Multiple sequence alignment - TraesCS5B01G052700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G052700 chr5B 100.000 2246 0 0 1 2246 57516468 57514223 0 4148
1 TraesCS5B01G052700 chr3A 99.021 2248 18 3 1 2246 105558302 105556057 0 4026
2 TraesCS5B01G052700 chr7B 98.753 2246 24 2 1 2246 662756374 662754133 0 3989
3 TraesCS5B01G052700 chr1B 98.531 2246 27 5 1 2246 633715632 633717871 0 3960
4 TraesCS5B01G052700 chr5D 98.089 2250 31 8 1 2246 503338098 503340339 0 3906
5 TraesCS5B01G052700 chr5D 97.696 2257 34 7 1 2246 6254625 6252376 0 3864
6 TraesCS5B01G052700 chr5D 98.399 2186 21 6 66 2246 299973782 299971606 0 3831
7 TraesCS5B01G052700 chr5D 97.552 2247 38 8 1 2243 503312163 503314396 0 3829
8 TraesCS5B01G052700 chr1D 97.689 2250 33 9 1 2246 254458076 254460310 0 3849


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G052700 chr5B 57514223 57516468 2245 True 4148 4148 100.000 1 2246 1 chr5B.!!$R1 2245
1 TraesCS5B01G052700 chr3A 105556057 105558302 2245 True 4026 4026 99.021 1 2246 1 chr3A.!!$R1 2245
2 TraesCS5B01G052700 chr7B 662754133 662756374 2241 True 3989 3989 98.753 1 2246 1 chr7B.!!$R1 2245
3 TraesCS5B01G052700 chr1B 633715632 633717871 2239 False 3960 3960 98.531 1 2246 1 chr1B.!!$F1 2245
4 TraesCS5B01G052700 chr5D 503338098 503340339 2241 False 3906 3906 98.089 1 2246 1 chr5D.!!$F2 2245
5 TraesCS5B01G052700 chr5D 6252376 6254625 2249 True 3864 3864 97.696 1 2246 1 chr5D.!!$R1 2245
6 TraesCS5B01G052700 chr5D 299971606 299973782 2176 True 3831 3831 98.399 66 2246 1 chr5D.!!$R2 2180
7 TraesCS5B01G052700 chr5D 503312163 503314396 2233 False 3829 3829 97.552 1 2243 1 chr5D.!!$F1 2242
8 TraesCS5B01G052700 chr1D 254458076 254460310 2234 False 3849 3849 97.689 1 2246 1 chr1D.!!$F1 2245

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
330 331 5.578073 AGTCCCCTTAGTAATCCCTATACG 58.422 45.833 0.0 0.0 0.0 3.06 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2041 2069 5.155278 ACCGTGTTAATGGTCTCACATTA 57.845 39.13 0.0 0.0 42.41 1.9 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
330 331 5.578073 AGTCCCCTTAGTAATCCCTATACG 58.422 45.833 0.0 0.0 0.00 3.06
1554 1577 4.594970 TCAACAAAGGAAGTCTTTCACCA 58.405 39.130 0.0 0.0 43.32 4.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
330 331 8.062065 TGTAAATAATCCAAGAAACATGACCC 57.938 34.615 0.0 0.0 0.00 4.46
1554 1577 8.142551 AGATTAAGTCTTACGTCTTGTTTGACT 58.857 33.333 0.0 0.0 40.92 3.41
1803 1829 5.923733 AATCAAAACACCAACCACTACAA 57.076 34.783 0.0 0.0 0.00 2.41
2041 2069 5.155278 ACCGTGTTAATGGTCTCACATTA 57.845 39.130 0.0 0.0 42.41 1.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.