Multiple sequence alignment - TraesCS5B01G010000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G010000 chr5B 100.000 4642 0 0 1 4642 9673286 9668645 0.000000e+00 8573.0
1 TraesCS5B01G010000 chr5B 90.909 275 16 6 4144 4418 319802630 319802365 1.230000e-95 361.0
2 TraesCS5B01G010000 chr5B 96.089 179 6 1 4464 4641 447560604 447560426 1.630000e-74 291.0
3 TraesCS5B01G010000 chr5A 96.085 1456 43 6 721 2170 7742074 7740627 0.000000e+00 2361.0
4 TraesCS5B01G010000 chr5A 91.203 773 35 12 2063 2831 7740672 7739929 0.000000e+00 1020.0
5 TraesCS5B01G010000 chr5A 88.931 262 12 5 422 682 7742320 7742075 1.620000e-79 307.0
6 TraesCS5B01G010000 chr5A 100.000 33 0 0 363 395 7742355 7742323 1.390000e-05 62.1
7 TraesCS5B01G010000 chrUn 95.879 1456 45 7 721 2170 144738139 144736693 0.000000e+00 2342.0
8 TraesCS5B01G010000 chrUn 95.873 1454 45 7 721 2168 144775251 144773807 0.000000e+00 2338.0
9 TraesCS5B01G010000 chrUn 95.873 1454 45 9 721 2168 179851924 179850480 0.000000e+00 2338.0
10 TraesCS5B01G010000 chrUn 95.808 1455 44 8 721 2168 144888213 144886769 0.000000e+00 2333.0
11 TraesCS5B01G010000 chrUn 95.670 1455 45 9 721 2168 144844497 144843054 0.000000e+00 2322.0
12 TraesCS5B01G010000 chrUn 95.604 1456 46 8 721 2170 144926791 144925348 0.000000e+00 2318.0
13 TraesCS5B01G010000 chrUn 95.261 1456 49 9 721 2170 144807722 144806281 0.000000e+00 2289.0
14 TraesCS5B01G010000 chrUn 95.441 1009 34 5 721 1724 409321514 409320513 0.000000e+00 1598.0
15 TraesCS5B01G010000 chrUn 91.085 774 34 13 2063 2831 144925393 144924650 0.000000e+00 1014.0
16 TraesCS5B01G010000 chrUn 90.827 774 36 13 2063 2831 144773850 144773107 0.000000e+00 1003.0
17 TraesCS5B01G010000 chrUn 90.698 774 37 14 2063 2831 144736738 144735995 0.000000e+00 998.0
18 TraesCS5B01G010000 chrUn 90.698 774 37 13 2063 2831 144806326 144805583 0.000000e+00 998.0
19 TraesCS5B01G010000 chrUn 90.698 774 37 13 2063 2831 144843097 144842354 0.000000e+00 998.0
20 TraesCS5B01G010000 chrUn 90.698 774 37 13 2063 2831 144886812 144886069 0.000000e+00 998.0
21 TraesCS5B01G010000 chrUn 91.258 755 33 11 2063 2813 382075962 382076687 0.000000e+00 998.0
22 TraesCS5B01G010000 chrUn 90.310 774 39 15 2063 2831 179850523 179849781 0.000000e+00 981.0
23 TraesCS5B01G010000 chrUn 96.918 584 13 3 1587 2168 382075425 382076005 0.000000e+00 974.0
24 TraesCS5B01G010000 chrUn 91.667 264 13 7 46 301 136982311 136982573 1.590000e-94 357.0
25 TraesCS5B01G010000 chrUn 88.636 264 11 6 422 682 144888461 144888214 2.100000e-78 303.0
26 TraesCS5B01G010000 chrUn 96.685 181 4 2 4464 4642 50437517 50437697 2.710000e-77 300.0
27 TraesCS5B01G010000 chrUn 88.302 265 11 6 422 682 144734886 144734638 2.710000e-77 300.0
28 TraesCS5B01G010000 chrUn 88.302 265 11 6 422 682 144738388 144738140 2.710000e-77 300.0
29 TraesCS5B01G010000 chrUn 88.302 265 11 6 422 682 144775500 144775252 2.710000e-77 300.0
30 TraesCS5B01G010000 chrUn 88.302 265 11 6 422 682 144927040 144926792 2.710000e-77 300.0
31 TraesCS5B01G010000 chrUn 96.685 181 4 2 4464 4642 263186114 263185934 2.710000e-77 300.0
32 TraesCS5B01G010000 chrUn 96.685 181 4 2 4464 4642 345495550 345495730 2.710000e-77 300.0
33 TraesCS5B01G010000 chrUn 88.302 265 11 6 422 682 409321763 409321515 2.710000e-77 300.0
34 TraesCS5B01G010000 chrUn 87.925 265 12 6 422 682 144807971 144807723 1.260000e-75 294.0
35 TraesCS5B01G010000 chrUn 87.879 264 13 6 422 682 144844745 144844498 4.540000e-75 292.0
36 TraesCS5B01G010000 chrUn 87.879 264 13 7 422 682 179852172 179851925 4.540000e-75 292.0
37 TraesCS5B01G010000 chrUn 92.391 184 8 5 4464 4642 49175900 49175718 1.660000e-64 257.0
38 TraesCS5B01G010000 chrUn 92.391 184 8 5 4464 4642 252592770 252592588 1.660000e-64 257.0
39 TraesCS5B01G010000 chrUn 90.000 180 16 2 4464 4642 60539860 60539682 1.000000e-56 231.0
40 TraesCS5B01G010000 chrUn 90.000 180 12 5 4464 4639 10529683 10529860 1.300000e-55 228.0
41 TraesCS5B01G010000 chrUn 89.444 180 14 5 4464 4639 293081468 293081646 6.050000e-54 222.0
42 TraesCS5B01G010000 chrUn 88.398 181 15 5 4464 4639 2577090 2576911 3.640000e-51 213.0
43 TraesCS5B01G010000 chrUn 87.978 183 18 4 4464 4642 41389658 41389476 3.640000e-51 213.0
44 TraesCS5B01G010000 chrUn 84.848 132 6 5 422 550 12064892 12064772 2.270000e-23 121.0
45 TraesCS5B01G010000 chrUn 92.453 53 1 2 311 363 12065022 12064973 6.440000e-09 73.1
46 TraesCS5B01G010000 chrUn 92.453 53 1 2 311 363 144735016 144734967 6.440000e-09 73.1
47 TraesCS5B01G010000 chrUn 92.453 53 1 2 311 363 144738518 144738469 6.440000e-09 73.1
48 TraesCS5B01G010000 chrUn 92.453 53 1 2 311 363 144844875 144844826 6.440000e-09 73.1
49 TraesCS5B01G010000 chrUn 92.453 53 1 2 311 363 144888592 144888543 6.440000e-09 73.1
50 TraesCS5B01G010000 chrUn 92.453 53 1 2 311 363 144927170 144927121 6.440000e-09 73.1
51 TraesCS5B01G010000 chrUn 92.453 53 1 2 311 363 179852302 179852253 6.440000e-09 73.1
52 TraesCS5B01G010000 chrUn 90.566 53 2 2 311 363 144775630 144775581 3.000000e-07 67.6
53 TraesCS5B01G010000 chrUn 90.566 53 2 2 311 363 144808101 144808052 3.000000e-07 67.6
54 TraesCS5B01G010000 chr3D 91.321 265 14 6 46 301 398072561 398072297 2.050000e-93 353.0
55 TraesCS5B01G010000 chr3D 90.840 262 18 5 46 301 139832363 139832624 3.440000e-91 346.0
56 TraesCS5B01G010000 chr5D 91.221 262 17 4 46 301 211389066 211388805 7.390000e-93 351.0
57 TraesCS5B01G010000 chr6D 91.120 259 20 2 46 301 204060268 204060526 9.560000e-92 348.0
58 TraesCS5B01G010000 chr6D 93.889 180 10 1 4464 4642 377848665 377848844 2.130000e-68 270.0
59 TraesCS5B01G010000 chr6D 91.803 183 9 5 4464 4642 424672017 424671837 2.770000e-62 250.0
60 TraesCS5B01G010000 chr6D 91.713 181 9 6 4464 4639 473518557 473518378 3.590000e-61 246.0
61 TraesCS5B01G010000 chr6D 91.160 181 10 5 4464 4639 455633267 455633446 1.670000e-59 241.0
62 TraesCS5B01G010000 chr4B 91.188 261 15 4 49 302 246424945 246424686 9.560000e-92 348.0
63 TraesCS5B01G010000 chr4B 95.000 180 8 1 4464 4642 51632676 51632497 9.830000e-72 281.0
64 TraesCS5B01G010000 chr4B 95.000 180 8 1 4464 4642 654981432 654981611 9.830000e-72 281.0
65 TraesCS5B01G010000 chr4B 95.000 180 8 1 4464 4642 655017162 655017341 9.830000e-72 281.0
66 TraesCS5B01G010000 chr4B 95.906 171 6 1 4465 4634 660089418 660089248 4.580000e-70 276.0
67 TraesCS5B01G010000 chr4B 93.889 180 10 1 4464 4642 655052568 655052747 2.130000e-68 270.0
68 TraesCS5B01G010000 chr4A 90.943 265 14 8 46 301 75569622 75569885 9.560000e-92 348.0
69 TraesCS5B01G010000 chr4A 96.685 181 4 2 4464 4642 703450356 703450536 2.710000e-77 300.0
70 TraesCS5B01G010000 chr4A 95.028 181 7 2 4464 4642 670558855 670559035 2.730000e-72 283.0
71 TraesCS5B01G010000 chr4A 95.055 182 6 2 4464 4642 740743938 740743757 2.730000e-72 283.0
72 TraesCS5B01G010000 chr4A 92.784 194 12 2 4447 4639 648770476 648770668 3.540000e-71 279.0
73 TraesCS5B01G010000 chr1B 91.188 261 15 6 48 301 231661731 231661990 9.560000e-92 348.0
74 TraesCS5B01G010000 chr1B 96.089 179 6 1 4464 4641 643025770 643025592 1.630000e-74 291.0
75 TraesCS5B01G010000 chr1B 95.000 180 7 2 4464 4642 94009950 94009772 9.830000e-72 281.0
76 TraesCS5B01G010000 chr1B 95.775 142 5 1 4476 4616 594692478 594692619 1.300000e-55 228.0
77 TraesCS5B01G010000 chr2A 89.888 267 23 3 48 310 729664644 729664378 1.600000e-89 340.0
78 TraesCS5B01G010000 chr2B 97.222 180 4 1 4464 4642 776456218 776456397 2.100000e-78 303.0
79 TraesCS5B01G010000 chr2B 95.833 168 5 2 4476 4642 452910982 452910816 2.130000e-68 270.0
80 TraesCS5B01G010000 chr3B 96.667 180 5 1 4464 4642 465344921 465345100 9.760000e-77 298.0
81 TraesCS5B01G010000 chr3B 96.667 180 4 2 4464 4642 533444602 533444780 9.760000e-77 298.0
82 TraesCS5B01G010000 chr7B 96.111 180 6 1 4464 4642 191892743 191892922 4.540000e-75 292.0
83 TraesCS5B01G010000 chr6B 96.089 179 6 1 4464 4641 563975053 563975231 1.630000e-74 291.0
84 TraesCS5B01G010000 chr6B 95.556 180 7 1 4464 4642 121524793 121524614 2.110000e-73 287.0
85 TraesCS5B01G010000 chr1D 94.915 177 8 1 4464 4639 106325111 106324935 4.580000e-70 276.0
86 TraesCS5B01G010000 chr4D 87.500 120 11 3 3921 4040 57444997 57444882 8.100000e-28 135.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G010000 chr5B 9668645 9673286 4641 True 8573.000000 8573 100.000000 1 4642 1 chr5B.!!$R1 4641
1 TraesCS5B01G010000 chr5A 7739929 7742355 2426 True 937.525000 2361 94.054750 363 2831 4 chr5A.!!$R1 2468
2 TraesCS5B01G010000 chrUn 382075425 382076687 1262 False 986.000000 998 94.088000 1587 2813 2 chrUn.!!$F6 1226
3 TraesCS5B01G010000 chrUn 409320513 409321763 1250 True 949.000000 1598 91.871500 422 1724 2 chrUn.!!$R15 1302
4 TraesCS5B01G010000 chrUn 144773107 144775630 2523 True 927.150000 2338 91.392000 311 2831 4 chrUn.!!$R9 2520
5 TraesCS5B01G010000 chrUn 144886069 144888592 2523 True 926.775000 2333 91.898750 311 2831 4 chrUn.!!$R12 2520
6 TraesCS5B01G010000 chrUn 144924650 144927170 2520 True 926.275000 2318 91.861000 311 2831 4 chrUn.!!$R13 2520
7 TraesCS5B01G010000 chrUn 144842354 144844875 2521 True 921.275000 2322 91.675000 311 2831 4 chrUn.!!$R11 2520
8 TraesCS5B01G010000 chrUn 179849781 179852302 2521 True 921.025000 2338 91.628750 311 2831 4 chrUn.!!$R14 2520
9 TraesCS5B01G010000 chrUn 144805583 144808101 2518 True 912.150000 2289 91.112500 311 2831 4 chrUn.!!$R10 2520
10 TraesCS5B01G010000 chrUn 144734638 144738518 3880 True 681.033333 2342 91.347833 311 2831 6 chrUn.!!$R8 2520


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
418 463 0.035725 GGTTTTGTAGTAGCGGGCCT 60.036 55.0 0.84 0.0 0.00 5.19 F
495 541 0.250989 TAAACCAAGACGCCCCCAAG 60.251 55.0 0.00 0.0 0.00 3.61 F
593 642 0.543174 AGGTCAGGTCAGGTCAGGTC 60.543 60.0 0.00 0.0 0.00 3.85 F
1646 1700 0.689080 ACGGAGGGAGTGCATCAGAT 60.689 55.0 3.18 0.0 0.00 2.90 F
3222 3444 0.107410 ACCTTGGTCAACGTGCTTGA 60.107 50.0 0.00 0.0 36.46 3.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2025 2082 1.066573 ACTTGAGGCTGGTCATCTTCG 60.067 52.381 0.00 0.0 0.00 3.79 R
2245 2365 1.070134 GTCCAAACCAAAAGGAAGGCC 59.930 52.381 0.00 0.0 32.30 5.19 R
2499 2619 0.035056 CAGGGGGTTAGTGCCTCTTG 60.035 60.000 0.00 0.0 29.58 3.02 R
3269 3491 0.033208 CTTTCCCAGGGGCTGCATAA 60.033 55.000 5.33 0.0 34.68 1.90 R
4319 4672 0.035725 TAGGAGCGTCGGAACTGAGA 60.036 55.000 0.00 0.0 0.00 3.27 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
17 18 3.432588 CGCGTCGAGACTGGAGGT 61.433 66.667 0.00 0.00 0.00 3.85
18 19 2.486042 GCGTCGAGACTGGAGGTC 59.514 66.667 8.65 0.00 44.80 3.85
29 30 4.618920 GACTGGAGGTCTTAGGTTCAAA 57.381 45.455 0.00 0.00 41.46 2.69
30 31 4.570930 GACTGGAGGTCTTAGGTTCAAAG 58.429 47.826 0.00 0.00 41.46 2.77
31 32 3.244596 ACTGGAGGTCTTAGGTTCAAAGC 60.245 47.826 0.00 0.00 0.00 3.51
32 33 2.708861 TGGAGGTCTTAGGTTCAAAGCA 59.291 45.455 0.00 0.00 0.00 3.91
33 34 3.075148 GGAGGTCTTAGGTTCAAAGCAC 58.925 50.000 0.00 0.00 0.00 4.40
34 35 3.244596 GGAGGTCTTAGGTTCAAAGCACT 60.245 47.826 0.00 0.00 0.00 4.40
35 36 4.020485 GGAGGTCTTAGGTTCAAAGCACTA 60.020 45.833 0.00 0.00 0.00 2.74
36 37 4.895961 AGGTCTTAGGTTCAAAGCACTAC 58.104 43.478 0.00 0.00 0.00 2.73
37 38 4.593634 AGGTCTTAGGTTCAAAGCACTACT 59.406 41.667 0.00 0.00 0.00 2.57
38 39 4.691216 GGTCTTAGGTTCAAAGCACTACTG 59.309 45.833 0.00 0.00 0.00 2.74
39 40 5.298347 GTCTTAGGTTCAAAGCACTACTGT 58.702 41.667 0.00 0.00 0.00 3.55
40 41 6.453092 GTCTTAGGTTCAAAGCACTACTGTA 58.547 40.000 0.00 0.00 0.00 2.74
41 42 6.927381 GTCTTAGGTTCAAAGCACTACTGTAA 59.073 38.462 0.00 0.00 0.00 2.41
42 43 7.440255 GTCTTAGGTTCAAAGCACTACTGTAAA 59.560 37.037 0.00 0.00 0.00 2.01
43 44 7.988599 TCTTAGGTTCAAAGCACTACTGTAAAA 59.011 33.333 0.00 0.00 0.00 1.52
44 45 8.508883 TTAGGTTCAAAGCACTACTGTAAAAA 57.491 30.769 0.00 0.00 0.00 1.94
70 71 9.524496 AAAATACTCCCTCCGTTTTTATTTAGT 57.476 29.630 0.00 0.00 0.00 2.24
71 72 8.728337 AATACTCCCTCCGTTTTTATTTAGTC 57.272 34.615 0.00 0.00 0.00 2.59
72 73 5.494724 ACTCCCTCCGTTTTTATTTAGTCC 58.505 41.667 0.00 0.00 0.00 3.85
73 74 4.506758 TCCCTCCGTTTTTATTTAGTCCG 58.493 43.478 0.00 0.00 0.00 4.79
74 75 3.064408 CCCTCCGTTTTTATTTAGTCCGC 59.936 47.826 0.00 0.00 0.00 5.54
75 76 3.242188 CCTCCGTTTTTATTTAGTCCGCG 60.242 47.826 0.00 0.00 0.00 6.46
76 77 3.324993 TCCGTTTTTATTTAGTCCGCGT 58.675 40.909 4.92 0.00 0.00 6.01
77 78 4.489810 TCCGTTTTTATTTAGTCCGCGTA 58.510 39.130 4.92 0.00 0.00 4.42
78 79 5.108517 TCCGTTTTTATTTAGTCCGCGTAT 58.891 37.500 4.92 0.00 0.00 3.06
79 80 6.269315 TCCGTTTTTATTTAGTCCGCGTATA 58.731 36.000 4.92 0.00 0.00 1.47
80 81 6.754209 TCCGTTTTTATTTAGTCCGCGTATAA 59.246 34.615 4.92 0.00 0.00 0.98
81 82 7.043458 TCCGTTTTTATTTAGTCCGCGTATAAG 60.043 37.037 4.92 0.00 0.00 1.73
82 83 6.567512 CGTTTTTATTTAGTCCGCGTATAAGC 59.432 38.462 4.92 0.00 0.00 3.09
83 84 7.515684 CGTTTTTATTTAGTCCGCGTATAAGCT 60.516 37.037 4.92 0.00 34.40 3.74
84 85 7.775397 TTTTATTTAGTCCGCGTATAAGCTT 57.225 32.000 4.92 3.48 34.40 3.74
85 86 7.775397 TTTATTTAGTCCGCGTATAAGCTTT 57.225 32.000 3.20 0.00 34.40 3.51
86 87 5.652744 ATTTAGTCCGCGTATAAGCTTTG 57.347 39.130 3.20 0.00 34.40 2.77
87 88 2.953466 AGTCCGCGTATAAGCTTTGA 57.047 45.000 3.20 0.45 34.40 2.69
88 89 3.454371 AGTCCGCGTATAAGCTTTGAT 57.546 42.857 3.20 0.00 34.40 2.57
89 90 4.579454 AGTCCGCGTATAAGCTTTGATA 57.421 40.909 3.20 0.00 34.40 2.15
90 91 4.940463 AGTCCGCGTATAAGCTTTGATAA 58.060 39.130 3.20 0.00 34.40 1.75
91 92 5.353938 AGTCCGCGTATAAGCTTTGATAAA 58.646 37.500 3.20 0.00 34.40 1.40
92 93 5.813672 AGTCCGCGTATAAGCTTTGATAAAA 59.186 36.000 3.20 0.00 34.40 1.52
93 94 6.018994 AGTCCGCGTATAAGCTTTGATAAAAG 60.019 38.462 3.20 0.00 34.40 2.27
94 95 5.813672 TCCGCGTATAAGCTTTGATAAAAGT 59.186 36.000 3.20 0.00 34.40 2.66
95 96 6.019318 TCCGCGTATAAGCTTTGATAAAAGTC 60.019 38.462 3.20 0.00 34.40 3.01
96 97 6.237996 CCGCGTATAAGCTTTGATAAAAGTCA 60.238 38.462 3.20 0.00 34.40 3.41
97 98 7.177407 CGCGTATAAGCTTTGATAAAAGTCAA 58.823 34.615 3.20 0.00 36.38 3.18
98 99 7.370836 CGCGTATAAGCTTTGATAAAAGTCAAG 59.629 37.037 3.20 0.00 39.13 3.02
99 100 7.164335 GCGTATAAGCTTTGATAAAAGTCAAGC 59.836 37.037 3.20 0.00 39.13 4.01
100 101 8.391106 CGTATAAGCTTTGATAAAAGTCAAGCT 58.609 33.333 3.20 0.00 40.72 3.74
115 116 9.529325 AAAAGTCAAGCTTTATAAACTTTGACC 57.471 29.630 27.04 17.92 45.91 4.02
116 117 7.817418 AGTCAAGCTTTATAAACTTTGACCA 57.183 32.000 27.04 8.39 0.00 4.02
117 118 8.232913 AGTCAAGCTTTATAAACTTTGACCAA 57.767 30.769 27.04 8.16 0.00 3.67
