Multiple sequence alignment - TraesCS5B01G034000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G034000 chr5B 100.000 2561 0 0 1 2561 36810277 36807717 0.000000e+00 4730.0
1 TraesCS5B01G034000 chrUn 99.291 2399 10 2 1 2398 314544423 314542031 0.000000e+00 4329.0
2 TraesCS5B01G034000 chrUn 99.289 1829 6 2 570 2398 369977784 369979605 0.000000e+00 3299.0
3 TraesCS5B01G034000 chrUn 99.463 1117 6 0 1 1117 260780563 260779447 0.000000e+00 2030.0
4 TraesCS5B01G034000 chrUn 99.698 663 2 0 1899 2561 65853474 65854136 0.000000e+00 1214.0
5 TraesCS5B01G034000 chr3B 97.188 1600 36 1 1 1600 691741910 691743500 0.000000e+00 2697.0
6 TraesCS5B01G034000 chr3B 92.008 1514 121 0 1 1514 555206721 555208234 0.000000e+00 2126.0
7 TraesCS5B01G034000 chr3B 87.492 1599 195 3 1 1599 734684100 734685693 0.000000e+00 1840.0
8 TraesCS5B01G034000 chr3B 82.658 1603 270 8 2 1600 566601396 566602994 0.000000e+00 1413.0
9 TraesCS5B01G034000 chr5A 90.175 1598 155 2 3 1599 510495520 510493924 0.000000e+00 2080.0
10 TraesCS5B01G034000 chr7A 82.960 1561 261 5 41 1599 680536353 680534796 0.000000e+00 1404.0
11 TraesCS5B01G034000 chr5D 82.408 1603 273 8 2 1600 137978966 137980563 0.000000e+00 1389.0
12 TraesCS5B01G034000 chr7B 95.272 698 26 7 1869 2561 81014304 81013609 0.000000e+00 1099.0
13 TraesCS5B01G034000 chr7B 94.556 698 29 8 1869 2561 81006886 81006193 0.000000e+00 1070.0
14 TraesCS5B01G034000 chr7B 94.681 94 3 2 1670 1762 60366472 60366564 7.390000e-31 145.0
15 TraesCS5B01G034000 chr4B 94.261 697 33 7 1869 2561 33825263 33824570 0.000000e+00 1059.0
16 TraesCS5B01G034000 chr4B 94.017 702 35 7 1864 2561 600553748 600554446 0.000000e+00 1057.0
17 TraesCS5B01G034000 chr4B 94.118 697 35 6 1869 2561 600561200 600561894 0.000000e+00 1055.0
18 TraesCS5B01G034000 chr4B 96.552 87 3 0 1676 1762 59873820 59873734 7.390000e-31 145.0
19 TraesCS5B01G034000 chr4A 93.983 698 35 7 1869 2561 712259203 712258508 0.000000e+00 1050.0
20 TraesCS5B01G034000 chr2B 92.473 93 7 0 1677 1769 760860388 760860296 1.600000e-27 134.0
21 TraesCS5B01G034000 chr2B 93.258 89 6 0 1677 1765 163545835 163545747 5.750000e-27 132.0
22 TraesCS5B01G034000 chr1B 91.765 85 4 3 1676 1759 32770930 32770848 5.790000e-22 115.0
23 TraesCS5B01G034000 chr1B 90.588 85 7 1 1679 1763 32770848 32770931 7.490000e-21 111.0
24 TraesCS5B01G034000 chr1B 97.674 43 0 1 1673 1715 32770802 32770843 3.530000e-09 73.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G034000 chr5B 36807717 36810277 2560 True 4730 4730 100.000 1 2561 1 chr5B.!!$R1 2560
1 TraesCS5B01G034000 chrUn 314542031 314544423 2392 True 4329 4329 99.291 1 2398 1 chrUn.!!$R2 2397
2 TraesCS5B01G034000 chrUn 369977784 369979605 1821 False 3299 3299 99.289 570 2398 1 chrUn.!!$F2 1828
3 TraesCS5B01G034000 chrUn 260779447 260780563 1116 True 2030 2030 99.463 1 1117 1 chrUn.!!$R1 1116
4 TraesCS5B01G034000 chrUn 65853474 65854136 662 False 1214 1214 99.698 1899 2561 1 chrUn.!!$F1 662
5 TraesCS5B01G034000 chr3B 691741910 691743500 1590 False 2697 2697 97.188 1 1600 1 chr3B.!!$F3 1599
6 TraesCS5B01G034000 chr3B 555206721 555208234 1513 False 2126 2126 92.008 1 1514 1 chr3B.!!$F1 1513
7 TraesCS5B01G034000 chr3B 734684100 734685693 1593 False 1840 1840 87.492 1 1599 1 chr3B.!!$F4 1598
8 TraesCS5B01G034000 chr3B 566601396 566602994 1598 False 1413 1413 82.658 2 1600 1 chr3B.!!$F2 1598
9 TraesCS5B01G034000 chr5A 510493924 510495520 1596 True 2080 2080 90.175 3 1599 1 chr5A.!!$R1 1596
10 TraesCS5B01G034000 chr7A 680534796 680536353 1557 True 1404 1404 82.960 41 1599 1 chr7A.!!$R1 1558
11 TraesCS5B01G034000 chr5D 137978966 137980563 1597 False 1389 1389 82.408 2 1600 1 chr5D.!!$F1 1598
12 TraesCS5B01G034000 chr7B 81013609 81014304 695 True 1099 1099 95.272 1869 2561 1 chr7B.!!$R2 692
13 TraesCS5B01G034000 chr7B 81006193 81006886 693 True 1070 1070 94.556 1869 2561 1 chr7B.!!$R1 692
14 TraesCS5B01G034000 chr4B 33824570 33825263 693 True 1059 1059 94.261 1869 2561 1 chr4B.!!$R1 692
15 TraesCS5B01G034000 chr4B 600553748 600554446 698 False 1057 1057 94.017 1864 2561 1 chr4B.!!$F1 697
16 TraesCS5B01G034000 chr4B 600561200 600561894 694 False 1055 1055 94.118 1869 2561 1 chr4B.!!$F2 692
17 TraesCS5B01G034000 chr4A 712258508 712259203 695 True 1050 1050 93.983 1869 2561 1 chr4A.!!$R1 692

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
568 571 0.03213 GTCTGGACAGTCGAGCACAA 59.968 55.0 7.7 0.0 0.0 3.33 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1772 1776 5.308014 TGCATAGTATTGGATCACCATCAC 58.692 41.667 0.0 0.0 46.34 3.06 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
278 280 4.265073 GAAGACAGCTGGATACCAAACAT 58.735 43.478 19.93 0.0 30.80 2.71
568 571 0.032130 GTCTGGACAGTCGAGCACAA 59.968 55.000 7.70 0.0 0.00 3.33
1772 1776 8.143193 AGTACAGAGGGAGTATATCGTATATCG 58.857 40.741 0.00 0.0 41.41 2.92
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
278 280 1.157751 AGGACCTTTCTCGGTGGGA 59.842 57.895 0.00 0.0 37.42 4.37
324 326 2.985809 GTCTATCAGATCGCTCACATGC 59.014 50.000 0.00 0.0 0.00 4.06
568 571 2.571653 TCTTCCAAACCGGATGATCAGT 59.428 45.455 9.46 0.0 45.80 3.41
1772 1776 5.308014 TGCATAGTATTGGATCACCATCAC 58.692 41.667 0.00 0.0 46.34 3.06


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.