Multiple sequence alignment - TraesCS5B01G070100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G070100 chr5B 100.000 2333 0 0 1 2333 80274091 80271759 0.000000e+00 4309
1 TraesCS5B01G070100 chr5B 99.357 2333 15 0 1 2333 80678880 80676548 0.000000e+00 4226
2 TraesCS5B01G070100 chr5B 90.192 469 40 5 1870 2333 207153815 207154282 7.130000e-170 606
3 TraesCS5B01G070100 chr5B 93.211 383 25 1 1952 2333 263954997 263955379 1.570000e-156 562
4 TraesCS5B01G070100 chr1B 98.300 1588 27 0 59 1646 410047167 410045580 0.000000e+00 2784
5 TraesCS5B01G070100 chr1B 95.781 1588 66 1 58 1645 24201244 24202830 0.000000e+00 2560
6 TraesCS5B01G070100 chr6B 98.110 1587 30 0 59 1645 59939147 59940733 0.000000e+00 2765
7 TraesCS5B01G070100 chr4A 97.730 1586 36 0 60 1645 668642136 668640551 0.000000e+00 2730
8 TraesCS5B01G070100 chr4A 86.801 1591 203 7 58 1645 438690740 438689154 0.000000e+00 1768
9 TraesCS5B01G070100 chr4A 87.313 402 24 12 1950 2333 583981957 583981565 3.560000e-118 435
10 TraesCS5B01G070100 chr7A 89.252 1591 160 10 62 1645 12891406 12892992 0.000000e+00 1980
11 TraesCS5B01G070100 chr7A 80.240 668 90 24 1704 2333 201966662 201967325 4.540000e-127 464
12 TraesCS5B01G070100 chr6A 88.833 1594 167 10 59 1645 133819639 133821228 0.000000e+00 1947
13 TraesCS5B01G070100 chr5A 86.378 1593 203 12 58 1645 602240416 602241999 0.000000e+00 1727
14 TraesCS5B01G070100 chr5A 82.803 692 55 15 1706 2333 32738921 32738230 5.630000e-156 560
15 TraesCS5B01G070100 chr3B 84.731 668 62 12 1706 2333 474005438 474004771 1.180000e-177 632
16 TraesCS5B01G070100 chr2B 89.366 489 36 7 1846 2333 733871693 733871220 3.320000e-168 601
17 TraesCS5B01G070100 chr5D 82.537 670 76 24 1701 2333 319427935 319427270 3.390000e-153 551
18 TraesCS5B01G070100 chr5D 87.306 386 31 7 1951 2333 510830580 510830210 2.140000e-115 425
19 TraesCS5B01G070100 chr7D 82.484 628 62 27 1708 2294 44657032 44657652 7.440000e-140 507
20 TraesCS5B01G070100 chr7D 87.339 387 30 9 1950 2333 402316581 402316951 2.140000e-115 425
21 TraesCS5B01G070100 chr7D 84.942 259 28 10 1708 1962 591858436 591858687 3.850000e-63 252
22 TraesCS5B01G070100 chr3D 90.050 402 22 8 1950 2333 352945755 352946156 2.680000e-139 505
23 TraesCS5B01G070100 chr1A 89.330 403 23 12 1950 2333 432517513 432517112 2.690000e-134 488
24 TraesCS5B01G070100 chr3A 80.763 655 90 22 1708 2333 93079463 93080110 1.620000e-131 479
25 TraesCS5B01G070100 chr2D 80.838 668 79 34 1706 2333 166105215 166104557 1.620000e-131 479
26 TraesCS5B01G070100 chr2D 88.114 387 28 9 1950 2333 543290448 543290077 5.920000e-121 444
27 TraesCS5B01G070100 chr2D 88.701 177 19 1 1702 1877 442966679 442966855 5.050000e-52 215
28 TraesCS5B01G070100 chr6D 80.495 687 70 35 1698 2333 141278405 141279078 3.510000e-128 468


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G070100 chr5B 80271759 80274091 2332 True 4309 4309 100.000 1 2333 1 chr5B.!!$R1 2332
1 TraesCS5B01G070100 chr5B 80676548 80678880 2332 True 4226 4226 99.357 1 2333 1 chr5B.!!$R2 2332
2 TraesCS5B01G070100 chr1B 410045580 410047167 1587 True 2784 2784 98.300 59 1646 1 chr1B.!!$R1 1587
3 TraesCS5B01G070100 chr1B 24201244 24202830 1586 False 2560 2560 95.781 58 1645 1 chr1B.!!$F1 1587
4 TraesCS5B01G070100 chr6B 59939147 59940733 1586 False 2765 2765 98.110 59 1645 1 chr6B.!!$F1 1586
5 TraesCS5B01G070100 chr4A 668640551 668642136 1585 True 2730 2730 97.730 60 1645 1 chr4A.!!$R3 1585
6 TraesCS5B01G070100 chr4A 438689154 438690740 1586 True 1768 1768 86.801 58 1645 1 chr4A.!!$R1 1587
7 TraesCS5B01G070100 chr7A 12891406 12892992 1586 False 1980 1980 89.252 62 1645 1 chr7A.!!$F1 1583
8 TraesCS5B01G070100 chr7A 201966662 201967325 663 False 464 464 80.240 1704 2333 1 chr7A.!!$F2 629
9 TraesCS5B01G070100 chr6A 133819639 133821228 1589 False 1947 1947 88.833 59 1645 1 chr6A.!!$F1 1586
10 TraesCS5B01G070100 chr5A 602240416 602241999 1583 False 1727 1727 86.378 58 1645 1 chr5A.!!$F1 1587
11 TraesCS5B01G070100 chr5A 32738230 32738921 691 True 560 560 82.803 1706 2333 1 chr5A.!!$R1 627
12 TraesCS5B01G070100 chr3B 474004771 474005438 667 True 632 632 84.731 1706 2333 1 chr3B.!!$R1 627
13 TraesCS5B01G070100 chr5D 319427270 319427935 665 True 551 551 82.537 1701 2333 1 chr5D.!!$R1 632
14 TraesCS5B01G070100 chr7D 44657032 44657652 620 False 507 507 82.484 1708 2294 1 chr7D.!!$F1 586
15 TraesCS5B01G070100 chr3A 93079463 93080110 647 False 479 479 80.763 1708 2333 1 chr3A.!!$F1 625
16 TraesCS5B01G070100 chr2D 166104557 166105215 658 True 479 479 80.838 1706 2333 1 chr2D.!!$R1 627
17 TraesCS5B01G070100 chr6D 141278405 141279078 673 False 468 468 80.495 1698 2333 1 chr6D.!!$F1 635

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
734 735 0.11358 GGCTTGGGTGGGAAAACCTA 59.886 55.0 0.0 0.0 40.35 3.08 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1980 2058 1.432251 CCCTACGTCGACGCTGATT 59.568 57.895 35.92 19.68 44.43 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
734 735 0.113580 GGCTTGGGTGGGAAAACCTA 59.886 55.0 0.0 0.0 40.35 3.08
1456 1461 0.469144 GACTTTTGGGGGCTGTTGGA 60.469 55.0 0.0 0.0 0.00 3.53
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
734 735 8.581578 ACGAATAAACAGATTTGGTGGTAAAAT 58.418 29.630 0.00 0.00 0.00 1.82
1456 1461 3.264450 ACATCTAAAGCTAGCAACCAGGT 59.736 43.478 18.83 3.79 0.00 4.00
1980 2058 1.432251 CCCTACGTCGACGCTGATT 59.568 57.895 35.92 19.68 44.43 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.