118 119 8.352942 AGTCAAGCTTTATAAACTTTGACCAAG 58.647 33.333 27.04 11.78 38.64 3.61
270 271 7.630242 AAAACTTGACTTCAATCAACTCTGA 57.370 32.000 0.00 0.00 34.84 3.27
271 272 7.814264 AAACTTGACTTCAATCAACTCTGAT 57.186 32.000 0.00 0.00 44.54 2.90
272 273 8.908786 AAACTTGACTTCAATCAACTCTGATA 57.091 30.769 0.00 0.00 41.66 2.15
273 274 9.512588 AAACTTGACTTCAATCAACTCTGATAT 57.487 29.630 0.00 0.00 41.66 1.63
274 275 8.489990 ACTTGACTTCAATCAACTCTGATATG 57.510 34.615 0.00 0.00 41.66 1.78
275 276 6.915544 TGACTTCAATCAACTCTGATATGC 57.084 37.500 0.00 0.00 41.66 3.14
276 277 6.408869 TGACTTCAATCAACTCTGATATGCA 58.591 36.000 0.00 0.00 41.66 3.96
277 278 6.880529 TGACTTCAATCAACTCTGATATGCAA 59.119 34.615 0.00 0.00 41.66 4.08
278 279 7.391275 TGACTTCAATCAACTCTGATATGCAAA 59.609 33.333 0.00 0.00 41.66 3.68
279 280 7.759465 ACTTCAATCAACTCTGATATGCAAAG 58.241 34.615 0.00 0.00 41.66 2.77
280 281 7.392673 ACTTCAATCAACTCTGATATGCAAAGT 59.607 33.333 0.00 0.00 41.66 2.66
281 282 8.791327 TTCAATCAACTCTGATATGCAAAGTA 57.209 30.769 0.00 0.00 41.66 2.24
282 283 8.791327 TCAATCAACTCTGATATGCAAAGTAA 57.209 30.769 0.00 0.00 41.66 2.24
283 284 9.230122 TCAATCAACTCTGATATGCAAAGTAAA 57.770 29.630 0.00 0.00 41.66 2.01
292 293 9.781834 TCTGATATGCAAAGTAAATAAAAACGG 57.218 29.630 0.00 0.00 0.00 4.44
293 294 9.781834 CTGATATGCAAAGTAAATAAAAACGGA 57.218 29.630 0.00 0.00 0.00 4.69
294 295 9.781834 TGATATGCAAAGTAAATAAAAACGGAG 57.218 29.630 0.00 0.00 0.00 4.63
295 296 9.233232 GATATGCAAAGTAAATAAAAACGGAGG 57.767 33.333 0.00 0.00 0.00 4.30
296 297 5.774630 TGCAAAGTAAATAAAAACGGAGGG 58.225 37.500 0.00 0.00 0.00 4.30
297 298 5.535406 TGCAAAGTAAATAAAAACGGAGGGA 59.465 36.000 0.00 0.00 0.00 4.20
298 299 6.090783 GCAAAGTAAATAAAAACGGAGGGAG 58.909 40.000 0.00 0.00 0.00 4.30
299 300 6.294342 GCAAAGTAAATAAAAACGGAGGGAGT 60.294 38.462 0.00 0.00 0.00 3.85
300 301 7.094677 GCAAAGTAAATAAAAACGGAGGGAGTA 60.095 37.037 0.00 0.00 0.00 2.59
301 302 7.912056 AAGTAAATAAAAACGGAGGGAGTAC 57.088 36.000 0.00 0.00 0.00 2.73
302 303 7.008021 AGTAAATAAAAACGGAGGGAGTACA 57.992 36.000 0.00 0.00 0.00 2.90
303 304 7.627311 AGTAAATAAAAACGGAGGGAGTACAT 58.373 34.615 0.00 0.00 0.00 2.29
304 305 8.761689 AGTAAATAAAAACGGAGGGAGTACATA 58.238 33.333 0.00 0.00 0.00 2.29
305 306 9.038803 GTAAATAAAAACGGAGGGAGTACATAG 57.961 37.037 0.00 0.00 0.00 2.23
306 307 6.803366 ATAAAAACGGAGGGAGTACATAGT 57.197 37.500 0.00 0.00 0.00 2.12
307 308 7.902920 ATAAAAACGGAGGGAGTACATAGTA 57.097 36.000 0.00 0.00 0.00 1.82
308 309 6.610075 AAAAACGGAGGGAGTACATAGTAA 57.390 37.500 0.00 0.00 0.00 2.24
309 310 6.803366 AAAACGGAGGGAGTACATAGTAAT 57.197 37.500 0.00 0.00 0.00 1.89
347 348 1.692411 GGCAAAATAGGAATCGCCCT 58.308 50.000 0.00 0.00 40.29 5.19
348 349 2.031870 GGCAAAATAGGAATCGCCCTT 58.968 47.619 0.00 0.00 37.74 3.95
349 350 2.223805 GGCAAAATAGGAATCGCCCTTG 60.224 50.000 0.00 0.00 37.74 3.61
350 351 2.687935 GCAAAATAGGAATCGCCCTTGA 59.312 45.455 0.00 0.00 37.74 3.02
351 352 3.130340 GCAAAATAGGAATCGCCCTTGAA 59.870 43.478 0.00 0.00 37.74 2.69
354 355 1.874129 TAGGAATCGCCCTTGAAGGA 58.126 50.000 13.97 0.00 37.67 3.36
355 356 0.543749 AGGAATCGCCCTTGAAGGAG 59.456 55.000 13.97 6.57 37.67 3.69
357 358 0.253327 GAATCGCCCTTGAAGGAGGT 59.747 55.000 13.97 0.00 37.67 3.85
358 359 0.253327 AATCGCCCTTGAAGGAGGTC 59.747 55.000 13.97 0.00 37.67 3.85
359 360 1.961180 ATCGCCCTTGAAGGAGGTCG 61.961 60.000 13.97 10.36 39.40 4.79
360 361 2.646175 CGCCCTTGAAGGAGGTCGA 61.646 63.158 13.97 0.00 40.42 4.20
361 362 1.219393 GCCCTTGAAGGAGGTCGAG 59.781 63.158 13.97 0.00 37.67 4.04
404 449 4.614036 CCCAGGCCACGGGGTTTT 62.614 66.667 20.39 0.00 45.94 2.43
405 450 3.302344 CCAGGCCACGGGGTTTTG 61.302 66.667 5.12 0.84 36.17 2.44
406 451 2.520741 CAGGCCACGGGGTTTTGT 60.521 61.111 5.12 0.00 36.17 2.83
407 452 1.228306 CAGGCCACGGGGTTTTGTA 60.228 57.895 5.12 0.00 36.17 2.41
408 453 1.074248 AGGCCACGGGGTTTTGTAG 59.926 57.895 5.12 0.00 36.17 2.74
409 454 1.228337 GGCCACGGGGTTTTGTAGT 60.228 57.895 5.12 0.00 36.17 2.73
410 455 0.036590 GGCCACGGGGTTTTGTAGTA 59.963 55.000 5.12 0.00 36.17 1.82
411 456 1.445871 GCCACGGGGTTTTGTAGTAG 58.554 55.000 5.12 0.00 36.17 2.57
412 457 1.445871 CCACGGGGTTTTGTAGTAGC 58.554 55.000 0.00 0.00 0.00 3.58
413 458 1.073177 CACGGGGTTTTGTAGTAGCG 58.927 55.000 0.00 0.00 0.00 4.26
414 459 0.037046 ACGGGGTTTTGTAGTAGCGG 60.037 55.000 0.00 0.00 0.00 5.52
415 460 0.741927 CGGGGTTTTGTAGTAGCGGG 60.742 60.000 0.00 0.00 0.00 6.13
416 461 1.028330 GGGGTTTTGTAGTAGCGGGC 61.028 60.000 0.00 0.00 0.00 6.13
417 462 1.028330 GGGTTTTGTAGTAGCGGGCC 61.028 60.000 0.00 0.00 0.00 5.80
418 463 0.035725 GGTTTTGTAGTAGCGGGCCT 60.036 55.000 0.84 0.00 0.00 5.19
419 464 1.207811 GGTTTTGTAGTAGCGGGCCTA 59.792 52.381 0.84 0.00 0.00 3.93
420 465 2.158856 GGTTTTGTAGTAGCGGGCCTAT 60.159 50.000 0.84 0.00 0.00 2.57
433 479 2.431454 GGGCCTATGCTAAGATTGCTC 58.569 52.381 0.84 0.00 37.74 4.26
461 507 1.739338 CGCTCTGGGCTATCGAACCT 61.739 60.000 0.00 0.00 39.13 3.50
495 541 0.250989 TAAACCAAGACGCCCCCAAG 60.251 55.000 0.00 0.00 0.00 3.61
507 553 3.927501 CCCAAGCCCCCAACCCTT 61.928 66.667 0.00 0.00 0.00 3.95
508 554 2.283894 CCAAGCCCCCAACCCTTC 60.284 66.667 0.00 0.00 0.00 3.46
509 555 2.283894 CAAGCCCCCAACCCTTCC 60.284 66.667 0.00 0.00 0.00 3.46
510 556 3.600981 AAGCCCCCAACCCTTCCC 61.601 66.667 0.00 0.00 0.00 3.97
526 572 0.748450 TCCCCGTCGTCATCCATAAC 59.252 55.000 0.00 0.00 0.00 1.89
590 639 1.294780 GCAGGTCAGGTCAGGTCAG 59.705 63.158 0.00 0.00 0.00 3.51
591 640 1.978473 CAGGTCAGGTCAGGTCAGG 59.022 63.158 0.00 0.00 0.00 3.86
592 641 0.833834 CAGGTCAGGTCAGGTCAGGT 60.834 60.000 0.00 0.00 0.00 4.00
593 642 0.543174 AGGTCAGGTCAGGTCAGGTC 60.543 60.000 0.00 0.00 0.00 3.85
594 643 0.832135 GGTCAGGTCAGGTCAGGTCA 60.832 60.000 0.00 0.00 0.00 4.02
604 653 4.035814 TCAGGTCAGGTCAGATTCATCAT 58.964 43.478 0.00 0.00 0.00 2.45
682 731 3.229697 GCCTTAGCCATGGGAGTATTT 57.770 47.619 15.13 0.00 0.00 1.40
683 732 2.887152 GCCTTAGCCATGGGAGTATTTG 59.113 50.000 15.13 0.00 0.00 2.32
684 733 3.688414 GCCTTAGCCATGGGAGTATTTGT 60.688 47.826 15.13 0.00 0.00 2.83
685 734 4.137543 CCTTAGCCATGGGAGTATTTGTC 58.862 47.826 15.13 0.00 0.00 3.18
686 735 4.385199 CCTTAGCCATGGGAGTATTTGTCA 60.385 45.833 15.13 0.00 0.00 3.58
687 736 3.287867 AGCCATGGGAGTATTTGTCAG 57.712 47.619 15.13 0.00 0.00 3.51
688 737 2.092212 AGCCATGGGAGTATTTGTCAGG 60.092 50.000 15.13 0.00 0.00 3.86
689 738 2.092429 GCCATGGGAGTATTTGTCAGGA 60.092 50.000 15.13 0.00 0.00 3.86
690 739 3.813443 CCATGGGAGTATTTGTCAGGAG 58.187 50.000 2.85 0.00 0.00 3.69
691 740 3.200825 CCATGGGAGTATTTGTCAGGAGT 59.799 47.826 2.85 0.00 0.00 3.85
692 741 4.324563 CCATGGGAGTATTTGTCAGGAGTT 60.325 45.833 2.85 0.00 0.00 3.01
693 742 5.104527 CCATGGGAGTATTTGTCAGGAGTTA 60.105 44.000 2.85 0.00 0.00 2.24
694 743 6.409695 CCATGGGAGTATTTGTCAGGAGTTAT 60.410 42.308 2.85 0.00 0.00 1.89
695 744 7.202093 CCATGGGAGTATTTGTCAGGAGTTATA 60.202 40.741 2.85 0.00 0.00 0.98
696 745 7.120923 TGGGAGTATTTGTCAGGAGTTATAC 57.879 40.000 0.00 0.00 0.00 1.47
697 746 6.901300 TGGGAGTATTTGTCAGGAGTTATACT 59.099 38.462 0.00 0.00 32.98 2.12
698 747 7.147724 TGGGAGTATTTGTCAGGAGTTATACTG 60.148 40.741 0.00 0.00 38.94 2.74
699 748 7.069578 GGGAGTATTTGTCAGGAGTTATACTGA 59.930 40.741 0.00 0.00 44.58 3.41
708 757 6.912426 TCAGGAGTTATACTGATGTAGGAGT 58.088 40.000 0.00 0.00 41.76 3.85
709 758 8.042286 TCAGGAGTTATACTGATGTAGGAGTA 57.958 38.462 0.00 0.00 41.76 2.59
710 759 8.158132 TCAGGAGTTATACTGATGTAGGAGTAG 58.842 40.741 0.00 0.00 41.76 2.57
711 760 6.943718 AGGAGTTATACTGATGTAGGAGTAGC 59.056 42.308 0.00 0.00 31.51 3.58
712 761 6.943718 GGAGTTATACTGATGTAGGAGTAGCT 59.056 42.308 0.00 0.00 31.51 3.32
713 762 7.094549 GGAGTTATACTGATGTAGGAGTAGCTG 60.095 44.444 0.00 0.00 31.51 4.24
714 763 6.717540 AGTTATACTGATGTAGGAGTAGCTGG 59.282 42.308 0.00 0.00 31.51 4.85
715 764 3.390175 ACTGATGTAGGAGTAGCTGGT 57.610 47.619 0.00 0.00 0.00 4.00
716 765 3.027412 ACTGATGTAGGAGTAGCTGGTG 58.973 50.000 0.00 0.00 0.00 4.17
717 766 3.027412 CTGATGTAGGAGTAGCTGGTGT 58.973 50.000 0.00 0.00 0.00 4.16
718 767 4.207955 CTGATGTAGGAGTAGCTGGTGTA 58.792 47.826 0.00 0.00 0.00 2.90
719 768 3.952323 TGATGTAGGAGTAGCTGGTGTAC 59.048 47.826 0.00 0.00 0.00 2.90
743 792 2.038837 GCGCAACCTGTTACTCCCC 61.039 63.158 0.30 0.00 0.00 4.81
816 865 7.762159 TCATTACTTATCTGACAATGCGTACAA 59.238 33.333 0.00 0.00 0.00 2.41
819 868 6.341316 ACTTATCTGACAATGCGTACAAGAT 58.659 36.000 0.00 0.00 0.00 2.40
834 883 2.909006 ACAAGATGATGTCCCTCTGTGT 59.091 45.455 0.00 0.00 0.00 3.72
837 886 2.690497 AGATGATGTCCCTCTGTGTACG 59.310 50.000 0.00 0.00 0.00 3.67
852 901 7.709182 CCTCTGTGTACGGTGAATTCATTTATA 59.291 37.037 12.12 0.00 0.00 0.98
901 950 8.090831 AGCTGAAAATCTTATTTTTGTCCCTTC 58.909 33.333 0.00 0.00 0.00 3.46
979 1028 4.636648 ACTTATTTTTGACCGTGTGTGTGA 59.363 37.500 0.00 0.00 0.00 3.58
980 1029 2.904011 TTTTTGACCGTGTGTGTGAC 57.096 45.000 0.00 0.00 0.00 3.67
983 1032 1.087202 TTGACCGTGTGTGTGACTGC 61.087 55.000 0.00 0.00 0.00 4.40
1024 1077 2.368875 TCAACAACCAGGAAGAGACCTC 59.631 50.000 0.00 0.00 38.32 3.85
1170 1223 6.295236 CCATGGTTTCAGAATTTGTGGTACAT 60.295 38.462 2.57 0.00 44.52 2.29
1287 1340 3.181462 CCATCTGCAGCCTACATGAAGTA 60.181 47.826 9.47 0.00 0.00 2.24
1339 1393 1.261480 TGCAGTCTCTCTTCCTGGAC 58.739 55.000 0.00 0.00 0.00 4.02
1346 1400 2.573462 TCTCTCTTCCTGGACCCAAATG 59.427 50.000 0.00 0.00 0.00 2.32
1347 1401 2.307098 CTCTCTTCCTGGACCCAAATGT 59.693 50.000 0.00 0.00 0.00 2.71
1385 1439 5.101648 TGATGTGAGATTTGCAGACCATA 57.898 39.130 0.00 0.00 0.00 2.74
1395 1449 3.070476 TGCAGACCATAATCAAGCACA 57.930 42.857 0.00 0.00 30.09 4.57
1410 1464 7.744087 ATCAAGCACAATTAGTTGTAGAACA 57.256 32.000 2.99 0.00 46.49 3.18
1446 1500 3.004734 CCATTCAAAGTGACTTGGACACC 59.995 47.826 0.98 0.00 38.82 4.16
1450 1504 3.709653 TCAAAGTGACTTGGACACCTACT 59.290 43.478 0.00 0.00 38.82 2.57
1480 1534 6.019779 AGATCGCAGATGATTAGTAAGTCC 57.980 41.667 0.00 0.00 45.12 3.85
1542 1596 5.591067 TGCATGATTTCTGCTCAATGTATGA 59.409 36.000 0.00 0.00 40.34 2.15
1646 1700 0.689080 ACGGAGGGAGTGCATCAGAT 60.689 55.000 3.18 0.00 0.00 2.90
1836 1890 5.415701 TGGTCAGCAGATTTTTATGAAGTCC 59.584 40.000 0.00 0.00 0.00 3.85
1859 1913 2.751259 AGGCGTCTTTCAGTGTACGATA 59.249 45.455 12.02 0.00 37.53 2.92
1957 2011 6.999272 TGCACCTTATTTTAGTTACAGGTTCA 59.001 34.615 0.00 0.00 32.03 3.18
1959 2013 7.968405 GCACCTTATTTTAGTTACAGGTTCATG 59.032 37.037 0.00 0.00 32.03 3.07
2064 2121 7.941238 CCTCAAGTTCCATGTTATCCATCTTAT 59.059 37.037 0.00 0.00 0.00 1.73
2118 2175 9.105844 AGATGCATAGACTACTATATTGGGTTT 57.894 33.333 0.00 0.00 37.24 3.27
2130 2187 8.451908 ACTATATTGGGTTTGCTTCTATTGTC 57.548 34.615 0.00 0.00 0.00 3.18
2153 2272 3.853831 TTGCTATGCAGAAATGTGTGG 57.146 42.857 0.00 0.00 40.61 4.17
2180 2299 2.623878 TAGACTACTCTCAGCCCTCG 57.376 55.000 0.00 0.00 0.00 4.63
2219 2339 6.099845 TGTCTTTGTAGTTTCCCTCTTCTCTT 59.900 38.462 0.00 0.00 0.00 2.85
2245 2365 2.049248 GGTGCATGCGGTGGTTTG 60.049 61.111 14.09 0.00 0.00 2.93
2300 2420 1.746220 TGGACGTGGTTGGTTCTTTTG 59.254 47.619 0.00 0.00 0.00 2.44
2301 2421 1.535226 GGACGTGGTTGGTTCTTTTGC 60.535 52.381 0.00 0.00 0.00 3.68
2302 2422 1.133407 GACGTGGTTGGTTCTTTTGCA 59.867 47.619 0.00 0.00 0.00 4.08
2303 2423 1.134175 ACGTGGTTGGTTCTTTTGCAG 59.866 47.619 0.00 0.00 0.00 4.41
2304 2424 1.535860 CGTGGTTGGTTCTTTTGCAGG 60.536 52.381 0.00 0.00 0.00 4.85
2305 2425 1.480545 GTGGTTGGTTCTTTTGCAGGT 59.519 47.619 0.00 0.00 0.00 4.00
2306 2426 2.093711 GTGGTTGGTTCTTTTGCAGGTT 60.094 45.455 0.00 0.00 0.00 3.50
2307 2427 2.569404 TGGTTGGTTCTTTTGCAGGTTT 59.431 40.909 0.00 0.00 0.00 3.27
2308 2428 3.008485 TGGTTGGTTCTTTTGCAGGTTTT 59.992 39.130 0.00 0.00 0.00 2.43
2309 2429 4.006989 GGTTGGTTCTTTTGCAGGTTTTT 58.993 39.130 0.00 0.00 0.00 1.94
2339 2459 3.567530 TGCGATGTTGAATGCTTTGAAG 58.432 40.909 0.00 0.00 0.00 3.02
2340 2460 3.252944 TGCGATGTTGAATGCTTTGAAGA 59.747 39.130 0.00 0.00 0.00 2.87
2341 2461 4.082625 TGCGATGTTGAATGCTTTGAAGAT 60.083 37.500 0.00 0.00 0.00 2.40
2342 2462 4.264614 GCGATGTTGAATGCTTTGAAGATG 59.735 41.667 0.00 0.00 0.00 2.90
2363 2483 3.185594 TGCTTTTGTTCCGTTATCTGACG 59.814 43.478 0.00 0.00 42.43 4.35
2451 2571 1.066858 TGCACCTCTAAGCTGCAGTAC 60.067 52.381 16.64 0.00 36.00 2.73
2463 2583 2.160417 GCTGCAGTACCAAGTCATGAAC 59.840 50.000 16.64 0.00 0.00 3.18
2499 2619 5.973565 CACAAGAACTTCAATCCTTCACAAC 59.026 40.000 0.00 0.00 0.00 3.32
2533 2653 3.154710 CCCCCTGAACTACAAGGAAAAC 58.845 50.000 0.00 0.00 32.12 2.43
2599 2719 3.507233 CCATGTTGCCTTAGTGTTGATGT 59.493 43.478 0.00 0.00 0.00 3.06
2648 2769 9.921637 ATCTTTTGTTTGTAACTCTTTGTTTCA 57.078 25.926 0.00 0.00 39.89 2.69
2674 2795 6.322201 TGAAATCTTTTGTTTCTCTCCTTGCT 59.678 34.615 0.00 0.00 36.71 3.91
2704 2825 5.471797 TGTTGCTTGAGACGATAATCCAAAA 59.528 36.000 0.00 0.00 0.00 2.44
2705 2826 6.150976 TGTTGCTTGAGACGATAATCCAAAAT 59.849 34.615 0.00 0.00 0.00 1.82
2706 2827 6.757897 TGCTTGAGACGATAATCCAAAATT 57.242 33.333 0.00 0.00 0.00 1.82
2707 2828 6.785191 TGCTTGAGACGATAATCCAAAATTC 58.215 36.000 0.00 0.00 0.00 2.17
2843 2966 9.537192 AAGTAACAACCTTACATTTAAAAAGGC 57.463 29.630 14.48 1.40 42.99 4.35
2844 2967 8.697292 AGTAACAACCTTACATTTAAAAAGGCA 58.303 29.630 14.48 0.00 42.99 4.75
2846 2969 8.794335 AACAACCTTACATTTAAAAAGGCAAA 57.206 26.923 14.48 0.00 42.99 3.68
2847 2970 8.972458 ACAACCTTACATTTAAAAAGGCAAAT 57.028 26.923 14.48 0.50 42.99 2.32
2859 2982 9.988815 TTTAAAAAGGCAAATATAGTTCTTGCA 57.011 25.926 10.40 0.00 45.77 4.08
2860 2983 9.988815 TTAAAAAGGCAAATATAGTTCTTGCAA 57.011 25.926 10.40 0.00 45.77 4.08
2861 2984 8.900983 AAAAAGGCAAATATAGTTCTTGCAAA 57.099 26.923 10.40 0.00 45.77 3.68
2862 2985 8.900983 AAAAGGCAAATATAGTTCTTGCAAAA 57.099 26.923 10.40 0.00 45.77 2.44
2863 2986 8.538409 AAAGGCAAATATAGTTCTTGCAAAAG 57.462 30.769 10.40 0.00 45.77 2.27
2864 2987 6.101997 AGGCAAATATAGTTCTTGCAAAAGC 58.898 36.000 10.40 0.00 45.77 3.51
2866 2989 6.536224 GGCAAATATAGTTCTTGCAAAAGCAT 59.464 34.615 10.40 0.00 45.77 3.79
2867 2990 7.254218 GGCAAATATAGTTCTTGCAAAAGCATC 60.254 37.037 10.40 0.00 45.77 3.91
2868 2991 7.490402 GCAAATATAGTTCTTGCAAAAGCATCT 59.510 33.333 0.00 0.00 43.89 2.90
2870 2993 9.578439 AAATATAGTTCTTGCAAAAGCATCTTC 57.422 29.630 0.00 0.00 0.00 2.87
2871 2994 4.924305 AGTTCTTGCAAAAGCATCTTCA 57.076 36.364 0.00 0.00 0.00 3.02
2873 2996 5.663456 AGTTCTTGCAAAAGCATCTTCAAA 58.337 33.333 0.00 0.00 0.00 2.69
