Multiple sequence alignment - TraesCS5B01G028600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G028600 chr5B 100.000 2384 0 0 1 2384 27520979 27518596 0.000000e+00 4403
1 TraesCS5B01G028600 chr5B 95.844 1997 56 4 411 2384 649475675 649477667 0.000000e+00 3203
2 TraesCS5B01G028600 chr5B 97.273 220 4 2 1 218 649474435 649474654 2.890000e-99 372
3 TraesCS5B01G028600 chr7B 97.318 2386 60 3 1 2384 694212196 694214579 0.000000e+00 4048
4 TraesCS5B01G028600 chr7B 97.690 2338 51 3 49 2384 607604461 607606797 0.000000e+00 4015
5 TraesCS5B01G028600 chr7B 94.930 1578 62 2 411 1988 703126279 703127838 0.000000e+00 2455
6 TraesCS5B01G028600 chr7B 94.568 902 25 6 428 1307 65681877 65680978 0.000000e+00 1373
7 TraesCS5B01G028600 chr7B 95.276 254 8 4 1 251 65682126 65681874 1.330000e-107 399
8 TraesCS5B01G028600 chr1B 95.935 2386 87 8 1 2384 31344024 31346401 0.000000e+00 3860
9 TraesCS5B01G028600 chr4A 95.918 2205 65 7 202 2384 650641078 650643279 0.000000e+00 3550
10 TraesCS5B01G028600 chr3B 97.167 1977 52 3 411 2384 445129312 445127337 0.000000e+00 3338
11 TraesCS5B01G028600 chr3B 95.425 1858 63 1 549 2384 52685185 52687042 0.000000e+00 2940
12 TraesCS5B01G028600 chr6B 96.192 1996 54 1 411 2384 646658689 646656694 0.000000e+00 3245
13 TraesCS5B01G028600 chr2B 95.696 1998 61 7 411 2384 709464645 709462649 0.000000e+00 3190
14 TraesCS5B01G028600 chr7D 88.950 362 9 13 1 333 534739075 534738716 3.670000e-113 418
15 TraesCS5B01G028600 chr7D 95.620 137 5 1 202 338 18643013 18642878 3.990000e-53 219
16 TraesCS5B01G028600 chrUn 88.889 342 10 11 19 333 442879734 442879394 1.720000e-106 396
17 TraesCS5B01G028600 chrUn 96.818 220 5 2 1 218 465738480 465738699 1.350000e-97 366
18 TraesCS5B01G028600 chrUn 95.000 220 8 3 1 218 48354843 48355061 2.270000e-90 342
19 TraesCS5B01G028600 chrUn 87.597 258 4 2 97 326 24566756 24566499 8.400000e-70 274
20 TraesCS5B01G028600 chrUn 95.541 157 6 1 63 218 264701329 264701173 1.410000e-62 250
21 TraesCS5B01G028600 chrUn 95.541 157 6 1 63 218 278242007 278242163 1.410000e-62 250
22 TraesCS5B01G028600 chrUn 95.541 157 6 1 63 218 307408300 307408144 1.410000e-62 250
23 TraesCS5B01G028600 chrUn 97.727 132 3 0 202 333 27645876 27645745 6.630000e-56 228
24 TraesCS5B01G028600 chrUn 96.970 132 4 0 202 333 465738711 465738842 3.080000e-54 222
25 TraesCS5B01G028600 chrUn 93.985 133 7 1 202 333 48355072 48355204 1.450000e-47 200
26 TraesCS5B01G028600 chrUn 94.574 129 7 0 202 330 369545484 369545356 1.450000e-47 200
27 TraesCS5B01G028600 chrUn 95.238 126 6 0 202 327 425372229 425372354 1.450000e-47 200
28 TraesCS5B01G028600 chrUn 93.750 80 3 2 329 408 27645235 27645158 4.160000e-23 119
29 TraesCS5B01G028600 chrUn 90.000 90 6 3 319 408 48348926 48348840 1.940000e-21 113
30 TraesCS5B01G028600 chrUn 92.500 80 4 2 329 408 442878895 442878818 1.940000e-21 113
31 TraesCS5B01G028600 chr3D 97.273 220 4 2 1 218 546358302 546358083 2.890000e-99 372
32 TraesCS5B01G028600 chr3D 96.818 220 5 2 1 218 84529982 84530201 1.350000e-97 366
