Multiple sequence alignment - TraesCS5B01G033200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G033200 chr5B 100.000 2952 0 0 1 2952 36453513 36450562 0 5452
1 TraesCS5B01G033200 chr2B 98.578 2953 40 2 1 2952 106932256 106935207 0 5219
2 TraesCS5B01G033200 chr2B 98.577 2952 40 2 1 2952 563765201 563768150 0 5217
3 TraesCS5B01G033200 chr2B 98.307 2953 48 2 1 2952 327771546 327768595 0 5175
4 TraesCS5B01G033200 chr2B 98.306 2952 48 1 1 2952 257723680 257720731 0 5173
5 TraesCS5B01G033200 chr2B 98.205 2952 52 1 1 2952 63584120 63587070 0 5156
6 TraesCS5B01G033200 chr1B 98.577 2952 41 1 1 2952 26649547 26652497 0 5217
7 TraesCS5B01G033200 chr4B 98.543 2952 41 2 1 2952 11627593 11624644 0 5212
8 TraesCS5B01G033200 chr3B 98.543 2952 42 1 1 2952 717600214 717597264 0 5212
9 TraesCS5B01G033200 chr6B 98.306 2952 49 1 1 2952 586281871 586278921 0 5173


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G033200 chr5B 36450562 36453513 2951 True 5452 5452 100.000 1 2952 1 chr5B.!!$R1 2951
1 TraesCS5B01G033200 chr2B 106932256 106935207 2951 False 5219 5219 98.578 1 2952 1 chr2B.!!$F2 2951
2 TraesCS5B01G033200 chr2B 563765201 563768150 2949 False 5217 5217 98.577 1 2952 1 chr2B.!!$F3 2951
3 TraesCS5B01G033200 chr2B 327768595 327771546 2951 True 5175 5175 98.307 1 2952 1 chr2B.!!$R2 2951
4 TraesCS5B01G033200 chr2B 257720731 257723680 2949 True 5173 5173 98.306 1 2952 1 chr2B.!!$R1 2951
5 TraesCS5B01G033200 chr2B 63584120 63587070 2950 False 5156 5156 98.205 1 2952 1 chr2B.!!$F1 2951
6 TraesCS5B01G033200 chr1B 26649547 26652497 2950 False 5217 5217 98.577 1 2952 1 chr1B.!!$F1 2951
7 TraesCS5B01G033200 chr4B 11624644 11627593 2949 True 5212 5212 98.543 1 2952 1 chr4B.!!$R1 2951
8 TraesCS5B01G033200 chr3B 717597264 717600214 2950 True 5212 5212 98.543 1 2952 1 chr3B.!!$R1 2951
9 TraesCS5B01G033200 chr6B 586278921 586281871 2950 True 5173 5173 98.306 1 2952 1 chr6B.!!$R1 2951

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
794 795 0.534203 TTCCACTCTTCACGCCCAAC 60.534 55.0 0.0 0.0 0.0 3.77 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2342 2345 2.550277 TGGCTTCCTCTGTCATCCTA 57.45 50.0 0.0 0.0 0.0 2.94 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
794 795 0.534203 TTCCACTCTTCACGCCCAAC 60.534 55.000 0.00 0.0 0.00 3.77
1079 1080 8.961294 TGAATTGAATTGATTGGTTCAGTTTT 57.039 26.923 0.00 0.0 35.36 2.43
1246 1247 1.057851 TGTTGGGAACGGAAGGGAGT 61.058 55.000 0.00 0.0 0.00 3.85
1343 1344 1.078848 GCTCGGCCTCAACATGTCT 60.079 57.895 0.00 0.0 0.00 3.41
1383 1384 0.820226 CCTCACGCTCATCTTCCTCA 59.180 55.000 0.00 0.0 0.00 3.86
1384 1385 1.411977 CCTCACGCTCATCTTCCTCAT 59.588 52.381 0.00 0.0 0.00 2.90
1478 1480 4.202461 GCCCCATTGATGTCCTACTAATGA 60.202 45.833 0.00 0.0 32.05 2.57
1969 1972 8.680903 CACTTCCTCATAAATGCTAACTCAATT 58.319 33.333 0.00 0.0 0.00 2.32
2057 2060 6.875948 TTGTGAAGTTTAGTATGCATGTGT 57.124 33.333 10.16 0.0 0.00 3.72
2449 2453 1.771255 GACTATGGTTCCAGCCCTGAT 59.229 52.381 0.00 0.0 0.00 2.90
2600 2604 1.153369 TGGCACGGATAGAGCTTGC 60.153 57.895 0.00 0.0 36.65 4.01
2943 2947 2.917933 CTCGGCCCATGTAGAAAATCA 58.082 47.619 0.00 0.0 0.00 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
165 166 1.871039 TGGACAAGCAAACTTCGCTAC 59.129 47.619 0.00 0.0 39.29 3.58
355 356 2.124983 CTGATGCACCGGAGTGGG 60.125 66.667 9.46 0.0 44.69 4.61
486 487 0.893270 TTAGCAAACATGCTGGGCGT 60.893 50.000 13.27 0.0 45.81 5.68
700 701 3.831323 TCAACTCCATTGGTTGTCACAT 58.169 40.909 1.86 0.0 42.97 3.21
794 795 3.065655 GGAGAGCTGCAGCATACTAATG 58.934 50.000 38.24 0.0 45.16 1.90
1079 1080 4.721776 AGAAGGCTGGGTGAAGAATATACA 59.278 41.667 0.00 0.0 0.00 2.29
1383 1384 1.153549 GGCGAGCGTCCTTGAAGAT 60.154 57.895 0.00 0.0 0.00 2.40
1384 1385 2.261671 GGCGAGCGTCCTTGAAGA 59.738 61.111 0.00 0.0 0.00 2.87
1478 1480 6.658849 TCAGCACCATGGTAGTAACAATTAT 58.341 36.000 19.28 0.0 0.00 1.28
1969 1972 4.127171 TGATAGTGTCGACGATGATCTGA 58.873 43.478 11.62 0.0 0.00 3.27
2057 2060 5.810587 GGCAAGATCTAACAATACTCGTCAA 59.189 40.000 0.00 0.0 0.00 3.18
2231 2234 2.687935 ACCATGCTTTTTGTTGTCGAGT 59.312 40.909 0.00 0.0 0.00 4.18
2342 2345 2.550277 TGGCTTCCTCTGTCATCCTA 57.450 50.000 0.00 0.0 0.00 2.94
2449 2453 4.942483 TCAACAGGACAAAAACTTCGGTAA 59.058 37.500 0.00 0.0 0.00 2.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.