2875 2998 6.257193 AGTTCTTGCAAAAGCATCTTCAAAAG 59.743 34.615 0.00 0.00 0.00 2.27
2877 3000 6.339730 TCTTGCAAAAGCATCTTCAAAAGAA 58.660 32.000 0.00 0.00 41.63 2.52
2878 3001 6.987992 TCTTGCAAAAGCATCTTCAAAAGAAT 59.012 30.769 0.00 0.00 41.63 2.40
2879 3002 6.774354 TGCAAAAGCATCTTCAAAAGAATC 57.226 33.333 0.00 0.00 41.63 2.52
2880 3003 6.518493 TGCAAAAGCATCTTCAAAAGAATCT 58.482 32.000 0.00 0.00 41.63 2.40
2881 3004 7.660112 TGCAAAAGCATCTTCAAAAGAATCTA 58.340 30.769 0.00 0.00 41.63 1.98
2882 3005 8.143193 TGCAAAAGCATCTTCAAAAGAATCTAA 58.857 29.630 0.00 0.00 41.63 2.10
2892 3015 9.950496 TCTTCAAAAGAATCTAATAAGACTGCT 57.050 29.630 0.00 0.00 33.83 4.24
2893 3016 9.985318 CTTCAAAAGAATCTAATAAGACTGCTG 57.015 33.333 0.00 0.00 33.57 4.41
2894 3017 8.498054 TCAAAAGAATCTAATAAGACTGCTGG 57.502 34.615 0.00 0.00 33.57 4.85
2896 3019 5.620738 AGAATCTAATAAGACTGCTGGCA 57.379 39.130 0.00 0.00 33.57 4.92
2897 3020 5.994250 AGAATCTAATAAGACTGCTGGCAA 58.006 37.500 0.00 0.00 33.57 4.52
2898 3021 6.054295 AGAATCTAATAAGACTGCTGGCAAG 58.946 40.000 0.00 0.00 33.57 4.01
2900 3023 4.507710 TCTAATAAGACTGCTGGCAAGTG 58.492 43.478 0.00 0.00 0.00 3.16
2901 3024 2.867109 ATAAGACTGCTGGCAAGTGT 57.133 45.000 0.00 0.00 0.00 3.55
2902 3025 1.882912 TAAGACTGCTGGCAAGTGTG 58.117 50.000 0.00 0.00 0.00 3.82
2903 3026 0.181114 AAGACTGCTGGCAAGTGTGA 59.819 50.000 0.00 0.00 0.00 3.58
2904 3027 0.181114 AGACTGCTGGCAAGTGTGAA 59.819 50.000 0.00 0.00 0.00 3.18
2906 3029 0.820891 ACTGCTGGCAAGTGTGAAGG 60.821 55.000 0.00 0.00 0.00 3.46
2907 3030 0.820891 CTGCTGGCAAGTGTGAAGGT 60.821 55.000 0.00 0.00 0.00 3.50
2908 3031 0.472044 TGCTGGCAAGTGTGAAGGTA 59.528 50.000 0.00 0.00 0.00 3.08
2909 3032 1.073763 TGCTGGCAAGTGTGAAGGTAT 59.926 47.619 0.00 0.00 0.00 2.73
2910 3033 2.162681 GCTGGCAAGTGTGAAGGTATT 58.837 47.619 0.00 0.00 0.00 1.89
2911 3034 2.095059 GCTGGCAAGTGTGAAGGTATTG 60.095 50.000 0.00 0.00 0.00 1.90
2913 3036 2.162681 GGCAAGTGTGAAGGTATTGCT 58.837 47.619 7.98 0.00 44.33 3.91
2914 3037 3.244735 TGGCAAGTGTGAAGGTATTGCTA 60.245 43.478 7.98 0.00 44.33 3.49
2915 3038 3.375299 GGCAAGTGTGAAGGTATTGCTAG 59.625 47.826 7.98 0.00 44.33 3.42
2916 3039 4.003648 GCAAGTGTGAAGGTATTGCTAGT 58.996 43.478 1.20 0.00 42.24 2.57
2917 3040 5.175859 GCAAGTGTGAAGGTATTGCTAGTA 58.824 41.667 1.20 0.00 42.24 1.82
2919 3042 5.012328 AGTGTGAAGGTATTGCTAGTAGC 57.988 43.478 15.56 15.56 42.82 3.58
2920 3043 4.712337 AGTGTGAAGGTATTGCTAGTAGCT 59.288 41.667 22.34 6.43 42.97 3.32
2921 3044 5.187967 AGTGTGAAGGTATTGCTAGTAGCTT 59.812 40.000 22.34 12.55 42.97 3.74
2922 3045 6.380274 AGTGTGAAGGTATTGCTAGTAGCTTA 59.620 38.462 22.34 11.26 42.97 3.09
2923 3046 7.070074 AGTGTGAAGGTATTGCTAGTAGCTTAT 59.930 37.037 22.34 16.87 42.97 1.73
2925 3048 9.090103 TGTGAAGGTATTGCTAGTAGCTTATAT 57.910 33.333 22.34 12.57 42.97 0.86
2949 3072 6.327279 AGTTACCTTAGGAAAACAACATGC 57.673 37.500 18.15 0.00 0.00 4.06
2950 3073 6.068670 AGTTACCTTAGGAAAACAACATGCT 58.931 36.000 18.15 0.00 0.00 3.79
2951 3074 6.549736 AGTTACCTTAGGAAAACAACATGCTT 59.450 34.615 18.15 0.00 0.00 3.91
2952 3075 5.869649 ACCTTAGGAAAACAACATGCTTT 57.130 34.783 4.77 0.00 0.00 3.51
2954 3077 6.745116 ACCTTAGGAAAACAACATGCTTTAC 58.255 36.000 4.77 0.00 0.00 2.01
2955 3078 6.322712 ACCTTAGGAAAACAACATGCTTTACA 59.677 34.615 4.77 0.00 0.00 2.41
2956 3079 7.015195 ACCTTAGGAAAACAACATGCTTTACAT 59.985 33.333 4.77 0.00 40.66 2.29
2957 3080 7.872483 CCTTAGGAAAACAACATGCTTTACATT 59.128 33.333 0.00 0.00 36.64 2.71
2959 3082 9.906660 TTAGGAAAACAACATGCTTTACATTAG 57.093 29.630 0.00 0.00 36.64 1.73
2960 3083 7.951591 AGGAAAACAACATGCTTTACATTAGT 58.048 30.769 0.00 0.00 36.64 2.24
2961 3084 7.867403 AGGAAAACAACATGCTTTACATTAGTG 59.133 33.333 0.00 0.00 36.64 2.74
2962 3085 7.651704 GGAAAACAACATGCTTTACATTAGTGT 59.348 33.333 0.00 0.00 42.39 3.55
2963 3086 7.928908 AAACAACATGCTTTACATTAGTGTG 57.071 32.000 0.34 0.00 39.39 3.82
2964 3087 6.875948 ACAACATGCTTTACATTAGTGTGA 57.124 33.333 0.34 0.00 39.39 3.58
2965 3088 6.902341 ACAACATGCTTTACATTAGTGTGAG 58.098 36.000 0.34 0.71 39.39 3.51
2966 3089 6.710295 ACAACATGCTTTACATTAGTGTGAGA 59.290 34.615 0.34 0.00 39.39 3.27
2968 3091 6.467677 ACATGCTTTACATTAGTGTGAGAGT 58.532 36.000 0.34 0.00 39.39 3.24
2969 3092 7.611770 ACATGCTTTACATTAGTGTGAGAGTA 58.388 34.615 0.34 0.00 39.39 2.59
2970 3093 8.260818 ACATGCTTTACATTAGTGTGAGAGTAT 58.739 33.333 0.34 0.00 39.39 2.12
2972 3095 6.535150 TGCTTTACATTAGTGTGAGAGTATGC 59.465 38.462 0.34 0.00 39.39 3.14
2973 3096 6.758886 GCTTTACATTAGTGTGAGAGTATGCT 59.241 38.462 0.34 0.00 39.39 3.79
2974 3097 7.278868 GCTTTACATTAGTGTGAGAGTATGCTT 59.721 37.037 0.34 0.00 39.39 3.91
2975 3098 9.803315 CTTTACATTAGTGTGAGAGTATGCTTA 57.197 33.333 0.34 0.00 39.39 3.09
2978 3101 8.480643 ACATTAGTGTGAGAGTATGCTTAAAC 57.519 34.615 0.00 0.00 37.14 2.01
2979 3102 8.094548 ACATTAGTGTGAGAGTATGCTTAAACA 58.905 33.333 0.00 0.00 37.14 2.83
2980 3103 9.102757 CATTAGTGTGAGAGTATGCTTAAACAT 57.897 33.333 0.00 0.00 0.00 2.71
2981 3104 6.974932 AGTGTGAGAGTATGCTTAAACATG 57.025 37.500 1.52 0.00 0.00 3.21
2984 3107 7.826252 AGTGTGAGAGTATGCTTAAACATGAAT 59.174 33.333 0.00 0.00 0.00 2.57
2985 3108 8.119226 GTGTGAGAGTATGCTTAAACATGAATC 58.881 37.037 0.00 0.00 0.00 2.52
2987 3110 6.479990 TGAGAGTATGCTTAAACATGAATCGG 59.520 38.462 0.00 0.00 0.00 4.18
2988 3111 6.349300 AGAGTATGCTTAAACATGAATCGGT 58.651 36.000 0.00 0.00 0.00 4.69
2989 3112 6.480320 AGAGTATGCTTAAACATGAATCGGTC 59.520 38.462 0.00 0.00 0.00 4.79
2990 3113 6.112734 AGTATGCTTAAACATGAATCGGTCA 58.887 36.000 0.00 0.00 41.67 4.02
2993 3116 5.483811 TGCTTAAACATGAATCGGTCAGTA 58.516 37.500 0.00 0.00 40.43 2.74
2995 3118 7.269316 TGCTTAAACATGAATCGGTCAGTATA 58.731 34.615 0.00 0.00 40.43 1.47
2996 3119 7.223971 TGCTTAAACATGAATCGGTCAGTATAC 59.776 37.037 0.00 0.00 40.43 1.47
2997 3120 7.223971 GCTTAAACATGAATCGGTCAGTATACA 59.776 37.037 5.50 0.00 40.43 2.29
2998 3121 6.903883 AAACATGAATCGGTCAGTATACAC 57.096 37.500 5.50 0.00 40.43 2.90
3000 3123 6.161855 ACATGAATCGGTCAGTATACACAT 57.838 37.500 5.50 0.00 40.43 3.21
3001 3124 6.582636 ACATGAATCGGTCAGTATACACATT 58.417 36.000 5.50 0.00 40.43 2.71
3002 3125 7.047891 ACATGAATCGGTCAGTATACACATTT 58.952 34.615 5.50 0.00 40.43 2.32
3004 3127 6.635755 TGAATCGGTCAGTATACACATTTGA 58.364 36.000 5.50 0.00 0.00 2.69
3007 3130 8.506168 AATCGGTCAGTATACACATTTGAAAT 57.494 30.769 5.50 0.00 0.00 2.17
3008 3131 7.915293 TCGGTCAGTATACACATTTGAAATT 57.085 32.000 5.50 0.00 0.00 1.82
3009 3132 8.330466 TCGGTCAGTATACACATTTGAAATTT 57.670 30.769 5.50 0.00 0.00 1.82
3010 3133 8.788806 TCGGTCAGTATACACATTTGAAATTTT 58.211 29.630 5.50 0.00 0.00 1.82
3035 3257 9.890629 TTTCTGATTGTACTATAGTTGAGCATT 57.109 29.630 11.40 2.84 0.00 3.56
3039 3261 7.439356 TGATTGTACTATAGTTGAGCATTCTGC 59.561 37.037 11.40 0.00 45.46 4.26
3040 3262 5.601662 TGTACTATAGTTGAGCATTCTGCC 58.398 41.667 11.40 0.00 46.52 4.85
3045 3267 3.587797 AGTTGAGCATTCTGCCATTTG 57.412 42.857 0.00 0.00 46.52 2.32
3052 3274 2.165030 GCATTCTGCCATTTGCTACACT 59.835 45.455 0.00 0.00 42.00 3.55
3053 3275 3.378112 GCATTCTGCCATTTGCTACACTA 59.622 43.478 0.00 0.00 42.00 2.74
3054 3276 4.037208 GCATTCTGCCATTTGCTACACTAT 59.963 41.667 0.00 0.00 42.00 2.12
3055 3277 5.450965 GCATTCTGCCATTTGCTACACTATT 60.451 40.000 0.00 0.00 42.00 1.73
3056 3278 5.565592 TTCTGCCATTTGCTACACTATTG 57.434 39.130 0.00 0.00 42.00 1.90
3057 3279 4.842574 TCTGCCATTTGCTACACTATTGA 58.157 39.130 0.00 0.00 42.00 2.57
3058 3280 4.635765 TCTGCCATTTGCTACACTATTGAC 59.364 41.667 0.00 0.00 42.00 3.18
3059 3281 4.331108 TGCCATTTGCTACACTATTGACA 58.669 39.130 0.00 0.00 42.00 3.58
3060 3282 4.949238 TGCCATTTGCTACACTATTGACAT 59.051 37.500 0.00 0.00 42.00 3.06
3061 3283 5.418524 TGCCATTTGCTACACTATTGACATT 59.581 36.000 0.00 0.00 42.00 2.71
3062 3284 6.071447 TGCCATTTGCTACACTATTGACATTT 60.071 34.615 0.00 0.00 42.00 2.32
3063 3285 7.121907 TGCCATTTGCTACACTATTGACATTTA 59.878 33.333 0.00 0.00 42.00 1.40
3064 3286 8.137437 GCCATTTGCTACACTATTGACATTTAT 58.863 33.333 0.00 0.00 36.87 1.40
3065 3287 9.669353 CCATTTGCTACACTATTGACATTTATC 57.331 33.333 0.00 0.00 0.00 1.75
3066 3288 9.669353 CATTTGCTACACTATTGACATTTATCC 57.331 33.333 0.00 0.00 0.00 2.59
3067 3289 7.477144 TTGCTACACTATTGACATTTATCCG 57.523 36.000 0.00 0.00 0.00 4.18
3068 3290 5.465390 TGCTACACTATTGACATTTATCCGC 59.535 40.000 0.00 0.00 0.00 5.54
3069 3291 5.388475 GCTACACTATTGACATTTATCCGCG 60.388 44.000 0.00 0.00 0.00 6.46
3070 3292 4.689071 ACACTATTGACATTTATCCGCGA 58.311 39.130 8.23 0.00 0.00 5.87
3071 3293 4.506654 ACACTATTGACATTTATCCGCGAC 59.493 41.667 8.23 0.00 0.00 5.19
3072 3294 4.506288 CACTATTGACATTTATCCGCGACA 59.494 41.667 8.23 0.00 0.00 4.35
3073 3295 4.745125 ACTATTGACATTTATCCGCGACAG 59.255 41.667 8.23 0.00 0.00 3.51
3074 3296 2.665649 TGACATTTATCCGCGACAGT 57.334 45.000 8.23 0.00 0.00 3.55
3075 3297 2.267426 TGACATTTATCCGCGACAGTG 58.733 47.619 8.23 0.79 0.00 3.66
3082 3304 2.434884 CCGCGACAGTGGCTGAAT 60.435 61.111 8.23 0.00 41.64 2.57
3083 3305 2.034879 CCGCGACAGTGGCTGAATT 61.035 57.895 8.23 0.00 41.64 2.17
3084 3306 1.421485 CGCGACAGTGGCTGAATTC 59.579 57.895 0.00 0.00 35.18 2.17
3085 3307 1.016130 CGCGACAGTGGCTGAATTCT 61.016 55.000 0.00 0.00 35.18 2.40
3086 3308 0.445436 GCGACAGTGGCTGAATTCTG 59.555 55.000 7.05 7.51 35.18 3.02
3087 3309 0.445436 CGACAGTGGCTGAATTCTGC 59.555 55.000 24.59 24.59 39.66 4.26
3088 3310 1.527034 GACAGTGGCTGAATTCTGCA 58.473 50.000 30.69 18.13 41.76 4.41
3089 3311 1.881973 GACAGTGGCTGAATTCTGCAA 59.118 47.619 30.69 21.81 41.76 4.08
3090 3312 1.610522 ACAGTGGCTGAATTCTGCAAC 59.389 47.619 28.40 28.40 42.80 4.17
3091 3313 1.610038 CAGTGGCTGAATTCTGCAACA 59.390 47.619 33.54 22.74 44.28 3.33
3092 3314 2.230508 CAGTGGCTGAATTCTGCAACAT 59.769 45.455 33.54 21.46 44.28 2.71
3093 3315 2.230508 AGTGGCTGAATTCTGCAACATG 59.769 45.455 33.54 0.00 44.28 3.21
3094 3316 2.229543 GTGGCTGAATTCTGCAACATGA 59.770 45.455 29.81 10.56 42.26 3.07
3095 3317 3.093814 TGGCTGAATTCTGCAACATGAT 58.906 40.909 30.69 0.00 41.76 2.45
3096 3318 4.096833 GTGGCTGAATTCTGCAACATGATA 59.903 41.667 29.81 9.87 42.26 2.15
3097 3319 4.891168 TGGCTGAATTCTGCAACATGATAT 59.109 37.500 30.69 0.00 41.76 1.63
3098 3320 5.361571 TGGCTGAATTCTGCAACATGATATT 59.638 36.000 30.69 0.00 41.76 1.28
3099 3321 6.546772 TGGCTGAATTCTGCAACATGATATTA 59.453 34.615 30.69 6.58 41.76 0.98
3100 3322 7.231925 TGGCTGAATTCTGCAACATGATATTAT 59.768 33.333 30.69 0.00 41.76 1.28
3101 3323 8.733458 GGCTGAATTCTGCAACATGATATTATA 58.267 33.333 30.69 0.00 41.76 0.98
3102 3324 9.552114 GCTGAATTCTGCAACATGATATTATAC 57.448 33.333 26.80 0.00 40.06 1.47
3144 3366 9.851686 ATTGAATACCATCTTAGAATACTTGCA 57.148 29.630 0.00 0.00 0.00 4.08
3145 3367 9.679661 TTGAATACCATCTTAGAATACTTGCAA 57.320 29.630 0.00 0.00 0.00 4.08
3146 3368 9.330063 TGAATACCATCTTAGAATACTTGCAAG 57.670 33.333 24.84 24.84 0.00 4.01
3147 3369 9.547753 GAATACCATCTTAGAATACTTGCAAGA 57.452 33.333 32.50 16.27 0.00 3.02
3148 3370 9.905713 AATACCATCTTAGAATACTTGCAAGAA 57.094 29.630 32.50 13.97 0.00 2.52
3149 3371 7.856145 ACCATCTTAGAATACTTGCAAGAAG 57.144 36.000 32.50 22.07 0.00 2.85
3150 3372 7.398024 ACCATCTTAGAATACTTGCAAGAAGT 58.602 34.615 32.50 14.18 0.00 3.01
3151 3373 8.540388 ACCATCTTAGAATACTTGCAAGAAGTA 58.460 33.333 32.50 16.03 37.18 2.24
3152 3374 9.553064 CCATCTTAGAATACTTGCAAGAAGTAT 57.447 33.333 32.50 17.61 43.23 2.12
3155 3377 9.371136 TCTTAGAATACTTGCAAGAAGTATGTG 57.629 33.333 32.50 15.50 41.24 3.21
3156 3378 9.155975 CTTAGAATACTTGCAAGAAGTATGTGT 57.844 33.333 32.50 10.30 41.24 3.72
3158 3380 8.480643 AGAATACTTGCAAGAAGTATGTGTAC 57.519 34.615 32.50 10.50 41.24 2.90
3159 3381 8.094548 AGAATACTTGCAAGAAGTATGTGTACA 58.905 33.333 32.50 0.00 41.24 2.90
3160 3382 8.792830 AATACTTGCAAGAAGTATGTGTACAT 57.207 30.769 32.50 7.53 41.24 2.29
3161 3383 9.884636 AATACTTGCAAGAAGTATGTGTACATA 57.115 29.630 32.50 9.55 41.24 2.29
3163 3385 8.792830 ACTTGCAAGAAGTATGTGTACATATT 57.207 30.769 32.50 0.33 40.53 1.28
3164 3386 9.231297 ACTTGCAAGAAGTATGTGTACATATTT 57.769 29.630 32.50 11.15 40.13 1.40
3165 3387 9.708222 CTTGCAAGAAGTATGTGTACATATTTC 57.292 33.333 22.31 22.41 46.78 2.17
3195 3417 8.288689 TGTAGTTTTTAGAGGAAAATATGCCC 57.711 34.615 0.00 0.00 36.89 5.36
3196 3418 8.113462 TGTAGTTTTTAGAGGAAAATATGCCCT 58.887 33.333 0.00 0.00 36.89 5.19
3197 3419 8.967918 GTAGTTTTTAGAGGAAAATATGCCCTT 58.032 33.333 0.00 0.00 36.89 3.95
3198 3420 8.435931 AGTTTTTAGAGGAAAATATGCCCTTT 57.564 30.769 0.00 0.00 36.89 3.11
3199 3421 8.314021 AGTTTTTAGAGGAAAATATGCCCTTTG 58.686 33.333 0.00 0.00 36.89 2.77
3200 3422 5.852282 TTAGAGGAAAATATGCCCTTTGC 57.148 39.130 0.00 0.00 41.77 3.68
3201 3423 3.033909 AGAGGAAAATATGCCCTTTGCC 58.966 45.455 0.00 0.00 40.16 4.52
3202 3424 2.765699 GAGGAAAATATGCCCTTTGCCA 59.234 45.455 3.38 0.00 40.16 4.92
3203 3425 3.180507 AGGAAAATATGCCCTTTGCCAA 58.819 40.909 3.38 0.00 40.16 4.52
3204 3426 3.055167 AGGAAAATATGCCCTTTGCCAAC 60.055 43.478 3.38 0.00 40.16 3.77
3205 3427 3.270027 GAAAATATGCCCTTTGCCAACC 58.730 45.455 0.00 0.00 40.16 3.77
3206 3428 2.252535 AATATGCCCTTTGCCAACCT 57.747 45.000 0.00 0.00 40.16 3.50
3207 3429 2.252535 ATATGCCCTTTGCCAACCTT 57.747 45.000 0.00 0.00 40.16 3.50
3208 3430 1.265236 TATGCCCTTTGCCAACCTTG 58.735 50.000 0.00 0.00 40.16 3.61
3218 3440 1.358759 CCAACCTTGGTCAACGTGC 59.641 57.895 0.00 0.00 43.43 5.34
3219 3441 1.101049 CCAACCTTGGTCAACGTGCT 61.101 55.000 0.00 0.00 43.43 4.40
3220 3442 0.738389 CAACCTTGGTCAACGTGCTT 59.262 50.000 0.00 0.00 0.00 3.91
3221 3443 0.738389 AACCTTGGTCAACGTGCTTG 59.262 50.000 0.00 0.00 0.00 4.01
3222 3444 0.107410 ACCTTGGTCAACGTGCTTGA 60.107 50.000 0.00 0.00 36.46 3.02
3223 3445 1.021202 CCTTGGTCAACGTGCTTGAA 58.979 50.000 0.00 0.00 40.73 2.69
3224 3446 1.608590 CCTTGGTCAACGTGCTTGAAT 59.391 47.619 0.00 0.00 40.73 2.57
3225 3447 2.034558 CCTTGGTCAACGTGCTTGAATT 59.965 45.455 0.00 0.00 40.73 2.17
3226 3448 2.772568 TGGTCAACGTGCTTGAATTG 57.227 45.000 0.00 0.00 40.73 2.32
3227 3449 2.293170 TGGTCAACGTGCTTGAATTGA 58.707 42.857 0.00 0.00 40.73 2.57
3228 3450 2.290367 TGGTCAACGTGCTTGAATTGAG 59.710 45.455 0.00 0.00 40.73 3.02
3229 3451 2.350772 GGTCAACGTGCTTGAATTGAGG 60.351 50.000 0.00 0.00 40.73 3.86
3230 3452 1.266718 TCAACGTGCTTGAATTGAGGC 59.733 47.619 0.00 0.00 35.84 4.70
3231 3453 1.267806 CAACGTGCTTGAATTGAGGCT 59.732 47.619 0.09 0.00 30.42 4.58
3232 3454 1.609208 ACGTGCTTGAATTGAGGCTT 58.391 45.000 0.09 0.00 0.00 4.35
3233 3455 2.778299 ACGTGCTTGAATTGAGGCTTA 58.222 42.857 0.09 0.00 0.00 3.09