33 TraesCS5B01G028600 chr3D 96.818 220 5 2 1 218 560168566 560168347 1.350000e-97 366
34 TraesCS5B01G028600 chr5A 96.818 220 5 2 1 218 671937340 671937559 1.350000e-97 366
35 TraesCS5B01G028600 chr5A 90.000 90 6 3 319 408 601009162 601009076 1.940000e-21 113
36 TraesCS5B01G028600 chr5A 89.888 89 6 3 319 407 692011089 692011004 6.970000e-21 111
37 TraesCS5B01G028600 chr6A 96.364 220 6 2 1 218 82985324 82985543 6.260000e-96 361
38 TraesCS5B01G028600 chr6A 95.455 220 8 2 1 218 14027612 14027831 1.360000e-92 350
39 TraesCS5B01G028600 chr6A 90.000 90 6 3 319 408 82986538 82986624 1.940000e-21 113
40 TraesCS5B01G028600 chr6A 88.889 90 7 3 319 408 617012179 617012265 9.010000e-20 108
41 TraesCS5B01G028600 chr4D 96.364 220 6 2 1 218 436826107 436826326 6.260000e-96 361
42 TraesCS5B01G028600 chr4D 96.970 132 4 0 202 333 436826337 436826468 3.080000e-54 222
43 TraesCS5B01G028600 chr4D 96.000 125 5 0 202 326 338462190 338462314 1.120000e-48 204
44 TraesCS5B01G028600 chr4D 92.500 80 4 2 329 408 460975563 460975640 1.940000e-21 113
45 TraesCS5B01G028600 chr4D 92.500 80 4 2 329 408 461413954 461413877 1.940000e-21 113
46 TraesCS5B01G028600 chr1D 95.890 219 7 2 1 218 447350007 447349790 1.050000e-93 353
47 TraesCS5B01G028600 chr1D 96.602 206 6 1 14 218 107459153 107458948 8.160000e-90 340
48 TraesCS5B01G028600 chr1D 97.727 132 3 0 202 333 419191893 419192024 6.630000e-56 228
49 TraesCS5B01G028600 chr1D 96.970 132 4 0 202 333 107458935 107458804 3.080000e-54 222
50 TraesCS5B01G028600 chr1D 96.970 132 4 0 202 333 419194572 419194703 3.080000e-54 222
51 TraesCS5B01G028600 chr1D 92.500 80 4 2 329 408 2184279 2184356 1.940000e-21 113
52 TraesCS5B01G028600 chr6D 93.750 80 3 2 329 408 91157896 91157819 4.160000e-23 119
53 TraesCS5B01G028600 chr3A 90.000 90 6 3 319 408 11149872 11149786 1.940000e-21 113
54 TraesCS5B01G028600 chr3A 90.000 90 6 3 319 408 666693971 666693885 1.940000e-21 113
55 TraesCS5B01G028600 chr3A 90.000 90 6 3 319 408 710757494 710757580 1.940000e-21 113


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G028600 chr5B 27518596 27520979 2383 True 4403.0 4403 100.0000 1 2384 1 chr5B.!!$R1 2383
1 TraesCS5B01G028600 chr5B 649474435 649477667 3232 False 1787.5 3203 96.5585 1 2384 2 chr5B.!!$F1 2383
2 TraesCS5B01G028600 chr7B 694212196 694214579 2383 False 4048.0 4048 97.3180 1 2384 1 chr7B.!!$F2 2383
3 TraesCS5B01G028600 chr7B 607604461 607606797 2336 False 4015.0 4015 97.6900 49 2384 1 chr7B.!!$F1 2335
4 TraesCS5B01G028600 chr7B 703126279 703127838 1559 False 2455.0 2455 94.9300 411 1988 1 chr7B.!!$F3 1577
5 TraesCS5B01G028600 chr7B 65680978 65682126 1148 True 886.0 1373 94.9220 1 1307 2 chr7B.!!$R1 1306
6 TraesCS5B01G028600 chr1B 31344024 31346401 2377 False 3860.0 3860 95.9350 1 2384 1 chr1B.!!$F1 2383
7 TraesCS5B01G028600 chr4A 650641078 650643279 2201 False 3550.0 3550 95.9180 202 2384 1 chr4A.!!$F1 2182
8 TraesCS5B01G028600 chr3B 445127337 445129312 1975 True 3338.0 3338 97.1670 411 2384 1 chr3B.!!$R1 1973
9 TraesCS5B01G028600 chr3B 52685185 52687042 1857 False 2940.0 2940 95.4250 549 2384 1 chr3B.!!$F1 1835
