B01G093800 chr5D 439393538 439394934 1396 True 910.0 1685 91.2055 893 2248 2 chr5D.!!$R2 1355
13 TraesCS5B01G093800 chr5D 482147623 482148123 500 True 617.0 617 89.1520 2260 2757 1 chr5D.!!$R1 497
14 TraesCS5B01G093800 chr2D 459840458 459841631 1173 True 1629.0 1629 91.8780 967 2132 1 chr2D.!!$R2 1165
15 TraesCS5B01G093800 chr2D 579153969 579155143 1174 True 1596.0 1596 91.3710 967 2132 1 chr2D.!!$R3 1165
16 TraesCS5B01G093800 chr2D 46317533 46321963 4430 True 1111.0 1533 91.3755 453 2132 2 chr2D.!!$R4 1679
17 TraesCS5B01G093800 chr3B 8690906 8691697 791 True 1020.0 1020 90.0630 453 1238 1 chr3B.!!$R1 785
18 TraesCS5B01G093800 chr3B 6978371 6978893 522 False 623.0 623 88.2350 2246 2769 1 chr3B.!!$F1 523
19 TraesCS5B01G093800 chr3A 644327354 644327867 513 True 592.0 592 87.6450 2260 2769 1 chr3A.!!$R1 509

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
687 696 1.599916 GCTATACTTCTCCGACGCCAC 60.6 57.143 0.0 0.0 0.0 5.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2282 5682 0.317479 GTTGGTCTCCAGTGCGTAGT 59.683 55.0 0.0 0.0 33.81 2.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
504 512 3.809279 GCTATTGCCAGCAAACAAGTTTT 59.191 39.130 9.44 0.00 41.40 2.43
687 696 1.599916 GCTATACTTCTCCGACGCCAC 60.600 57.143 0.00 0.00 0.00 5.01
1017 3775 0.389687 CCATGTTCGGCCGCAAAAAT 60.390 50.000 23.51 8.54 0.00 1.82
1620 4428 7.201947 CCAGATTATGATACACTCAAGGTCAGA 60.202 40.741 0.00 0.00 37.44 3.27
2255 5136 0.179056 AGTGTGTGTTAACGCTGGCT 60.179 50.000 19.29 11.23 39.40 4.75
2282 5682 3.178592 CATGCGTGCGTGCTCGTA 61.179 61.111 16.29 12.95 39.49 3.43
2303 5703 1.000955 CTACGCACTGGAGACCAACTT 59.999 52.381 0.00 0.00 30.80 2.66
2417 5819 5.768164 TGTAACATATGCTCCGAGTAGATCA 59.232 40.000 1.58 0.00 0.00 2.92
2531 5934 2.288273 CCTCGCCTCCTTATTAGAACCG 60.288 54.545 0.00 0.00 0.00 4.44
2625 6028 3.128852 AGCAGAGAATGAGGATGATGC 57.871 47.619 0.00 0.00 0.00 3.91
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
504 512 5.297547 AGAACTGTTAGTGCGAGAAATCAA 58.702 37.500 0.00 0.0 0.00 2.57
687 696 2.088950 TCGGTTCTAAGGCGGAAAAG 57.911 50.000 0.00 0.0 0.00 2.27
740 749 9.984190 AGAATATAGTAAGCAGGTTAGTTAAGC 57.016 33.333 5.03 0.0 0.00 3.09
1017 3775 7.282224 GTGCAGACATAGTATTTGGTATTTGGA 59.718 37.037 0.00 0.0 0.00 3.53
1620 4428 4.330074 GCGTATAGATCACTGTTTGCAAGT 59.670 41.667 0.00 0.0 0.00 3.16
1785 4594 1.376543 AGGCAATGCACGATGAGAAG 58.623 50.000 7.79 0.0 0.00 2.85
2282 5682 0.317479 GTTGGTCTCCAGTGCGTAGT 59.683 55.000 0.00 0.0 33.81 2.73
2303 5703 2.585341 CCAAAAGCATGCCCAGCCA 61.585 57.895 15.66 0.0 0.00 4.75
2625 6028 0.926846 GCATTCTCTTCTTCTCGCGG 59.073 55.000 6.13 0.0 0.00 6.46


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.