3234 3456 3.347216 ACGTGCTTGAATTGAGGCTTAT 58.653 40.909 0.09 0.00 0.00 1.73
3235 3457 3.127548 ACGTGCTTGAATTGAGGCTTATG 59.872 43.478 0.09 0.00 0.00 1.90
3236 3458 3.374988 CGTGCTTGAATTGAGGCTTATGA 59.625 43.478 0.09 0.00 0.00 2.15
3237 3459 4.666237 GTGCTTGAATTGAGGCTTATGAC 58.334 43.478 0.09 0.00 0.00 3.06
3238 3460 4.156556 GTGCTTGAATTGAGGCTTATGACA 59.843 41.667 0.09 0.00 0.00 3.58
3239 3461 4.156556 TGCTTGAATTGAGGCTTATGACAC 59.843 41.667 0.09 0.00 0.00 3.67
3240 3462 4.156556 GCTTGAATTGAGGCTTATGACACA 59.843 41.667 0.00 0.00 0.00 3.72
3241 3463 5.163581 GCTTGAATTGAGGCTTATGACACAT 60.164 40.000 0.00 0.00 0.00 3.21
3242 3464 6.038603 GCTTGAATTGAGGCTTATGACACATA 59.961 38.462 0.00 0.00 0.00 2.29
3243 3465 7.415541 GCTTGAATTGAGGCTTATGACACATAA 60.416 37.037 0.00 0.00 0.00 1.90
3244 3466 8.523915 TTGAATTGAGGCTTATGACACATAAT 57.476 30.769 0.00 0.00 0.00 1.28
3245 3467 9.625747 TTGAATTGAGGCTTATGACACATAATA 57.374 29.630 0.00 0.00 0.00 0.98
3246 3468 9.625747 TGAATTGAGGCTTATGACACATAATAA 57.374 29.630 0.00 0.00 0.00 1.40
3249 3471 9.797642 ATTGAGGCTTATGACACATAATAATCA 57.202 29.630 0.00 0.00 0.00 2.57
3250 3472 9.797642 TTGAGGCTTATGACACATAATAATCAT 57.202 29.630 0.00 0.00 35.91 2.45
3251 3473 9.797642 TGAGGCTTATGACACATAATAATCATT 57.202 29.630 0.00 0.00 33.84 2.57
3276 3498 9.791820 TTCTGACAAAATTATGATGTTATGCAG 57.208 29.630 0.00 0.00 0.00 4.41
3277 3499 7.916977 TCTGACAAAATTATGATGTTATGCAGC 59.083 33.333 0.00 0.00 0.00 5.25
3278 3500 6.979817 TGACAAAATTATGATGTTATGCAGCC 59.020 34.615 0.00 0.00 31.34 4.85
3279 3501 6.282930 ACAAAATTATGATGTTATGCAGCCC 58.717 36.000 0.00 0.00 31.34 5.19
3280 3502 5.473066 AAATTATGATGTTATGCAGCCCC 57.527 39.130 0.00 0.00 31.34 5.80
3281 3503 3.882102 TTATGATGTTATGCAGCCCCT 57.118 42.857 0.00 0.00 31.34 4.79
3282 3504 1.991121 ATGATGTTATGCAGCCCCTG 58.009 50.000 0.00 0.00 31.34 4.45
3283 3505 0.106569 TGATGTTATGCAGCCCCTGG 60.107 55.000 0.00 0.00 31.34 4.45
3284 3506 0.825010 GATGTTATGCAGCCCCTGGG 60.825 60.000 5.50 5.50 38.57 4.45
3285 3507 1.288508 ATGTTATGCAGCCCCTGGGA 61.289 55.000 16.20 0.00 37.50 4.37
3286 3508 1.306296 GTTATGCAGCCCCTGGGAA 59.694 57.895 16.20 0.00 37.50 3.97
3287 3509 0.324275 GTTATGCAGCCCCTGGGAAA 60.324 55.000 16.20 0.00 37.50 3.13
3288 3510 0.033208 TTATGCAGCCCCTGGGAAAG 60.033 55.000 16.20 3.99 37.50 2.62
3289 3511 1.214305 TATGCAGCCCCTGGGAAAGT 61.214 55.000 16.20 0.00 37.50 2.66
3290 3512 2.677875 GCAGCCCCTGGGAAAGTG 60.678 66.667 16.20 6.76 37.50 3.16
3291 3513 2.036256 CAGCCCCTGGGAAAGTGG 59.964 66.667 16.20 0.00 37.50 4.00
3292 3514 2.121506 AGCCCCTGGGAAAGTGGA 60.122 61.111 16.20 0.00 37.50 4.02
3293 3515 1.778383 AGCCCCTGGGAAAGTGGAA 60.778 57.895 16.20 0.00 37.50 3.53
3294 3516 1.149133 AGCCCCTGGGAAAGTGGAAT 61.149 55.000 16.20 0.00 37.50 3.01
3295 3517 0.252239 GCCCCTGGGAAAGTGGAATT 60.252 55.000 16.20 0.00 37.50 2.17
3296 3518 1.560505 CCCCTGGGAAAGTGGAATTG 58.439 55.000 16.20 0.00 37.50 2.32
3297 3519 1.203174 CCCCTGGGAAAGTGGAATTGT 60.203 52.381 16.20 0.00 37.50 2.71
3298 3520 2.042433 CCCCTGGGAAAGTGGAATTGTA 59.958 50.000 16.20 0.00 37.50 2.41
3299 3521 3.089284 CCCTGGGAAAGTGGAATTGTAC 58.911 50.000 7.01 0.00 0.00 2.90
3300 3522 3.089284 CCTGGGAAAGTGGAATTGTACC 58.911 50.000 0.00 0.00 0.00 3.34
3301 3523 3.499563 CCTGGGAAAGTGGAATTGTACCA 60.500 47.826 0.00 0.00 34.84 3.25
3302 3524 4.148838 CTGGGAAAGTGGAATTGTACCAA 58.851 43.478 0.00 0.00 39.22 3.67
3303 3525 3.892588 TGGGAAAGTGGAATTGTACCAAC 59.107 43.478 0.00 0.00 39.22 3.77
3304 3526 3.257375 GGGAAAGTGGAATTGTACCAACC 59.743 47.826 0.00 0.00 39.22 3.77
3305 3527 4.149598 GGAAAGTGGAATTGTACCAACCT 58.850 43.478 0.00 0.00 39.22 3.50
3306 3528 4.217767 GGAAAGTGGAATTGTACCAACCTC 59.782 45.833 0.00 0.00 39.22 3.85
3307 3529 3.434940 AGTGGAATTGTACCAACCTCC 57.565 47.619 0.00 0.00 39.22 4.30
3308 3530 2.986728 AGTGGAATTGTACCAACCTCCT 59.013 45.455 0.00 0.00 39.22 3.69
3309 3531 3.009143 AGTGGAATTGTACCAACCTCCTC 59.991 47.826 0.00 5.33 39.22 3.71
3310 3532 2.027561 TGGAATTGTACCAACCTCCTCG 60.028 50.000 0.00 0.00 34.25 4.63
3311 3533 2.027469 GGAATTGTACCAACCTCCTCGT 60.027 50.000 0.00 0.00 0.00 4.18
3312 3534 2.762535 ATTGTACCAACCTCCTCGTG 57.237 50.000 0.00 0.00 0.00 4.35
3313 3535 1.707106 TTGTACCAACCTCCTCGTGA 58.293 50.000 0.00 0.00 0.00 4.35
3314 3536 1.933021 TGTACCAACCTCCTCGTGAT 58.067 50.000 0.00 0.00 0.00 3.06
3315 3537 1.822990 TGTACCAACCTCCTCGTGATC 59.177 52.381 0.00 0.00 0.00 2.92
3316 3538 1.100510 TACCAACCTCCTCGTGATCG 58.899 55.000 0.00 0.00 38.55 3.69
3317 3539 0.898789 ACCAACCTCCTCGTGATCGT 60.899 55.000 0.00 0.00 38.33 3.73
3318 3540 0.458543 CCAACCTCCTCGTGATCGTG 60.459 60.000 0.00 0.00 38.33 4.35
3319 3541 0.526211 CAACCTCCTCGTGATCGTGA 59.474 55.000 0.00 0.00 38.33 4.35
3320 3542 1.135139 CAACCTCCTCGTGATCGTGAT 59.865 52.381 0.00 0.00 38.33 3.06
3321 3543 0.741326 ACCTCCTCGTGATCGTGATG 59.259 55.000 0.00 0.00 38.33 3.07
3322 3544 0.741326 CCTCCTCGTGATCGTGATGT 59.259 55.000 0.00 0.00 38.33 3.06
3323 3545 1.268794 CCTCCTCGTGATCGTGATGTC 60.269 57.143 0.00 0.00 38.33 3.06
3324 3546 1.673400 CTCCTCGTGATCGTGATGTCT 59.327 52.381 0.00 0.00 38.33 3.41
3325 3547 2.872858 CTCCTCGTGATCGTGATGTCTA 59.127 50.000 0.00 0.00 38.33 2.59
3326 3548 2.612672 TCCTCGTGATCGTGATGTCTAC 59.387 50.000 0.00 0.00 38.33 2.59
3327 3549 2.600084 CCTCGTGATCGTGATGTCTACG 60.600 54.545 0.00 0.00 42.56 3.51
3336 3558 3.751698 TCGTGATGTCTACGATATGGAGG 59.248 47.826 0.00 0.00 44.65 4.30
3337 3559 3.502595 CGTGATGTCTACGATATGGAGGT 59.497 47.826 0.00 0.00 43.82 3.85
3338 3560 4.694037 CGTGATGTCTACGATATGGAGGTA 59.306 45.833 0.00 0.00 43.82 3.08
3339 3561 5.180680 CGTGATGTCTACGATATGGAGGTAA 59.819 44.000 0.00 0.00 43.82 2.85
3340 3562 6.127980 CGTGATGTCTACGATATGGAGGTAAT 60.128 42.308 0.00 0.00 43.82 1.89
3341 3563 7.575155 CGTGATGTCTACGATATGGAGGTAATT 60.575 40.741 0.00 0.00 43.82 1.40
3342 3564 8.737175 GTGATGTCTACGATATGGAGGTAATTA 58.263 37.037 0.00 0.00 0.00 1.40
3343 3565 8.737175 TGATGTCTACGATATGGAGGTAATTAC 58.263 37.037 7.09 7.09 0.00 1.89
3344 3566 8.880991 ATGTCTACGATATGGAGGTAATTACT 57.119 34.615 15.05 1.79 0.00 2.24
3345 3567 9.970553 ATGTCTACGATATGGAGGTAATTACTA 57.029 33.333 15.05 0.20 0.00 1.82
3346 3568 9.224267 TGTCTACGATATGGAGGTAATTACTAC 57.776 37.037 15.05 9.22 0.00 2.73
3377 3599 8.806429 TCTCATTTAAAATGAACATAGGCTCA 57.194 30.769 0.00 0.00 0.00 4.26
3378 3600 9.412460 TCTCATTTAAAATGAACATAGGCTCAT 57.588 29.630 0.00 0.00 33.66 2.90
3379 3601 9.459640 CTCATTTAAAATGAACATAGGCTCATG 57.540 33.333 0.00 0.00 32.60 3.07
3391 3613 1.590147 GCTCATGGCAGCAAAGCTT 59.410 52.632 0.00 0.00 36.40 3.74
3392 3614 0.037605 GCTCATGGCAGCAAAGCTTT 60.038 50.000 5.69 5.69 36.40 3.51
3394 3616 2.159142 GCTCATGGCAGCAAAGCTTTAT 60.159 45.455 12.25 0.33 36.40 1.40
3395 3617 3.703420 CTCATGGCAGCAAAGCTTTATC 58.297 45.455 12.25 6.94 36.40 1.75
3396 3618 3.359033 TCATGGCAGCAAAGCTTTATCT 58.641 40.909 12.25 9.23 36.40 1.98
3397 3619 3.765511 TCATGGCAGCAAAGCTTTATCTT 59.234 39.130 12.25 0.00 36.40 2.40
3398 3620 3.581024 TGGCAGCAAAGCTTTATCTTG 57.419 42.857 12.25 8.89 36.40 3.02
3399 3621 2.231964 TGGCAGCAAAGCTTTATCTTGG 59.768 45.455 12.25 0.00 36.40 3.61
3400 3622 2.232208 GGCAGCAAAGCTTTATCTTGGT 59.768 45.455 12.25 2.34 36.40 3.67
3401 3623 3.248266 GCAGCAAAGCTTTATCTTGGTG 58.752 45.455 18.47 18.47 36.40 4.17
3402 3624 3.305608 GCAGCAAAGCTTTATCTTGGTGT 60.306 43.478 21.78 0.00 36.40 4.16
3403 3625 4.232221 CAGCAAAGCTTTATCTTGGTGTG 58.768 43.478 12.25 0.00 36.40 3.82
3404 3626 3.891366 AGCAAAGCTTTATCTTGGTGTGT 59.109 39.130 12.25 0.00 33.89 3.72
3405 3627 4.342092 AGCAAAGCTTTATCTTGGTGTGTT 59.658 37.500 12.25 0.00 33.89 3.32
3406 3628 4.681483 GCAAAGCTTTATCTTGGTGTGTTC 59.319 41.667 12.25 0.00 0.00 3.18
3407 3629 5.507985 GCAAAGCTTTATCTTGGTGTGTTCT 60.508 40.000 12.25 0.00 0.00 3.01
3413 3635 8.860088 AGCTTTATCTTGGTGTGTTCTTTTTAT 58.140 29.630 0.00 0.00 0.00 1.40
3417 3639 7.713764 ATCTTGGTGTGTTCTTTTTATTTGC 57.286 32.000 0.00 0.00 0.00 3.68
3418 3640 6.634805 TCTTGGTGTGTTCTTTTTATTTGCA 58.365 32.000 0.00 0.00 0.00 4.08
3419 3641 6.756074 TCTTGGTGTGTTCTTTTTATTTGCAG 59.244 34.615 0.00 0.00 0.00 4.41
3420 3642 4.808364 TGGTGTGTTCTTTTTATTTGCAGC 59.192 37.500 0.00 0.00 0.00 5.25
3422 3644 5.523552 GGTGTGTTCTTTTTATTTGCAGCTT 59.476 36.000 0.00 0.00 0.00 3.74
3423 3645 6.413269 GTGTGTTCTTTTTATTTGCAGCTTG 58.587 36.000 0.00 0.00 0.00 4.01
3424 3646 5.006552 TGTGTTCTTTTTATTTGCAGCTTGC 59.993 36.000 0.00 1.70 45.29 4.01
3425 3647 5.234972 GTGTTCTTTTTATTTGCAGCTTGCT 59.765 36.000 9.12 0.00 45.31 3.91
3426 3648 5.234757 TGTTCTTTTTATTTGCAGCTTGCTG 59.765 36.000 17.34 17.34 45.31 4.41
3428 3650 4.984161 TCTTTTTATTTGCAGCTTGCTGTC 59.016 37.500 21.55 14.82 45.31 3.51
3430 3652 1.176527 TATTTGCAGCTTGCTGTCCC 58.823 50.000 21.55 7.89 45.31 4.46
3431 3653 1.538687 ATTTGCAGCTTGCTGTCCCC 61.539 55.000 21.55 7.57 45.31 4.81
3432 3654 2.925416 TTTGCAGCTTGCTGTCCCCA 62.925 55.000 21.55 9.87 45.31 4.96
3433 3655 2.362120 GCAGCTTGCTGTCCCCAT 60.362 61.111 21.55 0.00 40.96 4.00
3434 3656 2.707849 GCAGCTTGCTGTCCCCATG 61.708 63.158 21.55 0.00 40.96 3.66
3435 3657 2.362120 AGCTTGCTGTCCCCATGC 60.362 61.111 0.00 0.00 34.62 4.06
3436 3658 3.455469 GCTTGCTGTCCCCATGCC 61.455 66.667 0.00 0.00 0.00 4.40
3437 3659 2.357836 CTTGCTGTCCCCATGCCT 59.642 61.111 0.00 0.00 0.00 4.75
3439 3661 1.601419 CTTGCTGTCCCCATGCCTTG 61.601 60.000 0.00 0.00 0.00 3.61
3451 3673 2.181975 CATGCCTTGGACCAATCCTTT 58.818 47.619 7.54 0.00 46.43 3.11
3452 3674 2.397044 TGCCTTGGACCAATCCTTTT 57.603 45.000 7.54 0.00 46.43 2.27
3453 3675 2.247358 TGCCTTGGACCAATCCTTTTC 58.753 47.619 7.54 0.00 46.43 2.29
3455 3677 2.179427 CCTTGGACCAATCCTTTTCCC 58.821 52.381 7.54 0.00 46.43 3.97
3456 3678 1.818674 CTTGGACCAATCCTTTTCCCG 59.181 52.381 7.54 0.00 46.43 5.14
3459 3681 2.375845 TGGACCAATCCTTTTCCCGTAA 59.624 45.455 0.00 0.00 46.43 3.18
3460 3682 3.014623 GGACCAATCCTTTTCCCGTAAG 58.985 50.000 0.00 0.00 42.45 2.34
3461 3683 3.307904 GGACCAATCCTTTTCCCGTAAGA 60.308 47.826 0.00 0.00 42.45 2.10
3462 3684 4.524053 GACCAATCCTTTTCCCGTAAGAT 58.476 43.478 0.00 0.00 43.02 2.40
3463 3685 4.930696 ACCAATCCTTTTCCCGTAAGATT 58.069 39.130 0.00 0.00 43.02 2.40
3464 3686 5.330233 ACCAATCCTTTTCCCGTAAGATTT 58.670 37.500 0.00 0.00 43.02 2.17
3465 3687 5.185056 ACCAATCCTTTTCCCGTAAGATTTG 59.815 40.000 0.00 0.00 43.02 2.32
3466 3688 5.417580 CCAATCCTTTTCCCGTAAGATTTGA 59.582 40.000 0.00 0.00 43.02 2.69
3467 3689 6.071616 CCAATCCTTTTCCCGTAAGATTTGAA 60.072 38.462 0.00 0.00 43.02 2.69
3468 3690 5.952526 TCCTTTTCCCGTAAGATTTGAAC 57.047 39.130 0.00 0.00 43.02 3.18
3469 3691 4.763279 TCCTTTTCCCGTAAGATTTGAACC 59.237 41.667 0.00 0.00 43.02 3.62
3470 3692 4.765339 CCTTTTCCCGTAAGATTTGAACCT 59.235 41.667 0.00 0.00 43.02 3.50
3471 3693 5.106277 CCTTTTCCCGTAAGATTTGAACCTC 60.106 44.000 0.00 0.00 43.02 3.85
3472 3694 3.241067 TCCCGTAAGATTTGAACCTCG 57.759 47.619 0.00 0.00 43.02 4.63
3473 3695 2.093869 TCCCGTAAGATTTGAACCTCGG 60.094 50.000 0.00 0.00 43.02 4.63
3474 3696 2.093869 CCCGTAAGATTTGAACCTCGGA 60.094 50.000 0.00 0.00 39.17 4.55
3475 3697 3.592059 CCGTAAGATTTGAACCTCGGAA 58.408 45.455 0.00 0.00 39.17 4.30
3476 3698 3.998341 CCGTAAGATTTGAACCTCGGAAA 59.002 43.478 0.00 0.00 39.17 3.13
3477 3699 4.453136 CCGTAAGATTTGAACCTCGGAAAA 59.547 41.667 0.00 0.00 39.17 2.29
3478 3700 5.123344 CCGTAAGATTTGAACCTCGGAAAAT 59.877 40.000 0.00 0.00 39.17 1.82
3479 3701 6.021596 CGTAAGATTTGAACCTCGGAAAATG 58.978 40.000 0.00 0.00 43.02 2.32
3480 3702 5.391312 AAGATTTGAACCTCGGAAAATGG 57.609 39.130 0.00 0.00 0.00 3.16
3481 3703 3.193479 AGATTTGAACCTCGGAAAATGGC 59.807 43.478 0.00 0.00 0.00 4.40
3482 3704 2.286365 TTGAACCTCGGAAAATGGCT 57.714 45.000 0.00 0.00 0.00 4.75
3483 3705 1.533625 TGAACCTCGGAAAATGGCTG 58.466 50.000 0.00 0.00 0.00 4.85
3484 3706 0.811281 GAACCTCGGAAAATGGCTGG 59.189 55.000 0.00 0.00 0.00 4.85
3485 3707 1.250840 AACCTCGGAAAATGGCTGGC 61.251 55.000 0.00 0.00 0.00 4.85
3486 3708 2.764314 CCTCGGAAAATGGCTGGCG 61.764 63.158 0.00 0.00 0.00 5.69
3487 3709 1.745115 CTCGGAAAATGGCTGGCGA 60.745 57.895 0.00 0.00 0.00 5.54
3488 3710 1.077787 TCGGAAAATGGCTGGCGAT 60.078 52.632 0.00 0.00 0.00 4.58
3489 3711 1.095228 TCGGAAAATGGCTGGCGATC 61.095 55.000 0.00 0.00 0.00 3.69
3490 3712 1.735973 GGAAAATGGCTGGCGATCC 59.264 57.895 0.00 0.00 0.00 3.36
3491 3713 1.356624 GAAAATGGCTGGCGATCCG 59.643 57.895 0.00 0.00 34.14 4.18
3492 3714 2.063541 GAAAATGGCTGGCGATCCGG 62.064 60.000 0.00 0.00 41.86 5.14
3493 3715 2.837031 AAAATGGCTGGCGATCCGGT 62.837 55.000 0.00 0.00 40.99 5.28
3494 3716 4.552365 ATGGCTGGCGATCCGGTG 62.552 66.667 0.00 0.00 40.99 4.94
3506 3728 4.910585 CCGGTGCGGCCCATCTAC 62.911 72.222 0.00 0.00 41.17 2.59
3507 3729 4.910585 CGGTGCGGCCCATCTACC 62.911 72.222 0.00 0.00 0.00 3.18
3508 3730 4.564110 GGTGCGGCCCATCTACCC 62.564 72.222 0.00 0.00 0.00 3.69
3509 3731 3.792736 GTGCGGCCCATCTACCCA 61.793 66.667 0.00 0.00 0.00 4.51
3510 3732 3.479203 TGCGGCCCATCTACCCAG 61.479 66.667 0.00 0.00 0.00 4.45
3511 3733 3.161450 GCGGCCCATCTACCCAGA 61.161 66.667 0.00 0.00 34.56 3.86
3512 3734 2.742116 GCGGCCCATCTACCCAGAA 61.742 63.158 0.00 0.00 33.50 3.02
3513 3735 1.912220 CGGCCCATCTACCCAGAAA 59.088 57.895 0.00 0.00 33.50 2.52
3514 3736 0.254747 CGGCCCATCTACCCAGAAAA 59.745 55.000 0.00 0.00 33.50 2.29
3515 3737 1.340600 CGGCCCATCTACCCAGAAAAA 60.341 52.381 0.00 0.00 33.50 1.94
3516 3738 2.379005 GGCCCATCTACCCAGAAAAAG 58.621 52.381 0.00 0.00 33.50 2.27
3517 3739 1.751351 GCCCATCTACCCAGAAAAAGC 59.249 52.381 0.00 0.00 33.50 3.51
3518 3740 2.621668 GCCCATCTACCCAGAAAAAGCT 60.622 50.000 0.00 0.00 33.50 3.74
3519 3741 3.282885 CCCATCTACCCAGAAAAAGCTC 58.717 50.000 0.00 0.00 33.50 4.09
3520 3742 3.308402 CCCATCTACCCAGAAAAAGCTCA 60.308 47.826 0.00 0.00 33.50 4.26
3521 3743 3.944015 CCATCTACCCAGAAAAAGCTCAG 59.056 47.826 0.00 0.00 33.50 3.35
3522 3744 3.059352 TCTACCCAGAAAAAGCTCAGC 57.941 47.619 0.00 0.00 0.00 4.26
3523 3745 2.087646 CTACCCAGAAAAAGCTCAGCC 58.912 52.381 0.00 0.00 0.00 4.85
3524 3746 0.185901 ACCCAGAAAAAGCTCAGCCA 59.814 50.000 0.00 0.00 0.00 4.75
3525 3747 1.331214 CCCAGAAAAAGCTCAGCCAA 58.669 50.000 0.00 0.00 0.00 4.52
3526 3748 1.688197 CCCAGAAAAAGCTCAGCCAAA 59.312 47.619 0.00 0.00 0.00 3.28
3527 3749 2.301009 CCCAGAAAAAGCTCAGCCAAAT 59.699 45.455 0.00 0.00 0.00 2.32
3528 3750 3.582780 CCAGAAAAAGCTCAGCCAAATC 58.417 45.455 0.00 0.00 0.00 2.17
