Multiple sequence alignment - TraesCS5B01G080600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G080600 chr5B 100.000 2414 0 0 1 2414 98846103 98843690 0.000000e+00 4458
1 TraesCS5B01G080600 chr5B 85.522 1409 197 6 1 1402 5072789 5071381 0.000000e+00 1465
2 TraesCS5B01G080600 chr5B 83.929 1512 210 18 1 1504 5067070 5065584 0.000000e+00 1415
3 TraesCS5B01G080600 chr5B 97.115 832 23 1 1504 2334 203679423 203678592 0.000000e+00 1402
4 TraesCS5B01G080600 chr5B 96.897 838 23 3 1503 2338 63251596 63252432 0.000000e+00 1400
5 TraesCS5B01G080600 chr5B 96.682 844 24 4 1499 2341 686832761 686831921 0.000000e+00 1400
6 TraesCS5B01G080600 chr5B 95.921 858 30 5 1486 2339 281571155 281570299 0.000000e+00 1386
7 TraesCS5B01G080600 chr5D 97.209 1505 37 2 1 1504 93862794 93861294 0.000000e+00 2542
8 TraesCS5B01G080600 chr5D 85.694 1412 192 7 1 1402 3633049 3634460 0.000000e+00 1480
9 TraesCS5B01G080600 chr5D 98.734 79 1 0 2334 2412 93861301 93861223 9.000000e-30 141
10 TraesCS5B01G080600 chr5A 96.412 1505 42 2 1 1504 87417612 87416119 0.000000e+00 2470
11 TraesCS5B01G080600 chr7A 85.246 1403 197 2 1 1402 700300474 700301867 0.000000e+00 1435
12 TraesCS5B01G080600 chr7A 85.175 1403 198 2 1 1402 700338292 700339685 0.000000e+00 1430
13 TraesCS5B01G080600 chr7D 85.948 1345 179 2 1 1344 610421336 610420001 0.000000e+00 1428
14 TraesCS5B01G080600 chr4B 96.812 847 21 6 1497 2339 28681506 28682350 0.000000e+00 1410
15 TraesCS5B01G080600 chr3A 97.239 833 19 4 1503 2333 522044212 522043382 0.000000e+00 1408
16 TraesCS5B01G080600 chr7B 85.166 1382 193 5 1 1380 698682976 698684347 0.000000e+00 1406
17 TraesCS5B01G080600 chr7B 96.568 845 25 4 1496 2338 664046779 664047621 0.000000e+00 1397
18 TraesCS5B01G080600 chr1B 96.479 852 27 3 1494 2343 295769577 295768727 0.000000e+00 1404
19 TraesCS5B01G080600 chr2B 96.231 849 28 4 1491 2337 579684187 579685033 0.000000e+00 1387


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G080600 chr5B 98843690 98846103 2413 True 4458.0 4458 100.0000 1 2414 1 chr5B.!!$R3 2413
1 TraesCS5B01G080600 chr5B 5071381 5072789 1408 True 1465.0 1465 85.5220 1 1402 1 chr5B.!!$R2 1401
2 TraesCS5B01G080600 chr5B 5065584 5067070 1486 True 1415.0 1415 83.9290 1 1504 1 chr5B.!!$R1 1503
3 TraesCS5B01G080600 chr5B 203678592 203679423 831 True 1402.0 1402 97.1150 1504 2334 1 chr5B.!!$R4 830
4 TraesCS5B01G080600 chr5B 63251596 63252432 836 False 1400.0 1400 96.8970 1503 2338 1 chr5B.!!$F1 835
5 TraesCS5B01G080600 chr5B 686831921 686832761 840 True 1400.0 1400 96.6820 1499 2341 1 chr5B.!!$R6 842
6 TraesCS5B01G080600 chr5B 281570299 281571155 856 True 1386.0 1386 95.9210 1486 2339 1 chr5B.!!$R5 853
7 TraesCS5B01G080600 chr5D 3633049 3634460 1411 False 1480.0 1480 85.6940 1 1402 1 chr5D.!!$F1 1401
8 TraesCS5B01G080600 chr5D 93861223 93862794 1571 True 1341.5 2542 97.9715 1 2412 2 chr5D.!!$R1 2411
9 TraesCS5B01G080600 chr5A 87416119 87417612 1493 True 2470.0 2470 96.4120 1 1504 1 chr5A.!!$R1 1503
10 TraesCS5B01G080600 chr7A 700300474 700301867 1393 False 1435.0 1435 85.2460 1 1402 1 chr7A.!!$F1 1401
11 TraesCS5B01G080600 chr7A 700338292 700339685 1393 False 1430.0 1430 85.1750 1 1402 1 chr7A.!!$F2 1401
12 TraesCS5B01G080600 chr7D 610420001 610421336 1335 True 1428.0 1428 85.9480 1 1344 1 chr7D.!!$R1 1343
13 TraesCS5B01G080600 chr4B 28681506 28682350 844 False 1410.0 1410 96.8120 1497 2339 1 chr4B.!!$F1 842
14 TraesCS5B01G080600 chr3A 522043382 522044212 830 True 1408.0 1408 97.2390 1503 2333 1 chr3A.!!$R1 830
