Multiple sequence alignment - TraesCS5B01G040100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G040100 chr5B 100.000 2372 0 0 1 2372 44989098 44991469 0.000000e+00 4381.0
1 TraesCS5B01G040100 chr5B 98.567 2372 33 1 1 2372 127808631 127811001 0.000000e+00 4191.0
2 TraesCS5B01G040100 chr3B 99.030 2372 22 1 1 2372 201615154 201617524 0.000000e+00 4252.0
3 TraesCS5B01G040100 chr3B 99.614 259 1 0 1353 1611 524468319 524468061 7.670000e-130 473.0
4 TraesCS5B01G040100 chr3B 100.000 63 0 0 1927 1989 21185264 21185202 1.490000e-22 117.0
5 TraesCS5B01G040100 chr1B 98.820 2372 26 2 1 2372 638728836 638731205 0.000000e+00 4224.0
6 TraesCS5B01G040100 chr1B 97.391 2376 56 3 1 2372 135053757 135051384 0.000000e+00 4039.0
7 TraesCS5B01G040100 chr2B 97.430 2179 53 2 1 2179 1454222 1452047 0.000000e+00 3711.0
8 TraesCS5B01G040100 chr7B 98.872 1418 15 1 1 1418 662726602 662728018 0.000000e+00 2529.0
9 TraesCS5B01G040100 chr7B 95.559 698 25 3 1675 2372 47246657 47247348 0.000000e+00 1112.0
10 TraesCS5B01G040100 chr3D 98.733 1421 17 1 1 1421 589263328 589261909 0.000000e+00 2523.0
11 TraesCS5B01G040100 chr3A 98.733 1421 17 1 1 1421 66004935 66003516 0.000000e+00 2523.0
12 TraesCS5B01G040100 chr6D 98.663 1421 18 1 1 1421 389245624 389244205 0.000000e+00 2518.0
13 TraesCS5B01G040100 chr2A 97.925 964 19 1 1409 2372 53948986 53948024 0.000000e+00 1668.0
14 TraesCS5B01G040100 chr7A 97.810 137 3 0 1839 1975 659649765 659649901 1.100000e-58 237.0
15 TraesCS5B01G040100 chr4A 97.674 86 2 0 2206 2291 670459470 670459385 5.280000e-32 148.0
16 TraesCS5B01G040100 chr4B 97.619 42 0 1 1867 1907 104460384 104460425 1.180000e-08 71.3
17 TraesCS5B01G040100 chrUn 97.500 40 1 0 2102 2141 186186806 186186767 4.230000e-08 69.4
18 TraesCS5B01G040100 chrUn 97.500 40 1 0 2102 2141 221556694 221556733 4.230000e-08 69.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G040100 chr5B 44989098 44991469 2371 False 4381 4381 100.000 1 2372 1 chr5B.!!$F1 2371
1 TraesCS5B01G040100 chr5B 127808631 127811001 2370 False 4191 4191 98.567 1 2372 1 chr5B.!!$F2 2371
2 TraesCS5B01G040100 chr3B 201615154 201617524 2370 False 4252 4252 99.030 1 2372 1 chr3B.!!$F1 2371
3 TraesCS5B01G040100 chr1B 638728836 638731205 2369 False 4224 4224 98.820 1 2372 1 chr1B.!!$F1 2371
4 TraesCS5B01G040100 chr1B 135051384 135053757 2373 True 4039 4039 97.391 1 2372 1 chr1B.!!$R1 2371
5 TraesCS5B01G040100 chr2B 1452047 1454222 2175 True 3711 3711 97.430 1 2179 1 chr2B.!!$R1 2178
6 TraesCS5B01G040100 chr7B 662726602 662728018 1416 False 2529 2529 98.872 1 1418 1 chr7B.!!$F2 1417
7 TraesCS5B01G040100 chr7B 47246657 47247348 691 False 1112 1112 95.559 1675 2372 1 chr7B.!!$F1 697
8 TraesCS5B01G040100 chr3D 589261909 589263328 1419 True 2523 2523 98.733 1 1421 1 chr3D.!!$R1 1420
9 TraesCS5B01G040100 chr3A 66003516 66004935 1419 True 2523 2523 98.733 1 1421 1 chr3A.!!$R1 1420
10 TraesCS5B01G040100 chr6D 389244205 389245624 1419 True 2518 2518 98.663 1 1421 1 chr6D.!!$R1 1420
11 TraesCS5B01G040100 chr2A 53948024 53948986 962 True 1668 1668 97.925 1409 2372 1 chr2A.!!$R1 963

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
853 854 2.687935 TCCAACTCAGCACCTTTTGTTC 59.312 45.455 0.0 0.0 0.0 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1695 1700 2.143925 GCGGAAAGGATTCGGGATAAG 58.856 52.381 0.0 0.0 36.63 1.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
322 323 4.833478 ACATGCCACTGAAAGACTCTAT 57.167 40.909 0.0 0.0 37.43 1.98
509 510 4.141756 ACTTGATGCACTATCTCCCTTCAG 60.142 45.833 0.0 0.0 36.71 3.02
853 854 2.687935 TCCAACTCAGCACCTTTTGTTC 59.312 45.455 0.0 0.0 0.00 3.18
1046 1051 1.080093 CAGCCCGTGAACTTAGCGA 60.080 57.895 0.0 0.0 0.00 4.93
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
322 323 3.565307 ACAGCCCATCTTTTTGTCTCAA 58.435 40.909 0.00 0.0 0.00 3.02
509 510 1.202188 GCTACATTTCGCTCAAAGGGC 60.202 52.381 0.00 0.0 29.53 5.19
778 779 4.263331 GGAATCCAGTTACAGGAGAACCAA 60.263 45.833 2.43 0.0 38.83 3.67
853 854 5.933463 AGAGCAACTCTTCTCAAAATCTCAG 59.067 40.000 0.00 0.0 37.60 3.35
1046 1051 5.589050 TCGGTGCTATCGCTATCATAGTATT 59.411 40.000 0.00 0.0 36.97 1.89
1249 1254 2.286365 TCAACTCCCCGAAGCATTTT 57.714 45.000 0.00 0.0 0.00 1.82
1695 1700 2.143925 GCGGAAAGGATTCGGGATAAG 58.856 52.381 0.00 0.0 36.63 1.73


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.