3529 3751 3.582780 CAGAAAAAGCTCAGCCAAATCC 58.417 45.455 0.00 0.00 0.00 3.01
3530 3752 3.257624 CAGAAAAAGCTCAGCCAAATCCT 59.742 43.478 0.00 0.00 0.00 3.24
3531 3753 3.509184 AGAAAAAGCTCAGCCAAATCCTC 59.491 43.478 0.00 0.00 0.00 3.71
3532 3754 1.844687 AAAGCTCAGCCAAATCCTCC 58.155 50.000 0.00 0.00 0.00 4.30
3533 3755 0.700564 AAGCTCAGCCAAATCCTCCA 59.299 50.000 0.00 0.00 0.00 3.86
3534 3756 0.924823 AGCTCAGCCAAATCCTCCAT 59.075 50.000 0.00 0.00 0.00 3.41
3535 3757 1.287146 AGCTCAGCCAAATCCTCCATT 59.713 47.619 0.00 0.00 0.00 3.16
3536 3758 2.511218 AGCTCAGCCAAATCCTCCATTA 59.489 45.455 0.00 0.00 0.00 1.90
3537 3759 3.139770 AGCTCAGCCAAATCCTCCATTAT 59.860 43.478 0.00 0.00 0.00 1.28
3538 3760 3.505293 GCTCAGCCAAATCCTCCATTATC 59.495 47.826 0.00 0.00 0.00 1.75
3539 3761 3.743521 TCAGCCAAATCCTCCATTATCG 58.256 45.455 0.00 0.00 0.00 2.92
3540 3762 3.390967 TCAGCCAAATCCTCCATTATCGA 59.609 43.478 0.00 0.00 0.00 3.59
3541 3763 4.136796 CAGCCAAATCCTCCATTATCGAA 58.863 43.478 0.00 0.00 0.00 3.71
3542 3764 4.214971 CAGCCAAATCCTCCATTATCGAAG 59.785 45.833 0.00 0.00 0.00 3.79
3543 3765 3.057946 GCCAAATCCTCCATTATCGAAGC 60.058 47.826 0.00 0.00 0.00 3.86
3544 3766 3.503748 CCAAATCCTCCATTATCGAAGCC 59.496 47.826 0.00 0.00 0.00 4.35
3545 3767 4.392940 CAAATCCTCCATTATCGAAGCCT 58.607 43.478 0.00 0.00 0.00 4.58
3546 3768 3.971245 ATCCTCCATTATCGAAGCCTC 57.029 47.619 0.00 0.00 0.00 4.70
3547 3769 1.971357 TCCTCCATTATCGAAGCCTCC 59.029 52.381 0.00 0.00 0.00 4.30
3548 3770 1.974236 CCTCCATTATCGAAGCCTCCT 59.026 52.381 0.00 0.00 0.00 3.69
3549 3771 2.370189 CCTCCATTATCGAAGCCTCCTT 59.630 50.000 0.00 0.00 0.00 3.36
3550 3772 3.181450 CCTCCATTATCGAAGCCTCCTTT 60.181 47.826 0.00 0.00 0.00 3.11
3551 3773 4.061596 CTCCATTATCGAAGCCTCCTTTC 58.938 47.826 0.00 0.00 0.00 2.62
3555 3777 0.179097 ATCGAAGCCTCCTTTCGCTC 60.179 55.000 0.00 0.00 33.09 5.03
3563 3785 1.139853 CCTCCTTTCGCTCAGCCTATT 59.860 52.381 0.00 0.00 0.00 1.73
3576 3798 3.021451 CCTATTTGGCCGGATCCAC 57.979 57.895 13.41 2.51 35.50 4.02
3577 3799 0.537371 CCTATTTGGCCGGATCCACC 60.537 60.000 13.41 13.17 35.50 4.61
3580 3802 0.468029 ATTTGGCCGGATCCACCATC 60.468 55.000 21.19 3.02 38.90 3.51
3581 3803 1.857638 TTTGGCCGGATCCACCATCA 61.858 55.000 21.19 10.63 38.90 3.07
3582 3804 2.203209 GGCCGGATCCACCATCAC 60.203 66.667 13.41 0.00 38.90 3.06
3584 3806 2.900273 CCGGATCCACCATCACGT 59.100 61.111 13.41 0.00 38.90 4.49
3586 3808 1.515487 CGGATCCACCATCACGTGA 59.485 57.895 22.48 22.48 38.90 4.35
3588 3810 0.462047 GGATCCACCATCACGTGACC 60.462 60.000 22.71 11.18 35.68 4.02
3589 3811 0.249120 GATCCACCATCACGTGACCA 59.751 55.000 22.71 0.00 35.68 4.02
3590 3812 0.911769 ATCCACCATCACGTGACCAT 59.088 50.000 22.71 5.88 35.68 3.55
3591 3813 0.690192 TCCACCATCACGTGACCATT 59.310 50.000 22.71 1.02 35.68 3.16
3592 3814 1.073125 TCCACCATCACGTGACCATTT 59.927 47.619 22.71 0.56 35.68 2.32
3595 3817 2.749076 CACCATCACGTGACCATTTCAT 59.251 45.455 22.71 0.00 36.32 2.57
3596 3818 3.009723 ACCATCACGTGACCATTTCATC 58.990 45.455 22.71 0.00 36.32 2.92
3598 3820 3.439825 CCATCACGTGACCATTTCATCAA 59.560 43.478 22.71 0.00 36.32 2.57
3600 3822 3.738982 TCACGTGACCATTTCATCAAGT 58.261 40.909 15.76 0.00 37.94 3.16
3602 3824 4.688879 TCACGTGACCATTTCATCAAGTAC 59.311 41.667 15.76 0.00 35.71 2.73
3603 3825 4.690748 CACGTGACCATTTCATCAAGTACT 59.309 41.667 10.90 0.00 35.71 2.73
3604 3826 5.867174 CACGTGACCATTTCATCAAGTACTA 59.133 40.000 10.90 0.00 35.71 1.82
3605 3827 5.867716 ACGTGACCATTTCATCAAGTACTAC 59.132 40.000 0.00 0.00 36.06 2.73
3606 3828 5.867174 CGTGACCATTTCATCAAGTACTACA 59.133 40.000 0.00 0.00 36.32 2.74
3607 3829 6.535150 CGTGACCATTTCATCAAGTACTACAT 59.465 38.462 0.00 0.00 36.32 2.29
3608 3830 7.464577 CGTGACCATTTCATCAAGTACTACATG 60.465 40.741 0.00 1.55 36.32 3.21
3609 3831 7.549134 GTGACCATTTCATCAAGTACTACATGA 59.451 37.037 11.09 11.09 36.32 3.07
3611 3833 6.823689 ACCATTTCATCAAGTACTACATGACC 59.176 38.462 13.72 0.00 27.90 4.02
3614 3836 7.667043 TTTCATCAAGTACTACATGACCAAC 57.333 36.000 13.72 0.00 27.90 3.77
3615 3837 5.407502 TCATCAAGTACTACATGACCAACG 58.592 41.667 11.09 0.00 27.90 4.10
3616 3838 4.859304 TCAAGTACTACATGACCAACGT 57.141 40.909 0.00 0.00 0.00 3.99
3617 3839 4.801891 TCAAGTACTACATGACCAACGTC 58.198 43.478 0.00 0.00 39.66 4.34
3619 3841 2.494870 AGTACTACATGACCAACGTCCC 59.505 50.000 0.00 0.00 38.32 4.46
3620 3842 0.245539 ACTACATGACCAACGTCCCG 59.754 55.000 0.00 0.00 38.32 5.14
3622 3844 0.899253 TACATGACCAACGTCCCGGA 60.899 55.000 0.73 0.00 38.32 5.14
3623 3845 1.004320 CATGACCAACGTCCCGGAA 60.004 57.895 0.73 0.00 38.32 4.30
3625 3847 2.357881 GACCAACGTCCCGGAACC 60.358 66.667 0.73 0.00 32.40 3.62
3626 3848 3.162858 ACCAACGTCCCGGAACCA 61.163 61.111 0.73 0.00 0.00 3.67
3627 3849 2.358247 CCAACGTCCCGGAACCAG 60.358 66.667 0.73 0.00 0.00 4.00
3628 3850 2.738480 CAACGTCCCGGAACCAGA 59.262 61.111 0.73 0.00 0.00 3.86
3629 3851 1.295423 CAACGTCCCGGAACCAGAT 59.705 57.895 0.73 0.00 0.00 2.90
3630 3852 0.739813 CAACGTCCCGGAACCAGATC 60.740 60.000 0.73 0.00 0.00 2.75
3632 3854 2.058595 CGTCCCGGAACCAGATCCT 61.059 63.158 0.73 0.00 37.34 3.24
3634 3856 0.178301 GTCCCGGAACCAGATCCTTC 59.822 60.000 0.73 0.00 37.34 3.46
3635 3857 0.042731 TCCCGGAACCAGATCCTTCT 59.957 55.000 0.73 0.00 37.34 2.85
3636 3858 1.289830 TCCCGGAACCAGATCCTTCTA 59.710 52.381 0.73 0.00 37.34 2.10
3638 3860 2.108168 CCGGAACCAGATCCTTCTACA 58.892 52.381 0.00 0.00 37.34 2.74
3639 3861 2.700897 CCGGAACCAGATCCTTCTACAT 59.299 50.000 0.00 0.00 37.34 2.29
3640 3862 3.493350 CCGGAACCAGATCCTTCTACATG 60.493 52.174 0.00 0.00 37.34 3.21
3641 3863 3.384789 CGGAACCAGATCCTTCTACATGA 59.615 47.826 0.00 0.00 37.34 3.07
3643 3865 4.443598 GGAACCAGATCCTTCTACATGACC 60.444 50.000 0.00 0.00 36.50 4.02
3644 3866 3.724478 ACCAGATCCTTCTACATGACCA 58.276 45.455 0.00 0.00 0.00 4.02
3645 3867 4.104086 ACCAGATCCTTCTACATGACCAA 58.896 43.478 0.00 0.00 0.00 3.67
3646 3868 4.080863 ACCAGATCCTTCTACATGACCAAC 60.081 45.833 0.00 0.00 0.00 3.77
3647 3869 4.163078 CCAGATCCTTCTACATGACCAACT 59.837 45.833 0.00 0.00 0.00 3.16
3648 3870 5.338708 CCAGATCCTTCTACATGACCAACTT 60.339 44.000 0.00 0.00 0.00 2.66
3649 3871 5.583854 CAGATCCTTCTACATGACCAACTTG 59.416 44.000 0.00 0.00 0.00 3.16
3650 3872 3.674997 TCCTTCTACATGACCAACTTGC 58.325 45.455 0.00 0.00 0.00 4.01
3652 3874 3.560025 CCTTCTACATGACCAACTTGCCT 60.560 47.826 0.00 0.00 0.00 4.75
3653 3875 3.788227 TCTACATGACCAACTTGCCTT 57.212 42.857 0.00 0.00 0.00 4.35
3654 3876 3.674997 TCTACATGACCAACTTGCCTTC 58.325 45.455 0.00 0.00 0.00 3.46
3655 3877 2.664402 ACATGACCAACTTGCCTTCT 57.336 45.000 0.00 0.00 0.00 2.85
3656 3878 3.788227 ACATGACCAACTTGCCTTCTA 57.212 42.857 0.00 0.00 0.00 2.10
3657 3879 3.412386 ACATGACCAACTTGCCTTCTAC 58.588 45.455 0.00 0.00 0.00 2.59
3658 3880 3.181445 ACATGACCAACTTGCCTTCTACA 60.181 43.478 0.00 0.00 0.00 2.74
3661 3883 3.820467 TGACCAACTTGCCTTCTACATTG 59.180 43.478 0.00 0.00 0.00 2.82
3662 3884 2.558359 ACCAACTTGCCTTCTACATTGC 59.442 45.455 0.00 0.00 0.00 3.56
3664 3886 3.366679 CCAACTTGCCTTCTACATTGCTG 60.367 47.826 0.00 0.00 0.00 4.41
3667 3889 3.755378 ACTTGCCTTCTACATTGCTGAAG 59.245 43.478 10.50 10.50 37.51 3.02
3673 3895 5.091261 CTTCTACATTGCTGAAGGGTACT 57.909 43.478 9.89 0.00 35.04 2.73
3675 3897 6.808321 TTCTACATTGCTGAAGGGTACTAT 57.192 37.500 0.00 0.00 0.00 2.12
3676 3898 6.161855 TCTACATTGCTGAAGGGTACTATG 57.838 41.667 0.00 0.00 0.00 2.23
3677 3899 4.844349 ACATTGCTGAAGGGTACTATGT 57.156 40.909 0.00 0.00 0.00 2.29
3678 3900 5.950544 ACATTGCTGAAGGGTACTATGTA 57.049 39.130 0.00 0.00 0.00 2.29
3679 3901 5.918608 ACATTGCTGAAGGGTACTATGTAG 58.081 41.667 0.00 0.00 0.00 2.74
3680 3902 5.425539 ACATTGCTGAAGGGTACTATGTAGT 59.574 40.000 0.00 0.00 40.24 2.73
3681 3903 6.610020 ACATTGCTGAAGGGTACTATGTAGTA 59.390 38.462 0.00 0.00 37.73 1.82
3682 3904 7.290248 ACATTGCTGAAGGGTACTATGTAGTAT 59.710 37.037 3.44 0.00 40.55 2.12
3684 3906 5.538813 TGCTGAAGGGTACTATGTAGTATGG 59.461 44.000 3.44 0.00 40.55 2.74
3685 3907 5.773680 GCTGAAGGGTACTATGTAGTATGGA 59.226 44.000 3.44 0.00 40.55 3.41
3687 3909 7.577807 GCTGAAGGGTACTATGTAGTATGGATG 60.578 44.444 3.44 0.00 40.55 3.51
3689 3911 7.670140 TGAAGGGTACTATGTAGTATGGATGAG 59.330 40.741 3.44 0.00 40.55 2.90
3690 3912 7.104974 AGGGTACTATGTAGTATGGATGAGT 57.895 40.000 3.44 0.00 40.55 3.41
3692 3914 7.670559 AGGGTACTATGTAGTATGGATGAGTTC 59.329 40.741 3.44 0.00 40.55 3.01
3694 3916 7.174599 GGTACTATGTAGTATGGATGAGTTCGT 59.825 40.741 3.44 0.00 40.55 3.85
3696 3918 8.008513 ACTATGTAGTATGGATGAGTTCGTTT 57.991 34.615 0.00 0.00 34.13 3.60
3697 3919 8.475639 ACTATGTAGTATGGATGAGTTCGTTTT 58.524 33.333 0.00 0.00 34.13 2.43
3698 3920 9.314321 CTATGTAGTATGGATGAGTTCGTTTTT 57.686 33.333 0.00 0.00 0.00 1.94
3717 3939 2.818130 TTTGCCATGAACTTGCCTTC 57.182 45.000 0.00 0.00 0.00 3.46
3718 3940 1.702182 TTGCCATGAACTTGCCTTCA 58.298 45.000 0.00 0.00 34.65 3.02
3719 3941 1.927487 TGCCATGAACTTGCCTTCAT 58.073 45.000 0.00 0.00 40.81 2.57
3720 3942 3.084536 TGCCATGAACTTGCCTTCATA 57.915 42.857 0.00 0.00 38.57 2.15
3722 3944 3.193267 TGCCATGAACTTGCCTTCATAAC 59.807 43.478 0.00 0.00 38.57 1.89
3723 3945 3.429410 GCCATGAACTTGCCTTCATAACC 60.429 47.826 0.00 0.00 38.57 2.85
3724 3946 3.763360 CCATGAACTTGCCTTCATAACCA 59.237 43.478 0.00 0.00 38.57 3.67
3725 3947 4.220382 CCATGAACTTGCCTTCATAACCAA 59.780 41.667 0.00 0.00 38.57 3.67
3726 3948 4.846779 TGAACTTGCCTTCATAACCAAC 57.153 40.909 0.00 0.00 0.00 3.77
3729 3951 6.245408 TGAACTTGCCTTCATAACCAACTAT 58.755 36.000 0.00 0.00 0.00 2.12
3730 3952 6.719370 TGAACTTGCCTTCATAACCAACTATT 59.281 34.615 0.00 0.00 0.00 1.73
3731 3953 6.759497 ACTTGCCTTCATAACCAACTATTC 57.241 37.500 0.00 0.00 0.00 1.75
3732 3954 6.245408 ACTTGCCTTCATAACCAACTATTCA 58.755 36.000 0.00 0.00 0.00 2.57
3733 3955 6.891908 ACTTGCCTTCATAACCAACTATTCAT 59.108 34.615 0.00 0.00 0.00 2.57
3735 3957 8.815565 TTGCCTTCATAACCAACTATTCATTA 57.184 30.769 0.00 0.00 0.00 1.90
3736 3958 8.220755 TGCCTTCATAACCAACTATTCATTAC 57.779 34.615 0.00 0.00 0.00 1.89
3737 3959 8.052748 TGCCTTCATAACCAACTATTCATTACT 58.947 33.333 0.00 0.00 0.00 2.24
3738 3960 8.345565 GCCTTCATAACCAACTATTCATTACTG 58.654 37.037 0.00 0.00 0.00 2.74
3742 3964 9.733556 TCATAACCAACTATTCATTACTGTTGT 57.266 29.630 0.00 0.00 37.04 3.32
3743 3965 9.773328 CATAACCAACTATTCATTACTGTTGTG 57.227 33.333 0.00 0.00 37.04 3.33
3744 3966 6.817765 ACCAACTATTCATTACTGTTGTGG 57.182 37.500 0.00 0.00 37.04 4.17
3746 3968 6.430000 ACCAACTATTCATTACTGTTGTGGTC 59.570 38.462 0.00 0.00 37.04 4.02
3747 3969 6.429692 CCAACTATTCATTACTGTTGTGGTCA 59.570 38.462 0.00 0.00 37.04 4.02
3748 3970 7.361201 CCAACTATTCATTACTGTTGTGGTCAG 60.361 40.741 0.00 0.00 37.04 3.51
3749 3971 6.769512 ACTATTCATTACTGTTGTGGTCAGT 58.230 36.000 4.11 4.11 46.10 3.41
3750 3972 7.903145 ACTATTCATTACTGTTGTGGTCAGTA 58.097 34.615 2.29 2.29 43.17 2.74
3754 3976 2.973694 ACTGTTGTGGTCAGTAACGT 57.026 45.000 0.00 0.00 43.17 3.99
3756 3978 3.973657 ACTGTTGTGGTCAGTAACGTAG 58.026 45.455 0.00 0.00 43.17 3.51
3757 3979 3.382546 ACTGTTGTGGTCAGTAACGTAGT 59.617 43.478 0.00 0.00 43.17 2.73
3758 3980 4.580167 ACTGTTGTGGTCAGTAACGTAGTA 59.420 41.667 0.00 0.00 43.17 1.82
3759 3981 5.242393 ACTGTTGTGGTCAGTAACGTAGTAT 59.758 40.000 0.00 0.00 43.17 2.12
3762 3984 6.654582 TGTTGTGGTCAGTAACGTAGTATAGA 59.345 38.462 0.00 0.00 45.00 1.98
3763 3985 6.668541 TGTGGTCAGTAACGTAGTATAGAC 57.331 41.667 0.00 0.00 45.00 2.59
3765 3987 6.314648 TGTGGTCAGTAACGTAGTATAGACTG 59.685 42.308 0.00 0.00 45.00 3.51
3766 3988 6.314896 GTGGTCAGTAACGTAGTATAGACTGT 59.685 42.308 0.00 0.00 45.00 3.55
3768 3990 8.040727 TGGTCAGTAACGTAGTATAGACTGTTA 58.959 37.037 0.00 0.00 45.00 2.41
3769 3991 8.883731 GGTCAGTAACGTAGTATAGACTGTTAA 58.116 37.037 0.00 0.00 45.00 2.01
3778 4000 8.257841 CGTAGTATAGACTGTTAATTTTGCGAC 58.742 37.037 0.00 0.00 36.28 5.19
3780 4002 8.186178 AGTATAGACTGTTAATTTTGCGACAG 57.814 34.615 0.00 0.00 43.81 3.51
3787 4009 5.826586 TGTTAATTTTGCGACAGTGTTGAT 58.173 33.333 15.07 0.00 0.00 2.57
3789 4011 6.754209 TGTTAATTTTGCGACAGTGTTGATTT 59.246 30.769 15.07 2.62 0.00 2.17
3791 4013 8.911662 GTTAATTTTGCGACAGTGTTGATTTAT 58.088 29.630 15.07 0.00 0.00 1.40
3792 4014 6.932901 ATTTTGCGACAGTGTTGATTTATG 57.067 33.333 15.07 0.00 0.00 1.90
3794 4016 4.661993 TGCGACAGTGTTGATTTATGAC 57.338 40.909 15.07 0.00 0.00 3.06
3795 4017 4.061596 TGCGACAGTGTTGATTTATGACA 58.938 39.130 15.07 0.00 0.00 3.58
3796 4018 4.152223 TGCGACAGTGTTGATTTATGACAG 59.848 41.667 15.07 0.00 0.00 3.51
3797 4019 4.388773 GCGACAGTGTTGATTTATGACAGA 59.611 41.667 15.07 0.00 0.00 3.41
3798 4020 5.063944 GCGACAGTGTTGATTTATGACAGAT 59.936 40.000 15.07 0.00 0.00 2.90
3800 4022 7.521529 CGACAGTGTTGATTTATGACAGATTT 58.478 34.615 4.29 0.00 0.00 2.17
3801 4023 7.479603 CGACAGTGTTGATTTATGACAGATTTG 59.520 37.037 4.29 0.00 0.00 2.32
3802 4024 8.169977 ACAGTGTTGATTTATGACAGATTTGT 57.830 30.769 0.00 0.00 41.18 2.83
3803 4025 8.077991 ACAGTGTTGATTTATGACAGATTTGTG 58.922 33.333 0.00 0.00 37.76 3.33
3805 4027 6.808212 GTGTTGATTTATGACAGATTTGTGGG 59.192 38.462 0.00 0.00 37.76 4.61
3806 4028 6.718912 TGTTGATTTATGACAGATTTGTGGGA 59.281 34.615 0.00 0.00 37.76 4.37
3807 4029 7.396907 TGTTGATTTATGACAGATTTGTGGGAT 59.603 33.333 0.00 0.00 37.76 3.85
3811 4033 9.736023 GATTTATGACAGATTTGTGGGATAAAC 57.264 33.333 0.00 0.00 37.76 2.01
3812 4034 7.639113 TTATGACAGATTTGTGGGATAAACC 57.361 36.000 0.00 0.00 37.76 3.27
3829 4051 8.122472 GGATAAACCCCCTTCATTTATGTATG 57.878 38.462 0.00 0.00 30.50 2.39
3830 4052 7.728532 GGATAAACCCCCTTCATTTATGTATGT 59.271 37.037 0.00 0.00 30.50 2.29
3832 4054 7.891498 AAACCCCCTTCATTTATGTATGTAC 57.109 36.000 0.00 0.00 0.00 2.90
3833 4055 6.841781 ACCCCCTTCATTTATGTATGTACT 57.158 37.500 0.00 0.00 0.00 2.73
3834 4056 6.601332 ACCCCCTTCATTTATGTATGTACTG 58.399 40.000 0.00 0.00 0.00 2.74
3835 4057 6.003950 CCCCCTTCATTTATGTATGTACTGG 58.996 44.000 0.00 0.00 0.00 4.00
3836 4058 6.410388 CCCCCTTCATTTATGTATGTACTGGT 60.410 42.308 0.00 0.00 0.00 4.00
3837 4059 6.710744 CCCCTTCATTTATGTATGTACTGGTC 59.289 42.308 0.00 0.00 0.00 4.02
3838 4060 6.710744 CCCTTCATTTATGTATGTACTGGTCC 59.289 42.308 0.00 0.00 0.00 4.46
3840 4062 7.773224 CCTTCATTTATGTATGTACTGGTCCAA 59.227 37.037 0.00 0.00 0.00 3.53
3843 4065 5.685520 TTATGTATGTACTGGTCCAAGCA 57.314 39.130 0.00 0.00 0.00 3.91
3844 4066 4.568072 ATGTATGTACTGGTCCAAGCAA 57.432 40.909 0.00 0.00 0.00 3.91
3845 4067 4.359434 TGTATGTACTGGTCCAAGCAAA 57.641 40.909 0.00 0.00 0.00 3.68
