Multiple sequence alignment - TraesCS5B01G019000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G019000 chr5B 100.000 2264 0 0 1 2264 18184113 18186376 0.000000e+00 4181.0
1 TraesCS5B01G019000 chr5B 97.927 2267 42 3 2 2264 353930733 353928468 0.000000e+00 3921.0
2 TraesCS5B01G019000 chr5B 94.126 2128 62 25 1 2071 123786975 123789096 0.000000e+00 3179.0
3 TraesCS5B01G019000 chr5B 91.700 253 20 1 1819 2071 514052593 514052844 1.290000e-92 350.0
4 TraesCS5B01G019000 chr5B 88.938 226 16 2 2039 2264 514052848 514053064 1.030000e-68 270.0
5 TraesCS5B01G019000 chr5B 88.496 226 16 5 2039 2264 123789100 123789315 4.790000e-67 265.0
6 TraesCS5B01G019000 chr5B 82.313 294 40 7 1972 2264 705248980 705248698 6.250000e-61 244.0
7 TraesCS5B01G019000 chr5B 89.412 85 9 0 1859 1943 123789096 123789180 8.550000e-20 108.0
8 TraesCS5B01G019000 chr3B 97.914 2205 43 2 1 2203 734227364 734225161 0.000000e+00 3814.0
9 TraesCS5B01G019000 chr3B 91.277 1754 134 10 1 1748 21644988 21646728 0.000000e+00 2374.0
10 TraesCS5B01G019000 chr7B 98.066 1758 29 4 1 1755 666615843 666617598 0.000000e+00 3053.0
11 TraesCS5B01G019000 chr7B 97.049 1762 45 4 1 1760 535437149 535435393 0.000000e+00 2959.0
12 TraesCS5B01G019000 chr7B 97.038 1587 41 4 1 1584 664951468 664949885 0.000000e+00 2665.0
13 TraesCS5B01G019000 chr7B 97.158 563 12 3 1684 2243 666617562 666618123 0.000000e+00 948.0
14 TraesCS5B01G019000 chr7B 82.819 227 28 4 2039 2264 692398972 692399188 2.290000e-45 193.0
15 TraesCS5B01G019000 chr7B 94.118 102 6 0 1757 1858 535435342 535435241 3.010000e-34 156.0
16 TraesCS5B01G019000 chr3D 94.476 1756 82 10 1 1748 581472630 581474378 0.000000e+00 2691.0
17 TraesCS5B01G019000 chr3D 98.113 53 1 0 1756 1808 581474426 581474478 2.390000e-15 93.5
18 TraesCS5B01G019000 chr6B 91.141 1761 135 11 1 1751 715471835 715470086 0.000000e+00 2368.0
19 TraesCS5B01G019000 chr4A 95.347 1139 31 5 690 1808 692376407 692375271 0.000000e+00 1790.0
20 TraesCS5B01G019000 chr4A 87.892 223 22 3 1852 2071 692375205 692374985 8.020000e-65 257.0
21 TraesCS5B01G019000 chr4A 87.054 224 18 4 2042 2264 692374978 692374765 2.250000e-60 243.0
22 TraesCS5B01G019000 chr4B 94.885 391 15 4 1684 2071 522405557 522405945 6.920000e-170 606.0
23 TraesCS5B01G019000 chr4B 93.805 226 13 1 2039 2264 522405949 522406173 2.790000e-89 339.0
24 TraesCS5B01G019000 chr2D 83.446 296 36 6 1972 2264 126687717 126687432 1.720000e-66 263.0
25 TraesCS5B01G019000 chr2D 98.113 53 1 0 1756 1808 126687965 126687913 2.390000e-15 93.5
26 TraesCS5B01G019000 chr2D 83.516 91 15 0 1866 1956 126687717 126687627 4.010000e-13 86.1
27 TraesCS5B01G019000 chr2B 85.294 170 10 6 2099 2264 799685676 799685834 6.470000e-36 161.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G019000 chr5B 18184113 18186376 2263 False 4181.000000 4181 100.000000 1 2264 1 chr5B.!!$F1 2263
1 TraesCS5B01G019000 chr5B 353928468 353930733 2265 True 3921.000000 3921 97.927000 2 2264 1 chr5B.!!$R1 2262
2 TraesCS5B01G019000 chr5B 123786975 123789315 2340 False 1184.000000 3179 90.678000 1 2264 3 chr5B.!!$F2 2263
3 TraesCS5B01G019000 chr3B 734225161 734227364 2203 True 3814.000000 3814 97.914000 1 2203 1 chr3B.!!$R1 2202
4 TraesCS5B01G019000 chr3B 21644988 21646728 1740 False 2374.000000 2374 91.277000 1 1748 1 chr3B.!!$F1 1747
5 TraesCS5B01G019000 chr7B 664949885 664951468 1583 True 2665.000000 2665 97.038000 1 1584 1 chr7B.!!$R1 1583
6 TraesCS5B01G019000 chr7B 666615843 666618123 2280 False 2000.500000 3053 97.612000 1 2243 2 chr7B.!!$F2 2242
