Multiple sequence alignment - TraesCS5B01G086500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G086500 chr5B 100.000 2322 0 0 1 2322 109899185 109896864 0 4289
1 TraesCS5B01G086500 chr5B 96.769 2321 73 2 1 2320 351452614 351450295 0 3869
2 TraesCS5B01G086500 chr7B 98.406 2321 37 0 1 2321 15309593 15311913 0 4082
3 TraesCS5B01G086500 chr7B 97.330 2322 59 3 1 2320 664294594 664296914 0 3941
4 TraesCS5B01G086500 chr3B 97.924 2312 48 0 1 2312 14264716 14267027 0 4004
5 TraesCS5B01G086500 chr3B 96.812 2321 72 2 1 2320 28344929 28347248 0 3875
6 TraesCS5B01G086500 chr1B 96.928 2311 62 4 1 2309 615476943 615479246 0 3866
7 TraesCS5B01G086500 chr1B 96.797 2310 66 3 1 2309 618191020 618188718 0 3849
8 TraesCS5B01G086500 chr2B 96.926 2310 62 4 1 2309 90758847 90761148 0 3864
9 TraesCS5B01G086500 chr2B 96.682 2321 68 4 1 2320 631382557 631380245 0 3851


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G086500 chr5B 109896864 109899185 2321 True 4289 4289 100.000 1 2322 1 chr5B.!!$R1 2321
1 TraesCS5B01G086500 chr5B 351450295 351452614 2319 True 3869 3869 96.769 1 2320 1 chr5B.!!$R2 2319
2 TraesCS5B01G086500 chr7B 15309593 15311913 2320 False 4082 4082 98.406 1 2321 1 chr7B.!!$F1 2320
3 TraesCS5B01G086500 chr7B 664294594 664296914 2320 False 3941 3941 97.330 1 2320 1 chr7B.!!$F2 2319
4 TraesCS5B01G086500 chr3B 14264716 14267027 2311 False 4004 4004 97.924 1 2312 1 chr3B.!!$F1 2311
5 TraesCS5B01G086500 chr3B 28344929 28347248 2319 False 3875 3875 96.812 1 2320 1 chr3B.!!$F2 2319
6 TraesCS5B01G086500 chr1B 615476943 615479246 2303 False 3866 3866 96.928 1 2309 1 chr1B.!!$F1 2308
7 TraesCS5B01G086500 chr1B 618188718 618191020 2302 True 3849 3849 96.797 1 2309 1 chr1B.!!$R1 2308
8 TraesCS5B01G086500 chr2B 90758847 90761148 2301 False 3864 3864 96.926 1 2309 1 chr2B.!!$F1 2308
9 TraesCS5B01G086500 chr2B 631380245 631382557 2312 True 3851 3851 96.682 1 2320 1 chr2B.!!$R1 2319

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
196 197 1.844771 GCATCGTGCTGTGCTTGTGA 61.845 55.0 3.2 0.0 40.96 3.58 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2051 2053 0.240411 CGAGACCGTCCGTTTCTCTT 59.76 55.0 11.49 0.0 34.72 2.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
196 197 1.844771 GCATCGTGCTGTGCTTGTGA 61.845 55.000 3.20 0.00 40.96 3.58
315 316 6.999705 TTTTGTAGGTTCCTCCAGTACTAA 57.000 37.500 0.00 0.00 39.02 2.24
431 432 2.666272 TTAAAGGCACACCACCATGA 57.334 45.000 0.00 0.00 39.06 3.07
1224 1225 3.493699 GGCGGTACAAGGCATACATAAGA 60.494 47.826 8.83 0.00 0.00 2.10
1276 1277 7.946776 AGGTAATTATCAAATGCCTTGCTATCT 59.053 33.333 0.00 0.00 34.76 1.98
1355 1356 2.431782 GGAGGCCGTACATGGTACTTAA 59.568 50.000 0.00 0.00 0.00 1.85
1492 1493 1.513858 TGGAGTACAACAACCCACCT 58.486 50.000 0.00 0.00 0.00 4.00
1526 1528 2.039418 TGAGACAAGTGTGGTGCTACT 58.961 47.619 0.00 0.00 0.00 2.57
2226 2230 0.901827 TTACTCTCTTGCCATGGCGA 59.098 50.000 30.87 28.19 45.51 5.54
2272 2276 4.920340 CGTGCTCAGTATAGAATGGATGTC 59.080 45.833 0.00 0.00 0.00 3.06
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
10 11 7.001099 TCCCTAAGATATAAATCACGAACCC 57.999 40.000 0.00 0.0 34.28 4.11
196 197 8.582891 AGATACATAATTACCTCCCCTCTTTT 57.417 34.615 0.00 0.0 0.00 2.27
431 432 0.892755 TAATGGCCGTCGAGTTCAGT 59.107 50.000 0.00 0.0 0.00 3.41
1224 1225 5.152623 TGTAAGTAAGCATGTCAAGCTCT 57.847 39.130 2.51 0.0 42.53 4.09
1355 1356 2.299326 ATTGCTCAAAGGGAACTGCT 57.701 45.000 0.00 0.0 42.68 4.24
1434 1435 2.777536 TGGAAGATGCCACTCCACT 58.222 52.632 0.00 0.0 31.66 4.00
1459 1460 5.957842 TGTACTCCAAATTGCTTCGAAAT 57.042 34.783 0.00 0.0 0.00 2.17
1492 1493 1.478916 TGTCTCAACATAATCCGGCGA 59.521 47.619 9.30 0.0 0.00 5.54
2051 2053 0.240411 CGAGACCGTCCGTTTCTCTT 59.760 55.000 11.49 0.0 34.72 2.85
2272 2276 2.093764 AGATGGACGAGCAGAAGAAAGG 60.094 50.000 0.00 0.0 0.00 3.11


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.