3846 4068 4.720046 TGTATGTACTGGTCCAAGCAAAA 58.280 39.130 0.00 0.00 0.00 2.44
3847 4069 5.321102 TGTATGTACTGGTCCAAGCAAAAT 58.679 37.500 0.00 0.00 0.00 1.82
3848 4070 5.772672 TGTATGTACTGGTCCAAGCAAAATT 59.227 36.000 0.00 0.00 0.00 1.82
3849 4071 4.846779 TGTACTGGTCCAAGCAAAATTC 57.153 40.909 0.00 0.00 0.00 2.17
3850 4072 4.211125 TGTACTGGTCCAAGCAAAATTCA 58.789 39.130 0.00 0.00 0.00 2.57
3851 4073 4.832266 TGTACTGGTCCAAGCAAAATTCAT 59.168 37.500 0.00 0.00 0.00 2.57
3852 4074 4.525912 ACTGGTCCAAGCAAAATTCATC 57.474 40.909 0.00 0.00 0.00 2.92
3853 4075 3.896888 ACTGGTCCAAGCAAAATTCATCA 59.103 39.130 0.00 0.00 0.00 3.07
3854 4076 4.344679 ACTGGTCCAAGCAAAATTCATCAA 59.655 37.500 0.00 0.00 0.00 2.57
3859 4081 7.039152 TGGTCCAAGCAAAATTCATCAAGAATA 60.039 33.333 0.00 0.00 46.09 1.75
3860 4082 7.983484 GGTCCAAGCAAAATTCATCAAGAATAT 59.017 33.333 0.00 0.00 46.09 1.28
3861 4083 9.028185 GTCCAAGCAAAATTCATCAAGAATATC 57.972 33.333 0.00 0.00 46.09 1.63
3862 4084 8.751242 TCCAAGCAAAATTCATCAAGAATATCA 58.249 29.630 0.00 0.00 46.09 2.15
3863 4085 9.373603 CCAAGCAAAATTCATCAAGAATATCAA 57.626 29.630 0.00 0.00 46.09 2.57
3866 4088 9.079833 AGCAAAATTCATCAAGAATATCAAACG 57.920 29.630 0.00 0.00 46.09 3.60
3877 4099 9.653287 TCAAGAATATCAAACGATTTACTGTCT 57.347 29.630 0.00 0.00 0.00 3.41
3887 4109 6.541111 ACGATTTACTGTCTTTTCTTCACC 57.459 37.500 0.00 0.00 0.00 4.02
3888 4110 6.289064 ACGATTTACTGTCTTTTCTTCACCT 58.711 36.000 0.00 0.00 0.00 4.00
3890 4112 7.072030 CGATTTACTGTCTTTTCTTCACCTTG 58.928 38.462 0.00 0.00 0.00 3.61
3892 4114 4.503714 ACTGTCTTTTCTTCACCTTGGA 57.496 40.909 0.00 0.00 0.00 3.53
3893 4115 5.053978 ACTGTCTTTTCTTCACCTTGGAT 57.946 39.130 0.00 0.00 0.00 3.41
3895 4117 6.601332 ACTGTCTTTTCTTCACCTTGGATTA 58.399 36.000 0.00 0.00 0.00 1.75
3896 4118 7.060421 ACTGTCTTTTCTTCACCTTGGATTAA 58.940 34.615 0.00 0.00 0.00 1.40
3897 4119 7.559897 ACTGTCTTTTCTTCACCTTGGATTAAA 59.440 33.333 0.00 0.00 0.00 1.52
3899 4121 6.856426 GTCTTTTCTTCACCTTGGATTAAACG 59.144 38.462 0.00 0.00 0.00 3.60
3900 4122 6.544564 TCTTTTCTTCACCTTGGATTAAACGT 59.455 34.615 0.00 0.00 0.00 3.99
3901 4123 7.716123 TCTTTTCTTCACCTTGGATTAAACGTA 59.284 33.333 0.00 0.00 0.00 3.57
3902 4124 7.804843 TTTCTTCACCTTGGATTAAACGTAA 57.195 32.000 0.00 0.00 0.00 3.18
3905 4258 6.938030 TCTTCACCTTGGATTAAACGTAACAT 59.062 34.615 0.00 0.00 0.00 2.71
3907 4260 7.513371 TCACCTTGGATTAAACGTAACATTT 57.487 32.000 0.00 0.00 0.00 2.32
3910 4263 9.120422 CACCTTGGATTAAACGTAACATTTTAC 57.880 33.333 0.00 0.00 35.17 2.01
3911 4264 8.848182 ACCTTGGATTAAACGTAACATTTTACA 58.152 29.630 2.87 0.00 37.99 2.41
3944 4297 8.853077 TCAGAAAAATGAATTCTTAGCTCTGA 57.147 30.769 18.16 18.16 34.99 3.27
3946 4299 9.504710 CAGAAAAATGAATTCTTAGCTCTGATG 57.495 33.333 16.09 0.06 34.99 3.07
3947 4300 9.240734 AGAAAAATGAATTCTTAGCTCTGATGT 57.759 29.630 7.05 0.00 33.41 3.06
3951 4304 8.659925 AATGAATTCTTAGCTCTGATGTACAG 57.340 34.615 7.05 0.00 46.97 2.74
3952 4305 7.175347 TGAATTCTTAGCTCTGATGTACAGT 57.825 36.000 7.05 0.00 45.86 3.55
3953 4306 8.293699 TGAATTCTTAGCTCTGATGTACAGTA 57.706 34.615 7.05 0.00 45.86 2.74
3956 4309 8.704849 ATTCTTAGCTCTGATGTACAGTAGAT 57.295 34.615 11.06 0.00 45.86 1.98
3958 4311 7.283329 TCTTAGCTCTGATGTACAGTAGATGA 58.717 38.462 11.06 0.00 45.86 2.92
3959 4312 7.941790 TCTTAGCTCTGATGTACAGTAGATGAT 59.058 37.037 11.06 7.84 45.86 2.45
3960 4313 6.975196 AGCTCTGATGTACAGTAGATGATT 57.025 37.500 11.06 0.00 45.86 2.57
3961 4314 9.574516 TTAGCTCTGATGTACAGTAGATGATTA 57.425 33.333 11.06 2.23 45.86 1.75
3962 4315 8.109705 AGCTCTGATGTACAGTAGATGATTAG 57.890 38.462 11.06 2.41 45.86 1.73
3963 4316 6.806249 GCTCTGATGTACAGTAGATGATTAGC 59.194 42.308 11.06 7.37 45.86 3.09
3964 4317 7.220741 TCTGATGTACAGTAGATGATTAGCC 57.779 40.000 0.33 0.00 45.86 3.93
3965 4318 6.777580 TCTGATGTACAGTAGATGATTAGCCA 59.222 38.462 0.33 0.00 45.86 4.75
3967 4320 8.650143 TGATGTACAGTAGATGATTAGCCATA 57.350 34.615 0.33 0.00 0.00 2.74
3968 4321 8.523658 TGATGTACAGTAGATGATTAGCCATAC 58.476 37.037 0.33 0.00 0.00 2.39
3971 4324 8.870116 TGTACAGTAGATGATTAGCCATACAAT 58.130 33.333 0.00 0.00 0.00 2.71
3972 4325 9.144747 GTACAGTAGATGATTAGCCATACAATG 57.855 37.037 0.00 0.00 0.00 2.82
3974 4327 8.600668 ACAGTAGATGATTAGCCATACAATGAT 58.399 33.333 0.00 0.00 0.00 2.45
3981 4334 8.995027 TGATTAGCCATACAATGATTTAAGGT 57.005 30.769 0.00 0.00 0.00 3.50
3982 4335 8.849168 TGATTAGCCATACAATGATTTAAGGTG 58.151 33.333 0.00 0.00 0.00 4.00
3983 4336 5.520376 AGCCATACAATGATTTAAGGTGC 57.480 39.130 0.00 0.00 0.00 5.01
3986 4339 5.519927 GCCATACAATGATTTAAGGTGCAAC 59.480 40.000 0.00 0.00 0.00 4.17
3987 4340 6.627953 GCCATACAATGATTTAAGGTGCAACT 60.628 38.462 0.00 0.00 36.74 3.16
3988 4341 7.416213 GCCATACAATGATTTAAGGTGCAACTA 60.416 37.037 3.69 0.00 36.74 2.24
3989 4342 8.632679 CCATACAATGATTTAAGGTGCAACTAT 58.367 33.333 3.69 0.00 36.74 2.12
4001 4354 9.899661 TTAAGGTGCAACTATAATGTAATCACT 57.100 29.630 3.69 0.00 36.74 3.41
4002 4355 7.792374 AGGTGCAACTATAATGTAATCACTG 57.208 36.000 0.00 0.00 36.74 3.66
4003 4356 7.564793 AGGTGCAACTATAATGTAATCACTGA 58.435 34.615 0.00 0.00 36.74 3.41
4004 4357 8.046708 AGGTGCAACTATAATGTAATCACTGAA 58.953 33.333 0.00 0.00 36.74 3.02
4005 4358 8.673711 GGTGCAACTATAATGTAATCACTGAAA 58.326 33.333 0.00 0.00 36.74 2.69
4006 4359 9.490663 GTGCAACTATAATGTAATCACTGAAAC 57.509 33.333 0.00 0.00 0.00 2.78
4007 4360 9.225436 TGCAACTATAATGTAATCACTGAAACA 57.775 29.630 0.00 1.27 0.00 2.83
4011 4364 9.959721 ACTATAATGTAATCACTGAAACAACCT 57.040 29.630 2.63 0.00 0.00 3.50
4014 4367 4.460263 TGTAATCACTGAAACAACCTGCT 58.540 39.130 0.00 0.00 0.00 4.24
4015 4368 3.996150 AATCACTGAAACAACCTGCTG 57.004 42.857 0.00 0.00 0.00 4.41
4016 4369 1.024271 TCACTGAAACAACCTGCTGC 58.976 50.000 0.00 0.00 0.00 5.25
4018 4371 1.134753 CACTGAAACAACCTGCTGCAA 59.865 47.619 3.02 0.00 0.00 4.08
4020 4373 2.233431 ACTGAAACAACCTGCTGCAAAA 59.767 40.909 3.02 0.00 0.00 2.44
4021 4374 3.118665 ACTGAAACAACCTGCTGCAAAAT 60.119 39.130 3.02 0.00 0.00 1.82
4022 4375 3.871485 TGAAACAACCTGCTGCAAAATT 58.129 36.364 3.02 0.00 0.00 1.82
4023 4376 3.870419 TGAAACAACCTGCTGCAAAATTC 59.130 39.130 3.02 3.93 0.00 2.17
4025 4378 3.102052 ACAACCTGCTGCAAAATTCTG 57.898 42.857 3.02 0.00 0.00 3.02
4026 4379 2.694628 ACAACCTGCTGCAAAATTCTGA 59.305 40.909 3.02 0.00 0.00 3.27
4027 4380 3.322828 ACAACCTGCTGCAAAATTCTGAT 59.677 39.130 3.02 0.00 0.00 2.90
4028 4381 4.202284 ACAACCTGCTGCAAAATTCTGATT 60.202 37.500 3.02 0.00 0.00 2.57
4029 4382 3.921677 ACCTGCTGCAAAATTCTGATTG 58.078 40.909 3.02 0.00 0.00 2.67
4030 4383 3.575256 ACCTGCTGCAAAATTCTGATTGA 59.425 39.130 3.02 0.00 0.00 2.57
4033 4386 5.107220 CCTGCTGCAAAATTCTGATTGAAAC 60.107 40.000 3.02 0.00 38.29 2.78
4034 4387 5.358090 TGCTGCAAAATTCTGATTGAAACA 58.642 33.333 0.00 0.00 38.29 2.83
4035 4388 5.816258 TGCTGCAAAATTCTGATTGAAACAA 59.184 32.000 0.00 0.00 38.29 2.83
4036 4389 6.131389 GCTGCAAAATTCTGATTGAAACAAC 58.869 36.000 0.00 0.00 38.29 3.32
4037 4390 6.601741 TGCAAAATTCTGATTGAAACAACC 57.398 33.333 0.00 0.00 38.29 3.77
4038 4391 6.111382 TGCAAAATTCTGATTGAAACAACCA 58.889 32.000 0.00 0.00 38.29 3.67
4039 4392 6.596888 TGCAAAATTCTGATTGAAACAACCAA 59.403 30.769 0.00 0.00 38.29 3.67
4041 4394 8.130469 GCAAAATTCTGATTGAAACAACCAAAT 58.870 29.630 0.00 0.00 38.29 2.32
4051 4404 9.797556 GATTGAAACAACCAAATAACTATACCC 57.202 33.333 0.00 0.00 0.00 3.69
4052 4405 8.707796 TTGAAACAACCAAATAACTATACCCA 57.292 30.769 0.00 0.00 0.00 4.51
4053 4406 8.707796 TGAAACAACCAAATAACTATACCCAA 57.292 30.769 0.00 0.00 0.00 4.12
4054 4407 9.144298 TGAAACAACCAAATAACTATACCCAAA 57.856 29.630 0.00 0.00 0.00 3.28
4057 4410 9.990360 AACAACCAAATAACTATACCCAAAAAG 57.010 29.630 0.00 0.00 0.00 2.27
4058 4411 8.590204 ACAACCAAATAACTATACCCAAAAAGG 58.410 33.333 0.00 0.00 37.03 3.11
4059 4412 7.177832 ACCAAATAACTATACCCAAAAAGGC 57.822 36.000 0.00 0.00 35.39 4.35
4063 4416 7.418337 AATAACTATACCCAAAAAGGCTTGG 57.582 36.000 0.00 0.00 44.77 3.61
4064 4417 3.096852 ACTATACCCAAAAAGGCTTGGC 58.903 45.455 0.00 0.00 43.97 4.52
4065 4418 2.022718 ATACCCAAAAAGGCTTGGCA 57.977 45.000 0.00 0.00 43.97 4.92
4066 4419 1.044611 TACCCAAAAAGGCTTGGCAC 58.955 50.000 0.00 0.00 43.97 5.01
4067 4420 0.980231 ACCCAAAAAGGCTTGGCACA 60.980 50.000 0.00 0.00 43.97 4.57
4068 4421 0.249996 CCCAAAAAGGCTTGGCACAG 60.250 55.000 0.00 0.00 43.97 3.66
4069 4422 0.752054 CCAAAAAGGCTTGGCACAGA 59.248 50.000 0.00 0.00 42.39 3.41
4070 4423 1.138661 CCAAAAAGGCTTGGCACAGAA 59.861 47.619 0.00 0.00 42.39 3.02
4071 4424 2.476821 CAAAAAGGCTTGGCACAGAAG 58.523 47.619 0.00 0.00 42.39 2.85
4072 4425 2.071778 AAAAGGCTTGGCACAGAAGA 57.928 45.000 0.00 0.00 42.39 2.87
4075 4428 1.322442 AGGCTTGGCACAGAAGAAAC 58.678 50.000 0.00 0.00 42.39 2.78
4076 4429 1.032014 GGCTTGGCACAGAAGAAACA 58.968 50.000 0.00 0.00 42.39 2.83
4077 4430 1.408702 GGCTTGGCACAGAAGAAACAA 59.591 47.619 0.00 0.00 42.39 2.83
4079 4432 3.311966 GCTTGGCACAGAAGAAACAATC 58.688 45.455 0.00 0.00 42.39 2.67
4080 4433 3.858503 GCTTGGCACAGAAGAAACAATCC 60.859 47.826 0.00 0.00 42.39 3.01
4081 4434 2.942804 TGGCACAGAAGAAACAATCCA 58.057 42.857 0.00 0.00 0.00 3.41
4083 4436 3.703556 TGGCACAGAAGAAACAATCCAAA 59.296 39.130 0.00 0.00 0.00 3.28
4084 4437 4.202141 TGGCACAGAAGAAACAATCCAAAG 60.202 41.667 0.00 0.00 0.00 2.77
4085 4438 3.737774 GCACAGAAGAAACAATCCAAAGC 59.262 43.478 0.00 0.00 0.00 3.51
4086 4439 4.500375 GCACAGAAGAAACAATCCAAAGCT 60.500 41.667 0.00 0.00 0.00 3.74
4087 4440 5.594926 CACAGAAGAAACAATCCAAAGCTT 58.405 37.500 0.00 0.00 0.00 3.74
4088 4441 6.044682 CACAGAAGAAACAATCCAAAGCTTT 58.955 36.000 5.69 5.69 0.00 3.51
4090 4443 6.097412 ACAGAAGAAACAATCCAAAGCTTTCT 59.903 34.615 9.23 0.00 33.54 2.52
4091 4444 6.420008 CAGAAGAAACAATCCAAAGCTTTCTG 59.580 38.462 9.23 5.18 32.70 3.02
4092 4445 6.322201 AGAAGAAACAATCCAAAGCTTTCTGA 59.678 34.615 9.23 9.50 32.70 3.27
4093 4446 6.469782 AGAAACAATCCAAAGCTTTCTGAA 57.530 33.333 9.23 0.00 31.47 3.02
4094 4447 6.276091 AGAAACAATCCAAAGCTTTCTGAAC 58.724 36.000 9.23 2.94 31.47 3.18
4095 4448 5.596836 AACAATCCAAAGCTTTCTGAACA 57.403 34.783 9.23 0.00 0.00 3.18
4096 4449 5.192327 ACAATCCAAAGCTTTCTGAACAG 57.808 39.130 9.23 6.16 0.00 3.16
4097 4450 4.646492 ACAATCCAAAGCTTTCTGAACAGT 59.354 37.500 9.23 6.72 0.00 3.55
4098 4451 4.843220 ATCCAAAGCTTTCTGAACAGTG 57.157 40.909 9.23 0.00 0.00 3.66
4099 4452 2.951642 TCCAAAGCTTTCTGAACAGTGG 59.048 45.455 9.23 5.16 0.00 4.00
4100 4453 2.544486 CCAAAGCTTTCTGAACAGTGGC 60.544 50.000 9.23 5.36 0.00 5.01
4101 4454 0.947244 AAGCTTTCTGAACAGTGGCG 59.053 50.000 0.00 0.00 0.00 5.69
4102 4455 0.179045 AGCTTTCTGAACAGTGGCGT 60.179 50.000 0.00 0.00 0.00 5.68
4103 4456 1.070134 AGCTTTCTGAACAGTGGCGTA 59.930 47.619 0.00 0.00 0.00 4.42
4104 4457 1.461127 GCTTTCTGAACAGTGGCGTAG 59.539 52.381 0.00 0.00 0.00 3.51
4117 4470 2.499685 CGTAGCCACAGGGTAGCC 59.500 66.667 1.60 1.60 36.28 3.93
4118 4471 2.355986 CGTAGCCACAGGGTAGCCA 61.356 63.158 14.62 0.00 36.28 4.75
4119 4472 1.522569 GTAGCCACAGGGTAGCCAG 59.477 63.158 14.62 7.92 36.28 4.85
4120 4473 1.689233 TAGCCACAGGGTAGCCAGG 60.689 63.158 14.62 12.78 34.28 4.45
4122 4475 2.610859 CCACAGGGTAGCCAGGGT 60.611 66.667 14.62 5.42 0.00 4.34
4124 4477 2.610859 ACAGGGTAGCCAGGGTGG 60.611 66.667 14.62 0.00 41.55 4.61
4126 4479 2.285442 AGGGTAGCCAGGGTGGTC 60.285 66.667 14.62 0.00 40.46 4.02
4127 4480 3.408853 GGGTAGCCAGGGTGGTCC 61.409 72.222 5.96 1.15 40.46 4.46
4128 4481 2.609610 GGTAGCCAGGGTGGTCCA 60.610 66.667 0.00 0.00 40.46 4.02
4129 4482 2.669240 GTAGCCAGGGTGGTCCAC 59.331 66.667 14.13 14.13 40.46 4.02
4130 4483 3.000819 TAGCCAGGGTGGTCCACG 61.001 66.667 15.93 3.15 40.46 4.94
4144 4497 3.461773 CACGGACCGCCCTGAGAT 61.462 66.667 15.39 0.00 0.00 2.75
4145 4498 2.683933 ACGGACCGCCCTGAGATT 60.684 61.111 15.39 0.00 0.00 2.40
4146 4499 2.291043 ACGGACCGCCCTGAGATTT 61.291 57.895 15.39 0.00 0.00 2.17
4147 4500 1.815421 CGGACCGCCCTGAGATTTG 60.815 63.158 0.00 0.00 0.00 2.32
4148 4501 1.452108 GGACCGCCCTGAGATTTGG 60.452 63.158 0.00 0.00 0.00 3.28
4149 4502 2.044946 ACCGCCCTGAGATTTGGC 60.045 61.111 0.00 0.00 41.85 4.52
4150 4503 2.830370 CCGCCCTGAGATTTGGCC 60.830 66.667 0.00 0.00 42.29 5.36
4151 4504 2.830370 CGCCCTGAGATTTGGCCC 60.830 66.667 0.00 0.00 42.29 5.80
4152 4505 2.360191 GCCCTGAGATTTGGCCCA 59.640 61.111 0.00 0.00 39.30 5.36
4153 4506 2.054453 GCCCTGAGATTTGGCCCAC 61.054 63.158 0.00 0.00 39.30 4.61
4164 4517 4.147587 GGCCCACCATCAGCCCAT 62.148 66.667 0.00 0.00 41.00 4.00
4165 4518 2.766925 GGCCCACCATCAGCCCATA 61.767 63.158 0.00 0.00 41.00 2.74
4166 4519 1.462035 GCCCACCATCAGCCCATAT 59.538 57.895 0.00 0.00 0.00 1.78
4167 4520 0.698238 GCCCACCATCAGCCCATATA 59.302 55.000 0.00 0.00 0.00 0.86
4168 4521 1.340405 GCCCACCATCAGCCCATATAG 60.340 57.143 0.00 0.00 0.00 1.31
4169 4522 1.283029 CCCACCATCAGCCCATATAGG 59.717 57.143 0.00 0.00 37.03 2.57
4170 4523 2.269023 CCACCATCAGCCCATATAGGA 58.731 52.381 0.00 0.00 41.22 2.94
4172 4525 3.267812 CCACCATCAGCCCATATAGGAAT 59.732 47.826 0.00 0.00 41.22 3.01
4173 4526 4.474651 CCACCATCAGCCCATATAGGAATA 59.525 45.833 0.00 0.00 41.22 1.75
4174 4527 5.133322 CCACCATCAGCCCATATAGGAATAT 59.867 44.000 0.00 0.00 41.22 1.28
4175 4528 6.354213 CCACCATCAGCCCATATAGGAATATT 60.354 42.308 0.00 0.00 41.22 1.28
4176 4529 7.121382 CACCATCAGCCCATATAGGAATATTT 58.879 38.462 0.00 0.00 41.22 1.40
4177 4530 7.616935 CACCATCAGCCCATATAGGAATATTTT 59.383 37.037 0.00 0.00 41.22 1.82
4178 4531 8.179487 ACCATCAGCCCATATAGGAATATTTTT 58.821 33.333 0.00 0.00 41.22 1.94
4200 4553 2.814410 CGTTCAGCGCAGAGAAAGA 58.186 52.632 11.47 0.00 0.00 2.52
4201 4554 1.139989 CGTTCAGCGCAGAGAAAGAA 58.860 50.000 11.47 0.00 0.00 2.52
4202 4555 1.526887 CGTTCAGCGCAGAGAAAGAAA 59.473 47.619 11.47 0.00 0.00 2.52
4203 4556 2.032894 CGTTCAGCGCAGAGAAAGAAAA 60.033 45.455 11.47 0.00 0.00 2.29
4205 4558 2.560504 TCAGCGCAGAGAAAGAAAACA 58.439 42.857 11.47 0.00 0.00 2.83
4206 4559 3.141398 TCAGCGCAGAGAAAGAAAACAT 58.859 40.909 11.47 0.00 0.00 2.71
4207 4560 3.187227 TCAGCGCAGAGAAAGAAAACATC 59.813 43.478 11.47 0.00 0.00 3.06
4208 4561 2.158449 AGCGCAGAGAAAGAAAACATCG 59.842 45.455 11.47 0.00 0.00 3.84
4210 4563 2.726066 CGCAGAGAAAGAAAACATCGCC 60.726 50.000 0.00 0.00 0.00 5.54
4211 4564 2.226437 GCAGAGAAAGAAAACATCGCCA 59.774 45.455 0.00 0.00 0.00 5.69
4212 4565 3.669023 GCAGAGAAAGAAAACATCGCCAG 60.669 47.826 0.00 0.00 0.00 4.85
4214 4567 2.485814 GAGAAAGAAAACATCGCCAGCT 59.514 45.455 0.00 0.00 0.00 4.24
4215 4568 3.674997 AGAAAGAAAACATCGCCAGCTA 58.325 40.909 0.00 0.00 0.00 3.32
