Multiple sequence alignment - TraesCS5B01G044100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G044100 chr5B 100.000 2739 0 0 1 2739 49314736 49311998 0 5059
1 TraesCS5B01G044100 chr5B 95.733 2742 107 6 1 2739 426078364 426081098 0 4407
2 TraesCS5B01G044100 chr3B 97.374 2742 67 4 1 2739 730273792 730276531 0 4660
3 TraesCS5B01G044100 chr3B 97.050 2746 72 6 1 2739 709813709 709816452 0 4614
4 TraesCS5B01G044100 chr3B 95.657 2740 108 7 3 2739 170815812 170813081 0 4390
5 TraesCS5B01G044100 chr3B 95.412 2746 111 10 1 2739 725530478 725533215 0 4359
6 TraesCS5B01G044100 chr3B 95.367 2741 120 5 1 2739 12926467 12923732 0 4351
7 TraesCS5B01G044100 chr4B 97.008 2741 74 7 1 2739 402851373 402848639 0 4601
8 TraesCS5B01G044100 chr6B 96.290 2749 91 8 1 2739 49206664 49209411 0 4501
9 TraesCS5B01G044100 chr7B 95.663 2744 107 6 1 2739 379743839 379746575 0 4397


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G044100 chr5B 49311998 49314736 2738 True 5059 5059 100.000 1 2739 1 chr5B.!!$R1 2738
1 TraesCS5B01G044100 chr5B 426078364 426081098 2734 False 4407 4407 95.733 1 2739 1 chr5B.!!$F1 2738
2 TraesCS5B01G044100 chr3B 730273792 730276531 2739 False 4660 4660 97.374 1 2739 1 chr3B.!!$F3 2738
3 TraesCS5B01G044100 chr3B 709813709 709816452 2743 False 4614 4614 97.050 1 2739 1 chr3B.!!$F1 2738
4 TraesCS5B01G044100 chr3B 170813081 170815812 2731 True 4390 4390 95.657 3 2739 1 chr3B.!!$R2 2736
5 TraesCS5B01G044100 chr3B 725530478 725533215 2737 False 4359 4359 95.412 1 2739 1 chr3B.!!$F2 2738
6 TraesCS5B01G044100 chr3B 12923732 12926467 2735 True 4351 4351 95.367 1 2739 1 chr3B.!!$R1 2738
7 TraesCS5B01G044100 chr4B 402848639 402851373 2734 True 4601 4601 97.008 1 2739 1 chr4B.!!$R1 2738
8 TraesCS5B01G044100 chr6B 49206664 49209411 2747 False 4501 4501 96.290 1 2739 1 chr6B.!!$F1 2738
9 TraesCS5B01G044100 chr7B 379743839 379746575 2736 False 4397 4397 95.663 1 2739 1 chr7B.!!$F1 2738

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
562 567 0.249447 TAGTTGCATGCGGGATCGAG 60.249 55.0 14.09 0.0 39.0 4.04 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2110 2129 3.134574 ACCATGCGGTTTAGAGAAACA 57.865 42.857 3.23 0.0 46.31 2.83 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
95 96 0.613260 TTGCCTGTAGAGACGGCATT 59.387 50.000 12.19 0.00 46.93 3.56
279 280 2.294233 GCACATGAAGGAGTTGAAAGCA 59.706 45.455 0.00 0.00 0.00 3.91
415 420 7.466746 TTTTACTTAGCAGGCATGATTCTTT 57.533 32.000 0.62 0.00 0.00 2.52
524 529 0.321564 CGAGTCCATGAGGCCAAACA 60.322 55.000 5.01 2.06 33.74 2.83
562 567 0.249447 TAGTTGCATGCGGGATCGAG 60.249 55.000 14.09 0.00 39.00 4.04
581 586 5.719173 TCGAGTACATCAACAATCACATCA 58.281 37.500 0.00 0.00 0.00 3.07
689 694 0.653636 TTTCGCTCAACACGGTGAAC 59.346 50.000 16.29 0.00 32.71 3.18
973 986 8.250332 TGTTCTTTTTGTGTAATCTGCTTTCTT 58.750 29.630 0.00 0.00 0.00 2.52
1148 1161 6.149129 TGATTCAGATCTTACTACGCATGT 57.851 37.500 0.00 0.00 33.28 3.21
1589 1603 5.460091 GGAAGCTGTCAAGAAAATCAACAAC 59.540 40.000 0.00 0.00 0.00 3.32
2110 2129 2.083774 CATCGCCCACAACACACTATT 58.916 47.619 0.00 0.00 0.00 1.73
2126 2145 5.178623 CACACTATTGTTTCTCTAAACCGCA 59.821 40.000 0.00 0.00 43.66 5.69
2158 2177 5.819901 TGTCATGGAAATATATGTCACGCAA 59.180 36.000 5.26 0.00 0.00 4.85
2296 2315 5.648092 GCAGATCCAGTACAACTAAAATGGT 59.352 40.000 0.00 0.00 0.00 3.55
2480 2500 5.837979 TCCACTCAATGAATTTTCCTTCCAA 59.162 36.000 0.00 0.00 0.00 3.53
2544 2571 4.985538 AAACTCATCGTCTAGGGTACAG 57.014 45.455 0.00 0.00 0.00 2.74
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
95 96 3.118261 GGCACTTCTGATGGTATCCTCAA 60.118 47.826 0.00 0.00 0.00 3.02
279 280 8.511748 AGAGATTATAGGGTGTGGTCATTTAT 57.488 34.615 0.00 0.00 0.00 1.40
415 420 8.510243 AGCTGTATGAAAATGACATAACATGA 57.490 30.769 0.00 0.00 33.04 3.07
524 529 7.075741 GCAACTACATTTGTCGACATTTTACT 58.924 34.615 20.80 2.81 0.00 2.24
581 586 1.806542 GATCTTGTCGGCACACACATT 59.193 47.619 0.00 0.00 29.76 2.71
689 694 8.173775 CACATATTTCTTCAGTGTTAGCTTGAG 58.826 37.037 0.00 0.00 0.00 3.02
748 753 2.627699 AGATGGCAAAAACCACACGATT 59.372 40.909 0.00 0.00 44.17 3.34
751 756 1.769733 CAGATGGCAAAAACCACACG 58.230 50.000 0.00 0.00 44.17 4.49
973 986 7.669427 ACCTGCATTTGAAAAGTGAATGAATA 58.331 30.769 0.00 0.00 35.27 1.75
1589 1603 3.184379 CACCACGTGATCACTTGTACTTG 59.816 47.826 25.46 14.97 35.23 3.16
2110 2129 3.134574 ACCATGCGGTTTAGAGAAACA 57.865 42.857 3.23 0.00 46.31 2.83
2296 2315 4.464244 GCCATGCTAGATGTACTGGATCTA 59.536 45.833 0.00 0.00 32.32 1.98
2480 2500 4.840716 AACTCTTGAGGAGCATCAGAAT 57.159 40.909 2.55 0.00 45.48 2.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.