10 TraesCS5B01G028600 chr6B 646656694 646658689 1995 True 3245.0 3245 96.1920 411 2384 1 chr6B.!!$R1 1973
11 TraesCS5B01G028600 chr2B 709462649 709464645 1996 True 3190.0 3190 95.6960 411 2384 1 chr2B.!!$R1 1973
12 TraesCS5B01G028600 chrUn 442878818 442879734 916 True 254.5 396 90.6945 19 408 2 chrUn.!!$R7 389
13 TraesCS5B01G028600 chr6A 82985324 82986624 1300 False 237.0 361 93.1820 1 408 2 chr6A.!!$F3 407
14 TraesCS5B01G028600 chr1D 419191893 419194703 2810 False 225.0 228 97.3485 202 333 2 chr1D.!!$F2 131

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
737 2414 1.414181 GCTCCTCCCATCTTCGATTGA 59.586 52.381 0.0 0.0 0.0 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2202 5423 1.302752 TGGAAGCTTGCACGCAGAT 60.303 52.632 17.55 2.82 0.0 2.9 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
40 42 8.640651 GTTTAGGATTTAGGGTTGGTTTACAAA 58.359 33.333 0.00 0.00 41.58 2.83
97 99 2.342279 CTCGGCCGACAACCTTCA 59.658 61.111 27.28 0.00 0.00 3.02
571 2226 5.677567 ACTAATTAACCCTACAATCACGGG 58.322 41.667 0.00 0.00 43.79 5.28
737 2414 1.414181 GCTCCTCCCATCTTCGATTGA 59.586 52.381 0.00 0.00 0.00 2.57
776 2520 4.651778 TCCATTGATTCGACCAAGAAGTT 58.348 39.130 5.77 0.00 33.19 2.66
866 2613 5.012239 AGGATGTCATGCAAGAGCTTTTTA 58.988 37.500 7.12 0.00 42.74 1.52
1278 4498 4.692228 ACAAGGAAATGCATCAAACGTTT 58.308 34.783 7.96 7.96 0.00 3.60
1810 5031 2.030457 GGATAAGAAACGTGTGATGGCG 59.970 50.000 0.00 0.00 0.00 5.69
2138 5359 5.749109 CCAAAGTGACCTACGATCTCATTAC 59.251 44.000 0.00 0.00 0.00 1.89
2202 5423 4.307032 ACTGTACTACTTCTTACCCGGA 57.693 45.455 0.73 0.00 0.00 5.14
2217 5438 2.393768 CGGATCTGCGTGCAAGCTT 61.394 57.895 24.81 10.26 38.13 3.74
2304 5527 3.402110 CAGCAAGACATGTCACCTGTAA 58.598 45.455 27.02 0.00 0.00 2.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
21 23 7.038587 GGAATCCTTTGTAAACCAACCCTAAAT 60.039 37.037 0.00 0.00 31.20 1.40
97 99 3.324268 TGGACAATGTGAACAATTGGCAT 59.676 39.130 10.83 5.91 35.11 4.40
571 2226 5.186409 TGCGGTAGAATGGGAAGGTATATAC 59.814 44.000 4.14 4.14 0.00 1.47
693 2348 4.564821 CGTGGAGGAGACCTTTTTAATCCA 60.565 45.833 0.00 0.00 31.76 3.41
866 2613 9.998106 ACAATCAACTACTACAAACTATCAGTT 57.002 29.630 0.00 0.00 40.80 3.16
1059 4275 1.103803 CCTTCAAGTCGATCTCCCGA 58.896 55.000 0.00 0.00 36.06 5.14
1278 4498 0.321671 CAAGCTTCCGGTCCTTCTGA 59.678 55.000 0.00 0.00 0.00 3.27
1553 4773 4.156922 CCGACATAAGGTTGCCACAAATTA 59.843 41.667 0.00 0.00 0.00 1.40
1741 4962 8.685427 GGGTTTAGACACAAGTTTTAAAAGGTA 58.315 33.333 0.00 0.00 0.00 3.08
1810 5031 1.841556 TGGTGTGACTGGGGACTCC 60.842 63.158 0.00 0.00 0.00 3.85
1841 5062 5.070001 CCTTCTCACCTTGTTATGTGGAAA 58.930 41.667 0.00 0.00 33.29 3.13
2138 5359 6.148480 ACCAAAAGAATCTCTCATTTCACTCG 59.852 38.462 0.00 0.00 0.00 4.18
2202 5423 1.302752 TGGAAGCTTGCACGCAGAT 60.303 52.632 17.55 2.82 0.00 2.90
2217 5438 4.460382 GCAATCAAGAACATTCCTTCTGGA 59.540 41.667 0.00 0.00 41.36 3.86
2304 5527 6.704310 ACCCGTAGTTCTATTGTACACAATT 58.296 36.000 12.50 0.00 43.48 2.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.