4216 4569 3.437049 AGAAAGAAAACATCGCCAGCTAC 59.563 43.478 0.00 0.00 0.00 3.58
4217 4570 1.359848 AGAAAACATCGCCAGCTACG 58.640 50.000 2.01 2.01 0.00 3.51
4227 4580 2.031919 CAGCTACGGCAACCCACA 59.968 61.111 0.00 0.00 41.70 4.17
4229 4582 2.746277 GCTACGGCAACCCACAGG 60.746 66.667 0.00 0.00 38.54 4.00
4230 4583 3.065306 CTACGGCAACCCACAGGA 58.935 61.111 0.00 0.00 36.73 3.86
4231 4584 1.602237 CTACGGCAACCCACAGGAT 59.398 57.895 0.00 0.00 36.73 3.24
4233 4586 1.195442 TACGGCAACCCACAGGATCA 61.195 55.000 0.00 0.00 36.73 2.92
4234 4587 1.077501 CGGCAACCCACAGGATCAT 60.078 57.895 0.00 0.00 36.73 2.45
4235 4588 0.680921 CGGCAACCCACAGGATCATT 60.681 55.000 0.00 0.00 36.73 2.57
4236 4589 1.560505 GGCAACCCACAGGATCATTT 58.439 50.000 0.00 0.00 36.73 2.32
4237 4590 1.478105 GGCAACCCACAGGATCATTTC 59.522 52.381 0.00 0.00 36.73 2.17
4248 4601 2.395654 GGATCATTTCCTCGTACTCGC 58.604 52.381 0.00 0.00 41.78 5.03
4249 4602 2.223735 GGATCATTTCCTCGTACTCGCA 60.224 50.000 0.00 0.00 41.78 5.10
4251 4604 1.542472 TCATTTCCTCGTACTCGCACA 59.458 47.619 0.00 0.00 36.96 4.57
4253 4606 2.060326 TTTCCTCGTACTCGCACAAG 57.940 50.000 0.00 0.00 36.96 3.16
4254 4607 0.242825 TTCCTCGTACTCGCACAAGG 59.757 55.000 0.00 0.00 36.96 3.61
4256 4609 1.213013 CTCGTACTCGCACAAGGCT 59.787 57.895 0.00 0.00 41.67 4.58
4257 4610 0.450583 CTCGTACTCGCACAAGGCTA 59.549 55.000 0.00 0.00 41.67 3.93
4258 4611 0.883153 TCGTACTCGCACAAGGCTAA 59.117 50.000 0.00 0.00 41.67 3.09
4259 4612 1.475280 TCGTACTCGCACAAGGCTAAT 59.525 47.619 0.00 0.00 41.67 1.73
4260 4613 1.852895 CGTACTCGCACAAGGCTAATC 59.147 52.381 0.00 0.00 41.67 1.75
4261 4614 2.734175 CGTACTCGCACAAGGCTAATCA 60.734 50.000 0.00 0.00 41.67 2.57
4262 4615 2.015736 ACTCGCACAAGGCTAATCAG 57.984 50.000 0.00 0.00 41.67 2.90
4280 4633 4.265904 TCAGCCTGTTAATCGTTCTCAA 57.734 40.909 0.00 0.00 0.00 3.02
4281 4634 3.994392 TCAGCCTGTTAATCGTTCTCAAC 59.006 43.478 0.00 0.00 0.00 3.18
4284 4637 3.371285 GCCTGTTAATCGTTCTCAACTCC 59.629 47.826 0.00 0.00 0.00 3.85
4285 4638 3.933332 CCTGTTAATCGTTCTCAACTCCC 59.067 47.826 0.00 0.00 0.00 4.30
4286 4639 3.581755 TGTTAATCGTTCTCAACTCCCG 58.418 45.455 0.00 0.00 0.00 5.14
4287 4640 3.256383 TGTTAATCGTTCTCAACTCCCGA 59.744 43.478 0.00 0.00 0.00 5.14
4290 4643 0.815734 TCGTTCTCAACTCCCGATCC 59.184 55.000 0.00 0.00 0.00 3.36
4292 4645 1.469940 CGTTCTCAACTCCCGATCCTG 60.470 57.143 0.00 0.00 0.00 3.86
4296 4649 1.135915 CTCAACTCCCGATCCTGACTG 59.864 57.143 0.00 0.00 0.00 3.51
4297 4650 1.186200 CAACTCCCGATCCTGACTGA 58.814 55.000 0.00 0.00 0.00 3.41
4298 4651 1.550524 CAACTCCCGATCCTGACTGAA 59.449 52.381 0.00 0.00 0.00 3.02
4300 4653 0.101399 CTCCCGATCCTGACTGAACG 59.899 60.000 0.00 0.00 0.00 3.95
4301 4654 0.611062 TCCCGATCCTGACTGAACGT 60.611 55.000 0.00 0.00 0.00 3.99
4304 4657 1.471287 CCGATCCTGACTGAACGTACA 59.529 52.381 0.00 0.00 0.00 2.90
4305 4658 2.516923 CGATCCTGACTGAACGTACAC 58.483 52.381 0.00 0.00 0.00 2.90
4307 4660 3.502920 GATCCTGACTGAACGTACACAG 58.497 50.000 13.25 13.25 39.65 3.66
4308 4661 2.578786 TCCTGACTGAACGTACACAGA 58.421 47.619 19.13 2.82 37.54 3.41
4310 4663 4.329392 TCCTGACTGAACGTACACAGATA 58.671 43.478 19.13 9.59 37.54 1.98
4311 4664 4.155462 TCCTGACTGAACGTACACAGATAC 59.845 45.833 19.13 12.14 37.54 2.24
4312 4665 4.082949 CCTGACTGAACGTACACAGATACA 60.083 45.833 19.13 14.71 37.54 2.29
4313 4666 5.441709 TGACTGAACGTACACAGATACAA 57.558 39.130 19.13 2.99 37.54 2.41
4314 4667 5.217393 TGACTGAACGTACACAGATACAAC 58.783 41.667 19.13 7.68 37.54 3.32
4315 4668 5.009310 TGACTGAACGTACACAGATACAACT 59.991 40.000 19.13 1.02 37.54 3.16
4316 4669 5.839621 ACTGAACGTACACAGATACAACTT 58.160 37.500 19.13 0.00 37.54 2.66
4317 4670 6.973843 ACTGAACGTACACAGATACAACTTA 58.026 36.000 19.13 0.00 37.54 2.24
4318 4671 7.600065 ACTGAACGTACACAGATACAACTTAT 58.400 34.615 19.13 0.00 37.54 1.73
4319 4672 8.086522 ACTGAACGTACACAGATACAACTTATT 58.913 33.333 19.13 0.00 37.54 1.40
4320 4673 8.456904 TGAACGTACACAGATACAACTTATTC 57.543 34.615 0.00 0.00 0.00 1.75
4322 4675 8.684973 AACGTACACAGATACAACTTATTCTC 57.315 34.615 0.00 0.00 0.00 2.87
4323 4676 7.823665 ACGTACACAGATACAACTTATTCTCA 58.176 34.615 0.00 0.00 0.00 3.27
4324 4677 7.968956 ACGTACACAGATACAACTTATTCTCAG 59.031 37.037 0.00 0.00 0.00 3.35
4325 4678 7.968956 CGTACACAGATACAACTTATTCTCAGT 59.031 37.037 0.00 0.00 0.00 3.41
4328 4681 7.819900 ACACAGATACAACTTATTCTCAGTTCC 59.180 37.037 0.00 0.00 31.83 3.62
4329 4682 7.009631 CACAGATACAACTTATTCTCAGTTCCG 59.990 40.741 0.00 0.00 31.83 4.30
4330 4683 7.093902 ACAGATACAACTTATTCTCAGTTCCGA 60.094 37.037 0.00 0.00 31.83 4.55
4331 4684 7.221067 CAGATACAACTTATTCTCAGTTCCGAC 59.779 40.741 0.00 0.00 31.83 4.79
4332 4685 4.235360 ACAACTTATTCTCAGTTCCGACG 58.765 43.478 0.00 0.00 31.83 5.12
4333 4686 2.877335 ACTTATTCTCAGTTCCGACGC 58.123 47.619 0.00 0.00 0.00 5.19
4335 4688 2.846039 TATTCTCAGTTCCGACGCTC 57.154 50.000 0.00 0.00 0.00 5.03
4336 4689 0.173708 ATTCTCAGTTCCGACGCTCC 59.826 55.000 0.00 0.00 0.00 4.70
4337 4690 0.894184 TTCTCAGTTCCGACGCTCCT 60.894 55.000 0.00 0.00 0.00 3.69
4338 4691 0.035725 TCTCAGTTCCGACGCTCCTA 60.036 55.000 0.00 0.00 0.00 2.94
4339 4692 0.809385 CTCAGTTCCGACGCTCCTAA 59.191 55.000 0.00 0.00 0.00 2.69
4341 4694 1.822990 TCAGTTCCGACGCTCCTAATT 59.177 47.619 0.00 0.00 0.00 1.40
4342 4695 2.159282 TCAGTTCCGACGCTCCTAATTC 60.159 50.000 0.00 0.00 0.00 2.17
4344 4697 1.136500 GTTCCGACGCTCCTAATTCCT 59.864 52.381 0.00 0.00 0.00 3.36
4345 4698 1.030457 TCCGACGCTCCTAATTCCTC 58.970 55.000 0.00 0.00 0.00 3.71
4346 4699 0.032267 CCGACGCTCCTAATTCCTCC 59.968 60.000 0.00 0.00 0.00 4.30
4347 4700 1.033574 CGACGCTCCTAATTCCTCCT 58.966 55.000 0.00 0.00 0.00 3.69
4348 4701 1.409427 CGACGCTCCTAATTCCTCCTT 59.591 52.381 0.00 0.00 0.00 3.36
4349 4702 2.621998 CGACGCTCCTAATTCCTCCTTA 59.378 50.000 0.00 0.00 0.00 2.69
4350 4703 3.304794 CGACGCTCCTAATTCCTCCTTAG 60.305 52.174 0.00 0.00 0.00 2.18
4351 4704 2.365941 ACGCTCCTAATTCCTCCTTAGC 59.634 50.000 0.00 0.00 0.00 3.09
4352 4705 2.365617 CGCTCCTAATTCCTCCTTAGCA 59.634 50.000 0.00 0.00 0.00 3.49
4353 4706 3.553922 CGCTCCTAATTCCTCCTTAGCAG 60.554 52.174 0.00 0.00 0.00 4.24
4360 4713 1.866015 TCCTCCTTAGCAGCTTAGCA 58.134 50.000 7.07 0.00 36.85 3.49
4361 4714 1.759445 TCCTCCTTAGCAGCTTAGCAG 59.241 52.381 7.07 0.00 36.85 4.24
4383 4736 4.079980 CTAGACCTAGCTAGCAGAGACA 57.920 50.000 18.83 0.00 32.26 3.41
4384 4737 3.374042 AGACCTAGCTAGCAGAGACAA 57.626 47.619 18.83 0.00 0.00 3.18
4385 4738 3.702792 AGACCTAGCTAGCAGAGACAAA 58.297 45.455 18.83 0.00 0.00 2.83
4386 4739 4.090090 AGACCTAGCTAGCAGAGACAAAA 58.910 43.478 18.83 0.00 0.00 2.44
4387 4740 4.081917 AGACCTAGCTAGCAGAGACAAAAC 60.082 45.833 18.83 3.01 0.00 2.43
4388 4741 3.182967 CCTAGCTAGCAGAGACAAAACG 58.817 50.000 18.83 0.00 0.00 3.60
4389 4742 2.086054 AGCTAGCAGAGACAAAACGG 57.914 50.000 18.83 0.00 0.00 4.44
4390 4743 0.444260 GCTAGCAGAGACAAAACGGC 59.556 55.000 10.63 0.00 0.00 5.68
4391 4744 1.795768 CTAGCAGAGACAAAACGGCA 58.204 50.000 0.00 0.00 0.00 5.69
4392 4745 1.461127 CTAGCAGAGACAAAACGGCAC 59.539 52.381 0.00 0.00 0.00 5.01
4405 4758 3.977244 GGCACGGGGCAACACAAG 61.977 66.667 6.24 0.00 44.36 3.16
4406 4759 3.977244 GCACGGGGCAACACAAGG 61.977 66.667 0.00 0.00 44.36 3.61
4407 4760 3.294493 CACGGGGCAACACAAGGG 61.294 66.667 0.00 0.00 44.36 3.95
4408 4761 4.596585 ACGGGGCAACACAAGGGG 62.597 66.667 0.00 0.00 44.36 4.79
4412 4765 4.966787 GGCAACACAAGGGGCCGA 62.967 66.667 0.00 0.00 36.58 5.54
4413 4766 3.670377 GCAACACAAGGGGCCGAC 61.670 66.667 0.00 0.00 0.00 4.79
4414 4767 2.203280 CAACACAAGGGGCCGACA 60.203 61.111 0.00 0.00 0.00 4.35
4415 4768 2.203294 AACACAAGGGGCCGACAC 60.203 61.111 0.00 0.00 0.00 3.67
4416 4769 3.785122 AACACAAGGGGCCGACACC 62.785 63.158 0.00 0.00 0.00 4.16
4417 4770 4.263572 CACAAGGGGCCGACACCA 62.264 66.667 0.00 0.00 0.00 4.17
4418 4771 4.265056 ACAAGGGGCCGACACCAC 62.265 66.667 0.00 0.00 0.00 4.16
4424 4777 4.555709 GGCCGACACCACCACACA 62.556 66.667 0.00 0.00 0.00 3.72
4425 4778 3.276846 GCCGACACCACCACACAC 61.277 66.667 0.00 0.00 0.00 3.82
4426 4779 2.964925 CCGACACCACCACACACG 60.965 66.667 0.00 0.00 0.00 4.49
4427 4780 2.964925 CGACACCACCACACACGG 60.965 66.667 0.00 0.00 0.00 4.94
4428 4781 2.188469 GACACCACCACACACGGT 59.812 61.111 0.00 0.00 41.07 4.83
4429 4782 1.450669 GACACCACCACACACGGTT 60.451 57.895 0.00 0.00 37.07 4.44
4430 4783 1.433837 GACACCACCACACACGGTTC 61.434 60.000 0.00 0.00 37.07 3.62
4431 4784 2.184167 CACCACCACACACGGTTCC 61.184 63.158 0.00 0.00 37.07 3.62
4432 4785 2.190843 CCACCACACACGGTTCCA 59.809 61.111 0.00 0.00 37.07 3.53
4433 4786 1.452289 CCACCACACACGGTTCCAA 60.452 57.895 0.00 0.00 37.07 3.53
4434 4787 1.720694 CCACCACACACGGTTCCAAC 61.721 60.000 0.00 0.00 37.07 3.77
4435 4788 1.816259 ACCACACACGGTTCCAACG 60.816 57.895 0.00 0.00 34.91 4.10
4436 4789 1.816259 CCACACACGGTTCCAACGT 60.816 57.895 0.00 0.00 46.82 3.99
4437 4790 0.530211 CCACACACGGTTCCAACGTA 60.530 55.000 0.00 0.00 43.58 3.57
4438 4791 0.578211 CACACACGGTTCCAACGTAC 59.422 55.000 0.00 0.00 43.58 3.67
4439 4792 0.871163 ACACACGGTTCCAACGTACG 60.871 55.000 15.01 15.01 43.58 3.67
4440 4793 0.594540 CACACGGTTCCAACGTACGA 60.595 55.000 24.41 0.00 43.58 3.43
4441 4794 0.594796 ACACGGTTCCAACGTACGAC 60.595 55.000 24.41 8.99 43.58 4.34
4442 4795 1.007387 ACGGTTCCAACGTACGACC 60.007 57.895 24.41 17.17 43.60 4.79
4443 4796 1.286880 CGGTTCCAACGTACGACCT 59.713 57.895 24.41 2.60 0.00 3.85
4444 4797 0.730494 CGGTTCCAACGTACGACCTC 60.730 60.000 24.41 6.81 0.00 3.85
4445 4798 0.730494 GGTTCCAACGTACGACCTCG 60.730 60.000 24.41 4.80 46.33 4.63
4446 4799 0.238289 GTTCCAACGTACGACCTCGA 59.762 55.000 24.41 6.72 43.02 4.04
4447 4800 0.518636 TTCCAACGTACGACCTCGAG 59.481 55.000 24.41 5.13 43.02 4.04
4448 4801 1.136147 CCAACGTACGACCTCGAGG 59.864 63.158 30.11 30.11 43.02 4.63
4449 4802 1.513586 CAACGTACGACCTCGAGGC 60.514 63.158 31.56 21.63 43.02 4.70
4450 4803 1.673665 AACGTACGACCTCGAGGCT 60.674 57.895 31.56 18.24 43.02 4.58
4451 4804 1.919956 AACGTACGACCTCGAGGCTG 61.920 60.000 31.56 24.66 43.02 4.85
4452 4805 2.396955 CGTACGACCTCGAGGCTGT 61.397 63.158 31.56 28.64 43.02 4.40
4453 4806 1.881602 GTACGACCTCGAGGCTGTT 59.118 57.895 31.56 12.17 43.02 3.16
4454 4807 0.243095 GTACGACCTCGAGGCTGTTT 59.757 55.000 31.56 11.74 43.02 2.83
4455 4808 0.963962 TACGACCTCGAGGCTGTTTT 59.036 50.000 31.56 10.89 43.02 2.43
4456 4809 0.319641 ACGACCTCGAGGCTGTTTTC 60.320 55.000 31.56 18.37 43.02 2.29
4457 4810 1.014564 CGACCTCGAGGCTGTTTTCC 61.015 60.000 31.56 9.11 43.02 3.13
4458 4811 0.321996 GACCTCGAGGCTGTTTTCCT 59.678 55.000 31.56 8.39 39.32 3.36
4459 4812 0.321996 ACCTCGAGGCTGTTTTCCTC 59.678 55.000 31.56 0.00 45.12 3.71
4460 4813 0.610687 CCTCGAGGCTGTTTTCCTCT 59.389 55.000 20.67 0.00 46.11 3.69
4461 4814 1.404851 CCTCGAGGCTGTTTTCCTCTC 60.405 57.143 20.67 0.00 46.11 3.20
4462 4815 0.243907 TCGAGGCTGTTTTCCTCTCG 59.756 55.000 0.00 0.00 46.11 4.04
4463 4816 0.038159 CGAGGCTGTTTTCCTCTCGT 60.038 55.000 0.00 0.00 46.11 4.18
4464 4817 1.201647 CGAGGCTGTTTTCCTCTCGTA 59.798 52.381 0.00 0.00 46.11 3.43
4465 4818 2.732597 CGAGGCTGTTTTCCTCTCGTAG 60.733 54.545 0.00 0.00 46.11 3.51
4466 4819 1.066787 AGGCTGTTTTCCTCTCGTAGC 60.067 52.381 0.00 0.00 0.00 3.58
4467 4820 1.360820 GCTGTTTTCCTCTCGTAGCC 58.639 55.000 0.00 0.00 0.00 3.93
4468 4821 1.630148 CTGTTTTCCTCTCGTAGCCG 58.370 55.000 0.00 0.00 0.00 5.52
4469 4822 0.389426 TGTTTTCCTCTCGTAGCCGC 60.389 55.000 0.00 0.00 0.00 6.53
4470 4823 1.082679 GTTTTCCTCTCGTAGCCGCC 61.083 60.000 0.00 0.00 0.00 6.13
4471 4824 2.552585 TTTTCCTCTCGTAGCCGCCG 62.553 60.000 0.00 0.00 0.00 6.46
4489 4842 3.738481 CCGGGGGCCAATCTTCCA 61.738 66.667 4.39 0.00 0.00 3.53
4490 4843 2.358619 CGGGGGCCAATCTTCCAA 59.641 61.111 4.39 0.00 0.00 3.53
4491 4844 2.052104 CGGGGGCCAATCTTCCAAC 61.052 63.158 4.39 0.00 0.00 3.77
4492 4845 2.052104 GGGGGCCAATCTTCCAACG 61.052 63.158 4.39 0.00 0.00 4.10
4493 4846 2.710902 GGGGCCAATCTTCCAACGC 61.711 63.158 4.39 0.00 0.00 4.84
4494 4847 2.710902 GGGCCAATCTTCCAACGCC 61.711 63.158 4.39 0.00 35.60 5.68
4495 4848 2.485122 GCCAATCTTCCAACGCCG 59.515 61.111 0.00 0.00 0.00 6.46
4496 4849 2.332654 GCCAATCTTCCAACGCCGT 61.333 57.895 0.00 0.00 0.00 5.68
4497 4850 1.862602 GCCAATCTTCCAACGCCGTT 61.863 55.000 0.00 0.00 0.00 4.44
4498 4851 0.168128 CCAATCTTCCAACGCCGTTC 59.832 55.000 0.00 0.00 0.00 3.95
4499 4852 1.156736 CAATCTTCCAACGCCGTTCT 58.843 50.000 0.00 0.00 0.00 3.01
4500 4853 1.128692 CAATCTTCCAACGCCGTTCTC 59.871 52.381 0.00 0.00 0.00 2.87
4501 4854 0.391263 ATCTTCCAACGCCGTTCTCC 60.391 55.000 0.00 0.00 0.00 3.71
4502 4855 2.356553 TTCCAACGCCGTTCTCCG 60.357 61.111 0.00 0.00 0.00 4.63
4538 4891 2.126580 GACTTCGGTCGTCGGTGG 60.127 66.667 0.00 0.00 39.77 4.61
4539 4892 2.908940 ACTTCGGTCGTCGGTGGT 60.909 61.111 0.00 0.00 39.77 4.16
4540 4893 2.430244 CTTCGGTCGTCGGTGGTG 60.430 66.667 0.00 0.00 39.77 4.17
4541 4894 2.906388 TTCGGTCGTCGGTGGTGA 60.906 61.111 0.00 0.00 39.77 4.02
4542 4895 2.797866 CTTCGGTCGTCGGTGGTGAG 62.798 65.000 0.00 0.00 39.77 3.51
4543 4896 4.415332 CGGTCGTCGGTGGTGAGG 62.415 72.222 0.00 0.00 34.75 3.86
4544 4897 4.065281 GGTCGTCGGTGGTGAGGG 62.065 72.222 0.00 0.00 0.00 4.30
4545 4898 4.065281 GTCGTCGGTGGTGAGGGG 62.065 72.222 0.00 0.00 0.00 4.79
4575 4928 3.240203 CACGCGTGTGGATCGTTT 58.760 55.556 30.50 0.00 42.59 3.60
4576 4929 1.567537 CACGCGTGTGGATCGTTTT 59.432 52.632 30.50 0.00 42.59 2.43
4577 4930 0.041663 CACGCGTGTGGATCGTTTTT 60.042 50.000 30.50 0.00 42.59 1.94
4578 4931 1.192757 CACGCGTGTGGATCGTTTTTA 59.807 47.619 30.50 0.00 42.59 1.52
4579 4932 1.192980 ACGCGTGTGGATCGTTTTTAC 59.807 47.619 12.93 0.00 31.89 2.01
4580 4933 1.458064 CGCGTGTGGATCGTTTTTACT 59.542 47.619 0.00 0.00 0.00 2.24
4581 4934 2.471749 CGCGTGTGGATCGTTTTTACTC 60.472 50.000 0.00 0.00 0.00 2.59
4582 4935 2.477375 GCGTGTGGATCGTTTTTACTCA 59.523 45.455 0.00 0.00 0.00 3.41
4583 4936 3.124636 GCGTGTGGATCGTTTTTACTCAT 59.875 43.478 0.00 0.00 0.00 2.90
4584 4937 4.724036 GCGTGTGGATCGTTTTTACTCATC 60.724 45.833 0.00 0.00 0.00 2.92
4585 4938 4.201685 CGTGTGGATCGTTTTTACTCATCC 60.202 45.833 0.00 0.00 34.64 3.51
4586 4939 3.930229 TGTGGATCGTTTTTACTCATCCG 59.070 43.478 0.00 0.00 36.55 4.18
4587 4940 3.930848 GTGGATCGTTTTTACTCATCCGT 59.069 43.478 0.00 0.00 36.55 4.69
4588 4941 5.104374 GTGGATCGTTTTTACTCATCCGTA 58.896 41.667 0.00 0.00 36.55 4.02
4589 4942 5.231568 GTGGATCGTTTTTACTCATCCGTAG 59.768 44.000 0.00 0.00 36.55 3.51