7 TraesCS5B01G019000 chr7B 535435241 535437149 1908 True 1557.500000 2959 95.583500 1 1858 2 chr7B.!!$R2 1857
8 TraesCS5B01G019000 chr3D 581472630 581474478 1848 False 1392.250000 2691 96.294500 1 1808 2 chr3D.!!$F1 1807
9 TraesCS5B01G019000 chr6B 715470086 715471835 1749 True 2368.000000 2368 91.141000 1 1751 1 chr6B.!!$R1 1750
10 TraesCS5B01G019000 chr4A 692374765 692376407 1642 True 763.333333 1790 90.097667 690 2264 3 chr4A.!!$R1 1574
11 TraesCS5B01G019000 chr4B 522405557 522406173 616 False 472.500000 606 94.345000 1684 2264 2 chr4B.!!$F1 580

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
859 870 0.813184 GGACTGATAACGGGTCGACA 59.187 55.0 18.91 0.0 0.0 4.35 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1871 2052 1.940752 GCCTAAACGCCGTGGTTTCTA 60.941 52.381 0.0 0.0 40.41 2.1 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
134 135 1.134560 GACCTACCAAATCGACGAGCT 59.865 52.381 3.01 0.0 0.00 4.09
244 245 3.141398 AGTAAGTATCATTGGCCATGCG 58.859 45.455 6.09 0.0 32.13 4.73
245 246 2.346766 AAGTATCATTGGCCATGCGA 57.653 45.000 6.09 3.6 32.13 5.10
400 407 1.758592 GCCCGAGTATAATGGCCCA 59.241 57.895 0.00 0.0 37.94 5.36
448 455 2.291605 GGTTGAGCCCAAGGGTAGAATT 60.292 50.000 7.05 0.0 37.65 2.17
859 870 0.813184 GGACTGATAACGGGTCGACA 59.187 55.000 18.91 0.0 0.00 4.35
1335 1353 5.736813 ACTTGTTTTGTGTGTAGTCACCTA 58.263 37.500 0.00 0.0 43.26 3.08
1364 1382 5.769662 TCTTTGCAAGTACTTCACATGGATT 59.230 36.000 4.77 0.0 0.00 3.01
1411 1429 7.041721 GTCCAAAAAGACCAACTTCAAGATTT 58.958 34.615 0.00 0.0 37.93 2.17
1536 1554 1.860484 GCGCAAAGAGAAGGCAGCTT 61.860 55.000 0.30 0.0 0.00 3.74
1871 2052 0.320247 CTCTGTTCTGCCAAGACGCT 60.320 55.000 0.00 0.0 29.98 5.07
2141 2357 0.178975 TCGGTGGCATTTTGGTCCTT 60.179 50.000 0.00 0.0 0.00 3.36
2165 2382 3.053693 TGCAGATTATAAGGCCTTGTGGT 60.054 43.478 28.77 14.1 35.27 4.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
134 135 2.488891 CCATCTCTTGTTGTCCCACCAA 60.489 50.000 0.00 0.00 0.00 3.67
200 201 1.043816 CCTCTCACACTGACACCACT 58.956 55.000 0.00 0.00 0.00 4.00
244 245 1.226018 CGCCGCCGTCAAAAGATTC 60.226 57.895 0.00 0.00 0.00 2.52
245 246 1.964373 ACGCCGCCGTCAAAAGATT 60.964 52.632 0.00 0.00 46.39 2.40
299 302 5.050126 AGATCAAACTCATGCATCCTCAT 57.950 39.130 0.00 0.00 0.00 2.90
388 395 3.870299 GCCTAAGCTCTGGGCCATTATAC 60.870 52.174 6.72 0.00 43.05 1.47
400 407 0.399233 AAGGATCGGGCCTAAGCTCT 60.399 55.000 0.84 0.00 37.33 4.09
448 455 2.029290 GCCTCTCAACCGTTTCTGTCTA 60.029 50.000 0.00 0.00 0.00 2.59
859 870 9.122779 CCATTTGGATTATGCAAATAACCAAAT 57.877 29.630 20.97 22.94 44.72 2.32
1240 1257 1.843851 ACATACCGGTGGGATGTCATT 59.156 47.619 19.93 0.00 32.23 2.57
1364 1382 3.986996 TCTTCTGGCACTTCATGATCA 57.013 42.857 0.00 0.00 0.00 2.92
1411 1429 1.030488 CCGTCGCTGTCTCCTAAGGA 61.030 60.000 0.00 0.00 0.00 3.36
1536 1554 0.318441 CTTGCCCTCTCGTCTTGACA 59.682 55.000 1.59 0.00 0.00 3.58
1810 1964 2.778299 ACAAAGCATTTCTGGCGTCTA 58.222 42.857 0.00 0.00 35.03 2.59
1871 2052 1.940752 GCCTAAACGCCGTGGTTTCTA 60.941 52.381 0.00 0.00 40.41 2.10
1898 2079 3.057946 GCAACCACACATTTTCCTCTCTC 60.058 47.826 0.00 0.00 0.00 3.20
2130 2346 8.260114 CCTTATAATCTGCAAAAGGACCAAAAT 58.740 33.333 0.00 0.00 39.26 1.82
2141 2357 4.402155 CCACAAGGCCTTATAATCTGCAAA 59.598 41.667 20.00 0.00 0.00 3.68
2165 2382 4.782691 TGAAGAATGAGTTATGGAGTGGGA 59.217 41.667 0.00 0.00 0.00 4.37


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.