15 TraesCS5B01G080600 chr7B 698682976 698684347 1371 False 1406.0 1406 85.1660 1 1380 1 chr7B.!!$F2 1379
16 TraesCS5B01G080600 chr7B 664046779 664047621 842 False 1397.0 1397 96.5680 1496 2338 1 chr7B.!!$F1 842
17 TraesCS5B01G080600 chr1B 295768727 295769577 850 True 1404.0 1404 96.4790 1494 2343 1 chr1B.!!$R1 849
18 TraesCS5B01G080600 chr2B 579684187 579685033 846 False 1387.0 1387 96.2310 1491 2337 1 chr2B.!!$F1 846

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
978 981 1.301293 CAAGGAGAAGCTGGACCCC 59.699 63.158 0.0 0.0 0.0 4.95 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2383 2409 6.984474 TCTACCTATAGCAACATTACAACAGC 59.016 38.462 0.0 0.0 0.0 4.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
223 224 1.377725 CTCCAAGCAGCGACCCAAT 60.378 57.895 0.00 0.0 0.00 3.16
823 825 1.945354 GCGACAAGGACTCCGATGGA 61.945 60.000 8.32 0.0 0.00 3.41
978 981 1.301293 CAAGGAGAAGCTGGACCCC 59.699 63.158 0.00 0.0 0.00 4.95
1074 1077 2.359900 GCCAAGAACTACCTGGATGTG 58.640 52.381 0.00 0.0 0.00 3.21
1077 1080 3.338249 CAAGAACTACCTGGATGTGGTG 58.662 50.000 0.00 0.0 38.42 4.17
1162 1165 1.606531 GCAGAGAACCTGATGCCCT 59.393 57.895 0.00 0.0 45.78 5.19
1243 1246 1.667830 CAGGCCAAAGAAGACGCGA 60.668 57.895 15.93 0.0 0.00 5.87
1420 1440 5.822204 ACAAGATACAGGAGTAGAGTGAGT 58.178 41.667 0.00 0.0 32.86 3.41
1421 1441 5.650266 ACAAGATACAGGAGTAGAGTGAGTG 59.350 44.000 0.00 0.0 32.86 3.51
1422 1442 5.702065 AGATACAGGAGTAGAGTGAGTGA 57.298 43.478 0.00 0.0 32.86 3.41
1423 1443 5.680619 AGATACAGGAGTAGAGTGAGTGAG 58.319 45.833 0.00 0.0 32.86 3.51
1429 1449 3.194542 GGAGTAGAGTGAGTGAGCATGTT 59.805 47.826 0.00 0.0 0.00 2.71
1474 1494 4.256920 AGATGCAGTGTTGGTTCAGATAC 58.743 43.478 0.00 0.0 0.00 2.24
1565 1585 1.078214 CACACGCCTCCATCACCAT 60.078 57.895 0.00 0.0 0.00 3.55
1642 1664 7.494625 TCGGCTTAAAAATGTTGTATCTCCTAG 59.505 37.037 0.00 0.0 0.00 3.02
1689 1711 5.106869 CGTTTTCACCATTAAATCCGTCTCA 60.107 40.000 0.00 0.0 0.00 3.27
1759 1783 1.189752 TTTTGCCAGAAGTTGCCACA 58.810 45.000 0.00 0.0 0.00 4.17
2138 2164 5.989477 TCAACATGGGATCTAGTTTCGAAT 58.011 37.500 0.00 0.0 0.00 3.34
2339 2365 2.612212 CAGTTAGCGCGACCCATAAAAT 59.388 45.455 12.10 0.0 0.00 1.82
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
223 224 3.505680 GGTACAAACTGATGACATTGGCA 59.494 43.478 0.00 0.00 0.00 4.92
350 352 2.569059 CTGGCGGTTCTTGATGATGAT 58.431 47.619 0.00 0.00 0.00 2.45
375 377 1.341482 TGGCTTTGTTGGTGAACAGGA 60.341 47.619 0.00 0.00 43.03 3.86
423 425 4.864334 CATGGCTCCAGGCGGTCC 62.864 72.222 0.00 0.56 44.42 4.46
426 428 2.203070 GTACATGGCTCCAGGCGG 60.203 66.667 0.00 0.00 44.42 6.13
700 702 2.729467 CGTCGTCTCGATGAAGAGCTTT 60.729 50.000 5.58 0.00 44.49 3.51
823 825 3.002038 TGGTACTTGGGTTTGTCGTTT 57.998 42.857 0.00 0.00 0.00 3.60
1048 1051 2.431057 CCAGGTAGTTCTTGGCGAGTAT 59.569 50.000 0.77 0.00 36.52 2.12
1162 1165 4.887655 GTCCCTCTTTTTCTTCTTGGACAA 59.112 41.667 0.00 0.00 40.52 3.18
1429 1449 0.530744 GGTCACGGAGCATGTAGTGA 59.469 55.000 9.45 9.45 40.77 3.41
1565 1585 6.993786 TCTATTCATACGTGGCAAAATGAA 57.006 33.333 17.48 17.48 41.24 2.57
1689 1711 5.480205 GGGTCTAGTTTTGAAGATCTCGTT 58.520 41.667 0.00 0.00 0.00 3.85
1759 1783 2.692557 TGGCAACTGCAGTGTAAACATT 59.307 40.909 22.49 0.00 44.36 2.71
2339 2365 7.394359 AGCAAATGAGAAAAGGAAGCTACATTA 59.606 33.333 0.00 0.00 0.00 1.90
2383 2409 6.984474 TCTACCTATAGCAACATTACAACAGC 59.016 38.462 0.00 0.00 0.00 4.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.