4590 4943 5.105635 TGGATCGTTTTTACTCATCCGTAGT 60.106 40.000 0.00 0.00 36.55 2.73
4591 4944 5.458126 GGATCGTTTTTACTCATCCGTAGTC 59.542 44.000 0.00 0.00 0.00 2.59
4592 4945 5.633830 TCGTTTTTACTCATCCGTAGTCT 57.366 39.130 0.00 0.00 0.00 3.24
4593 4946 6.741992 TCGTTTTTACTCATCCGTAGTCTA 57.258 37.500 0.00 0.00 0.00 2.59
4594 4947 6.779117 TCGTTTTTACTCATCCGTAGTCTAG 58.221 40.000 0.00 0.00 0.00 2.43
4595 4948 5.970023 CGTTTTTACTCATCCGTAGTCTAGG 59.030 44.000 0.00 0.00 0.00 3.02
4596 4949 6.404074 CGTTTTTACTCATCCGTAGTCTAGGT 60.404 42.308 0.00 0.00 0.00 3.08
4597 4950 7.318893 GTTTTTACTCATCCGTAGTCTAGGTT 58.681 38.462 0.00 0.00 0.00 3.50
4598 4951 7.472334 TTTTACTCATCCGTAGTCTAGGTTT 57.528 36.000 0.00 0.00 0.00 3.27
4599 4952 7.472334 TTTACTCATCCGTAGTCTAGGTTTT 57.528 36.000 0.00 0.00 0.00 2.43
4600 4953 5.997384 ACTCATCCGTAGTCTAGGTTTTT 57.003 39.130 0.00 0.00 0.00 1.94
4601 4954 8.579850 TTACTCATCCGTAGTCTAGGTTTTTA 57.420 34.615 0.00 0.00 0.00 1.52
4602 4955 7.098074 ACTCATCCGTAGTCTAGGTTTTTAG 57.902 40.000 0.00 0.00 0.00 1.85
4603 4956 6.096564 ACTCATCCGTAGTCTAGGTTTTTAGG 59.903 42.308 0.00 0.00 0.00 2.69
4604 4957 5.954150 TCATCCGTAGTCTAGGTTTTTAGGT 59.046 40.000 0.00 0.00 0.00 3.08
4605 4958 6.438425 TCATCCGTAGTCTAGGTTTTTAGGTT 59.562 38.462 0.00 0.00 0.00 3.50
4606 4959 6.029346 TCCGTAGTCTAGGTTTTTAGGTTG 57.971 41.667 0.00 0.00 0.00 3.77
4607 4960 5.539955 TCCGTAGTCTAGGTTTTTAGGTTGT 59.460 40.000 0.00 0.00 0.00 3.32
4608 4961 6.041979 TCCGTAGTCTAGGTTTTTAGGTTGTT 59.958 38.462 0.00 0.00 0.00 2.83
4609 4962 6.367149 CCGTAGTCTAGGTTTTTAGGTTGTTC 59.633 42.308 0.00 0.00 0.00 3.18
4610 4963 6.925165 CGTAGTCTAGGTTTTTAGGTTGTTCA 59.075 38.462 0.00 0.00 0.00 3.18
4611 4964 7.601508 CGTAGTCTAGGTTTTTAGGTTGTTCAT 59.398 37.037 0.00 0.00 0.00 2.57
4612 4965 7.981102 AGTCTAGGTTTTTAGGTTGTTCATC 57.019 36.000 0.00 0.00 0.00 2.92
4613 4966 6.649557 AGTCTAGGTTTTTAGGTTGTTCATCG 59.350 38.462 0.00 0.00 0.00 3.84
4614 4967 6.426025 GTCTAGGTTTTTAGGTTGTTCATCGT 59.574 38.462 0.00 0.00 0.00 3.73
4615 4968 5.684550 AGGTTTTTAGGTTGTTCATCGTC 57.315 39.130 0.00 0.00 0.00 4.20
4616 4969 5.374071 AGGTTTTTAGGTTGTTCATCGTCT 58.626 37.500 0.00 0.00 0.00 4.18
4617 4970 5.826208 AGGTTTTTAGGTTGTTCATCGTCTT 59.174 36.000 0.00 0.00 0.00 3.01
4618 4971 6.320418 AGGTTTTTAGGTTGTTCATCGTCTTT 59.680 34.615 0.00 0.00 0.00 2.52
4619 4972 6.976349 GGTTTTTAGGTTGTTCATCGTCTTTT 59.024 34.615 0.00 0.00 0.00 2.27
4620 4973 7.166970 GGTTTTTAGGTTGTTCATCGTCTTTTC 59.833 37.037 0.00 0.00 0.00 2.29
4621 4974 7.562454 TTTTAGGTTGTTCATCGTCTTTTCT 57.438 32.000 0.00 0.00 0.00 2.52
4622 4975 7.562454 TTTAGGTTGTTCATCGTCTTTTCTT 57.438 32.000 0.00 0.00 0.00 2.52
4623 4976 5.674933 AGGTTGTTCATCGTCTTTTCTTC 57.325 39.130 0.00 0.00 0.00 2.87
4624 4977 4.211374 AGGTTGTTCATCGTCTTTTCTTCG 59.789 41.667 0.00 0.00 0.00 3.79
4625 4978 4.455124 GTTGTTCATCGTCTTTTCTTCGG 58.545 43.478 0.00 0.00 0.00 4.30
4626 4979 2.478894 TGTTCATCGTCTTTTCTTCGGC 59.521 45.455 0.00 0.00 0.00 5.54
4627 4980 1.346365 TCATCGTCTTTTCTTCGGCG 58.654 50.000 0.00 0.00 0.00 6.46
4628 4981 0.370273 CATCGTCTTTTCTTCGGCGG 59.630 55.000 7.21 0.00 0.00 6.13
4629 4982 1.359459 ATCGTCTTTTCTTCGGCGGC 61.359 55.000 7.21 0.00 0.00 6.53
4630 4983 2.474712 GTCTTTTCTTCGGCGGCG 59.525 61.111 27.15 27.15 0.00 6.46
4631 4984 2.025418 GTCTTTTCTTCGGCGGCGA 61.025 57.895 31.46 31.46 0.00 5.54
4632 4985 2.025418 TCTTTTCTTCGGCGGCGAC 61.025 57.895 34.85 7.01 0.00 5.19
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 3.384014 GACCTCCAGTCTCGACGCG 62.384 68.421 3.53 3.53 42.69 6.01
1 2 2.486042 GACCTCCAGTCTCGACGC 59.514 66.667 0.00 0.00 42.69 5.19
8 9 4.570930 CTTTGAACCTAAGACCTCCAGTC 58.429 47.826 0.00 0.00 46.71 3.51
9 10 3.244596 GCTTTGAACCTAAGACCTCCAGT 60.245 47.826 0.00 0.00 0.00 4.00
10 11 3.244561 TGCTTTGAACCTAAGACCTCCAG 60.245 47.826 0.00 0.00 0.00 3.86
11 12 2.708861 TGCTTTGAACCTAAGACCTCCA 59.291 45.455 0.00 0.00 0.00 3.86
12 13 3.075148 GTGCTTTGAACCTAAGACCTCC 58.925 50.000 0.00 0.00 0.00 4.30
13 14 4.009370 AGTGCTTTGAACCTAAGACCTC 57.991 45.455 0.00 0.00 0.00 3.85
14 15 4.593634 AGTAGTGCTTTGAACCTAAGACCT 59.406 41.667 0.00 0.00 0.00 3.85
15 16 4.691216 CAGTAGTGCTTTGAACCTAAGACC 59.309 45.833 0.00 0.00 0.00 3.85
16 17 5.298347 ACAGTAGTGCTTTGAACCTAAGAC 58.702 41.667 0.00 0.00 0.00 3.01
17 18 5.546621 ACAGTAGTGCTTTGAACCTAAGA 57.453 39.130 0.00 0.00 0.00 2.10
18 19 7.724305 TTTACAGTAGTGCTTTGAACCTAAG 57.276 36.000 0.00 0.00 0.00 2.18
19 20 8.508883 TTTTTACAGTAGTGCTTTGAACCTAA 57.491 30.769 0.00 0.00 0.00 2.69
44 45 9.524496 ACTAAATAAAAACGGAGGGAGTATTTT 57.476 29.630 0.00 0.00 0.00 1.82
45 46 9.170734 GACTAAATAAAAACGGAGGGAGTATTT 57.829 33.333 0.00 0.00 0.00 1.40
46 47 7.772292 GGACTAAATAAAAACGGAGGGAGTATT 59.228 37.037 0.00 0.00 0.00 1.89
47 48 7.278135 GGACTAAATAAAAACGGAGGGAGTAT 58.722 38.462 0.00 0.00 0.00 2.12
48 49 6.627953 CGGACTAAATAAAAACGGAGGGAGTA 60.628 42.308 0.00 0.00 0.00 2.59
49 50 5.494724 GGACTAAATAAAAACGGAGGGAGT 58.505 41.667 0.00 0.00 0.00 3.85
50 51 4.569564 CGGACTAAATAAAAACGGAGGGAG 59.430 45.833 0.00 0.00 0.00 4.30
51 52 4.506758 CGGACTAAATAAAAACGGAGGGA 58.493 43.478 0.00 0.00 0.00 4.20
52 53 3.064408 GCGGACTAAATAAAAACGGAGGG 59.936 47.826 0.00 0.00 0.00 4.30
53 54 3.242188 CGCGGACTAAATAAAAACGGAGG 60.242 47.826 0.00 0.00 0.00 4.30
54 55 3.368843 ACGCGGACTAAATAAAAACGGAG 59.631 43.478 12.47 0.00 0.00 4.63
55 56 3.324993 ACGCGGACTAAATAAAAACGGA 58.675 40.909 12.47 0.00 0.00 4.69
56 57 3.727780 ACGCGGACTAAATAAAAACGG 57.272 42.857 12.47 0.00 0.00 4.44
57 58 6.567512 GCTTATACGCGGACTAAATAAAAACG 59.432 38.462 12.47 0.00 0.00 3.60
58 59 7.624661 AGCTTATACGCGGACTAAATAAAAAC 58.375 34.615 12.47 0.00 34.40 2.43
59 60 7.775397 AGCTTATACGCGGACTAAATAAAAA 57.225 32.000 12.47 0.00 34.40 1.94
60 61 7.775397 AAGCTTATACGCGGACTAAATAAAA 57.225 32.000 12.47 0.00 34.40 1.52
61 62 7.492020 TCAAAGCTTATACGCGGACTAAATAAA 59.508 33.333 12.47 0.00 34.40 1.40
62 63 6.979817 TCAAAGCTTATACGCGGACTAAATAA 59.020 34.615 12.47 0.00 34.40 1.40
63 64 6.506147 TCAAAGCTTATACGCGGACTAAATA 58.494 36.000 12.47 0.00 34.40 1.40
64 65 5.353938 TCAAAGCTTATACGCGGACTAAAT 58.646 37.500 12.47 0.00 34.40 1.40
65 66 4.746729 TCAAAGCTTATACGCGGACTAAA 58.253 39.130 12.47 0.00 34.40 1.85
66 67 4.374843 TCAAAGCTTATACGCGGACTAA 57.625 40.909 12.47 4.07 34.40 2.24
67 68 4.579454 ATCAAAGCTTATACGCGGACTA 57.421 40.909 12.47 0.00 34.40 2.59
68 69 2.953466 TCAAAGCTTATACGCGGACT 57.047 45.000 12.47 0.00 34.40 3.85
69 70 5.646467 TTTATCAAAGCTTATACGCGGAC 57.354 39.130 12.47 0.00 34.40 4.79
70 71 5.813672 ACTTTTATCAAAGCTTATACGCGGA 59.186 36.000 12.47 0.00 43.03 5.54
71 72 6.044512 ACTTTTATCAAAGCTTATACGCGG 57.955 37.500 12.47 0.00 43.03 6.46
72 73 6.701937 TGACTTTTATCAAAGCTTATACGCG 58.298 36.000 3.53 3.53 43.03 6.01
73 74 7.164335 GCTTGACTTTTATCAAAGCTTATACGC 59.836 37.037 0.00 0.00 43.03 4.42
74 75 8.391106 AGCTTGACTTTTATCAAAGCTTATACG 58.609 33.333 0.00 0.00 43.03 3.06
89 90 9.529325 GGTCAAAGTTTATAAAGCTTGACTTTT 57.471 29.630 29.50 10.50 46.73 2.27
91 92 8.232913 TGGTCAAAGTTTATAAAGCTTGACTT 57.767 30.769 29.50 16.55 38.94 3.01
92 93 7.817418 TGGTCAAAGTTTATAAAGCTTGACT 57.183 32.000 29.50 12.88 38.94 3.41
93 94 8.507470 CTTGGTCAAAGTTTATAAAGCTTGAC 57.493 34.615 26.50 26.50 38.59 3.18
245 246 8.055279 TCAGAGTTGATTGAAGTCAAGTTTTT 57.945 30.769 0.00 0.00 40.79 1.94
246 247 7.630242 TCAGAGTTGATTGAAGTCAAGTTTT 57.370 32.000 0.00 0.00 40.79 2.43
247 248 7.814264 ATCAGAGTTGATTGAAGTCAAGTTT 57.186 32.000 0.00 0.00 41.24 2.66
248 249 8.944029 CATATCAGAGTTGATTGAAGTCAAGTT 58.056 33.333 0.00 0.00 41.24 2.66
249 250 7.065563 GCATATCAGAGTTGATTGAAGTCAAGT 59.934 37.037 0.00 0.00 41.24 3.16
250 251 7.065443 TGCATATCAGAGTTGATTGAAGTCAAG 59.935 37.037 0.00 0.00 41.24 3.02
251 252 6.880529 TGCATATCAGAGTTGATTGAAGTCAA 59.119 34.615 0.00 0.00 41.24 3.18
252 253 6.408869 TGCATATCAGAGTTGATTGAAGTCA 58.591 36.000 0.00 0.00 41.24 3.41
253 254 6.915544 TGCATATCAGAGTTGATTGAAGTC 57.084 37.500 0.00 0.00 41.24 3.01
254 255 7.392673 ACTTTGCATATCAGAGTTGATTGAAGT 59.607 33.333 0.00 0.00 41.24 3.01
255 256 7.759465 ACTTTGCATATCAGAGTTGATTGAAG 58.241 34.615 0.00 0.00 41.24 3.02
256 257 7.692460 ACTTTGCATATCAGAGTTGATTGAA 57.308 32.000 0.00 0.00 41.24 2.69
257 258 8.791327 TTACTTTGCATATCAGAGTTGATTGA 57.209 30.769 0.00 0.00 41.24 2.57
266 267 9.781834 CCGTTTTTATTTACTTTGCATATCAGA 57.218 29.630 0.00 0.00 0.00 3.27
267 268 9.781834 TCCGTTTTTATTTACTTTGCATATCAG 57.218 29.630 0.00 0.00 0.00 2.90
268 269 9.781834 CTCCGTTTTTATTTACTTTGCATATCA 57.218 29.630 0.00 0.00 0.00 2.15
269 270 9.233232 CCTCCGTTTTTATTTACTTTGCATATC 57.767 33.333 0.00 0.00 0.00 1.63
270 271 8.194769 CCCTCCGTTTTTATTTACTTTGCATAT 58.805 33.333 0.00 0.00 0.00 1.78
271 272 7.393796 TCCCTCCGTTTTTATTTACTTTGCATA 59.606 33.333 0.00 0.00 0.00 3.14
272 273 6.209788 TCCCTCCGTTTTTATTTACTTTGCAT 59.790 34.615 0.00 0.00 0.00 3.96
273 274 5.535406 TCCCTCCGTTTTTATTTACTTTGCA 59.465 36.000 0.00 0.00 0.00 4.08
274 275 6.016213 TCCCTCCGTTTTTATTTACTTTGC 57.984 37.500 0.00 0.00 0.00 3.68
275 276 7.210718 ACTCCCTCCGTTTTTATTTACTTTG 57.789 36.000 0.00 0.00 0.00 2.77
276 277 7.938490 TGTACTCCCTCCGTTTTTATTTACTTT 59.062 33.333 0.00 0.00 0.00 2.66
277 278 7.452562 TGTACTCCCTCCGTTTTTATTTACTT 58.547 34.615 0.00 0.00 0.00 2.24
278 279 7.008021 TGTACTCCCTCCGTTTTTATTTACT 57.992 36.000 0.00 0.00 0.00 2.24
279 280 7.854557 ATGTACTCCCTCCGTTTTTATTTAC 57.145 36.000 0.00 0.00 0.00 2.01
280 281 8.761689 ACTATGTACTCCCTCCGTTTTTATTTA 58.238 33.333 0.00 0.00 0.00 1.40
281 282 7.627311 ACTATGTACTCCCTCCGTTTTTATTT 58.373 34.615 0.00 0.00 0.00 1.40
282 283 7.191593 ACTATGTACTCCCTCCGTTTTTATT 57.808 36.000 0.00 0.00 0.00 1.40
283 284 6.803366 ACTATGTACTCCCTCCGTTTTTAT 57.197 37.500 0.00 0.00 0.00 1.40
284 285 7.716799 TTACTATGTACTCCCTCCGTTTTTA 57.283 36.000 0.00 0.00 0.00 1.52
285 286 6.610075 TTACTATGTACTCCCTCCGTTTTT 57.390 37.500 0.00 0.00 0.00 1.94
286 287 6.803366 ATTACTATGTACTCCCTCCGTTTT 57.197 37.500 0.00 0.00 0.00 2.43
287 288 7.065504 ACTATTACTATGTACTCCCTCCGTTT 58.934 38.462 0.00 0.00 0.00 3.60
288 289 6.608922 ACTATTACTATGTACTCCCTCCGTT 58.391 40.000 0.00 0.00 0.00 4.44
289 290 6.198237 ACTATTACTATGTACTCCCTCCGT 57.802 41.667 0.00 0.00 0.00 4.69
290 291 8.675504 CATTACTATTACTATGTACTCCCTCCG 58.324 40.741 0.00 0.00 0.00 4.63
291 292 8.968969 CCATTACTATTACTATGTACTCCCTCC 58.031 40.741 0.00 0.00 0.00 4.30
292 293 9.750783 TCCATTACTATTACTATGTACTCCCTC 57.249 37.037 0.00 0.00 0.00 4.30
293 294 9.531158 GTCCATTACTATTACTATGTACTCCCT 57.469 37.037 0.00 0.00 0.00 4.20
294 295 8.457261 CGTCCATTACTATTACTATGTACTCCC 58.543 40.741 0.00 0.00 0.00 4.30
295 296 7.967303 GCGTCCATTACTATTACTATGTACTCC 59.033 40.741 0.00 0.00 0.00 3.85
296 297 8.728833 AGCGTCCATTACTATTACTATGTACTC 58.271 37.037 0.00 0.00 0.00 2.59
297 298 8.632906 AGCGTCCATTACTATTACTATGTACT 57.367 34.615 0.00 0.00 0.00 2.73
298 299 9.125906 CAAGCGTCCATTACTATTACTATGTAC 57.874 37.037 0.00 0.00 0.00 2.90
299 300 9.070179 TCAAGCGTCCATTACTATTACTATGTA 57.930 33.333 0.00 0.00 0.00 2.29
300 301 7.948357 TCAAGCGTCCATTACTATTACTATGT 58.052 34.615 0.00 0.00 0.00 2.29
301 302 8.812147 TTCAAGCGTCCATTACTATTACTATG 57.188 34.615 0.00 0.00 0.00 2.23
302 303 8.088981 CCTTCAAGCGTCCATTACTATTACTAT 58.911 37.037 0.00 0.00 0.00 2.12
303 304 7.431249 CCTTCAAGCGTCCATTACTATTACTA 58.569 38.462 0.00 0.00 0.00 1.82
304 305 6.281405 CCTTCAAGCGTCCATTACTATTACT 58.719 40.000 0.00 0.00 0.00 2.24
305 306 5.465724 CCCTTCAAGCGTCCATTACTATTAC 59.534 44.000 0.00 0.00 0.00 1.89
306 307 5.607477 CCCTTCAAGCGTCCATTACTATTA 58.393 41.667 0.00 0.00 0.00 0.98
307 308 4.451900 CCCTTCAAGCGTCCATTACTATT 58.548 43.478 0.00 0.00 0.00 1.73
308 309 3.744530 GCCCTTCAAGCGTCCATTACTAT 60.745 47.826 0.00 0.00 0.00 2.12
309 310 2.419574 GCCCTTCAAGCGTCCATTACTA 60.420 50.000 0.00 0.00 0.00 1.82
347 348 0.596577 CGTGTCTCGACCTCCTTCAA 59.403 55.000 0.00 0.00 42.86 2.69
348 349 1.863662 GCGTGTCTCGACCTCCTTCA 61.864 60.000 0.00 0.00 42.86 3.02
349 350 1.153997 GCGTGTCTCGACCTCCTTC 60.154 63.158 0.00 0.00 42.86 3.46
350 351 2.963371 GCGTGTCTCGACCTCCTT 59.037 61.111 0.00 0.00 42.86 3.36
351 352 3.432588 CGCGTGTCTCGACCTCCT 61.433 66.667 0.00 0.00 42.86 3.69
354 355 4.406173 CTGCGCGTGTCTCGACCT 62.406 66.667 8.43 0.00 42.86 3.85
395 440 0.037046 CCGCTACTACAAAACCCCGT 60.037 55.000 0.00 0.00 0.00 5.28
396 441 0.741927 CCCGCTACTACAAAACCCCG 60.742 60.000 0.00 0.00 0.00 5.73
397 442 1.028330 GCCCGCTACTACAAAACCCC 61.028 60.000 0.00 0.00 0.00 4.95
398 443 1.028330 GGCCCGCTACTACAAAACCC 61.028 60.000 0.00 0.00 0.00 4.11
399 444 0.035725 AGGCCCGCTACTACAAAACC 60.036 55.000 0.00 0.00 0.00 3.27
400 445 2.678471 TAGGCCCGCTACTACAAAAC 57.322 50.000 0.00 0.00 0.00 2.43
401 446 2.743838 GCATAGGCCCGCTACTACAAAA 60.744 50.000 0.00 0.00 0.00 2.44
402 447 1.202604 GCATAGGCCCGCTACTACAAA 60.203 52.381 0.00 0.00 0.00 2.83
403 448 0.391597 GCATAGGCCCGCTACTACAA 59.608 55.000 0.00 0.00 0.00 2.41
404 449 0.469331 AGCATAGGCCCGCTACTACA 60.469 55.000 10.05 0.00 42.56 2.74
405 450 1.542492 TAGCATAGGCCCGCTACTAC 58.458 55.000 13.62 0.00 42.56 2.73
406 451 2.168496 CTTAGCATAGGCCCGCTACTA 58.832 52.381 16.49 5.03 40.34 1.82
407 452 0.969894 CTTAGCATAGGCCCGCTACT 59.030 55.000 16.49 3.71 40.34 2.57
408 453 0.966920 TCTTAGCATAGGCCCGCTAC 59.033 55.000 16.49 0.00 40.34 3.58
409 454 1.938585 ATCTTAGCATAGGCCCGCTA 58.061 50.000 13.62 13.62 42.56 4.26
410 455 1.059913 AATCTTAGCATAGGCCCGCT 58.940 50.000 15.50 15.50 42.56 5.52
411 456 1.160137 CAATCTTAGCATAGGCCCGC 58.840 55.000 0.00 0.00 42.56 6.13
412 457 1.160137 GCAATCTTAGCATAGGCCCG 58.840 55.000 0.00 0.00 42.56 6.13
413 458 2.431454 GAGCAATCTTAGCATAGGCCC 58.569 52.381 0.00 0.00 42.56 5.80
414 459 2.072298 CGAGCAATCTTAGCATAGGCC 58.928 52.381 0.00 0.00 42.56 5.19
415 460 2.072298 CCGAGCAATCTTAGCATAGGC 58.928 52.381 0.00 0.00 41.61 3.93
416 461 2.072298 GCCGAGCAATCTTAGCATAGG 58.928 52.381 0.00 0.00 0.00 2.57
417 462 2.735663 CAGCCGAGCAATCTTAGCATAG 59.264 50.000 0.00 0.00 0.00 2.23
418 463 2.548707 CCAGCCGAGCAATCTTAGCATA 60.549 50.000 0.00 0.00 0.00 3.14
419 464 1.590932 CAGCCGAGCAATCTTAGCAT 58.409 50.000 0.00 0.00 0.00 3.79
420 465 0.462581 CCAGCCGAGCAATCTTAGCA 60.463 55.000 0.00 0.00 0.00 3.49
443 489 0.466124 AAGGTTCGATAGCCCAGAGC 59.534 55.000 0.00 0.00 44.25 4.09
446 492 3.536956 TTGTAAGGTTCGATAGCCCAG 57.463 47.619 0.00 0.00 0.00 4.45
461 507 7.388500 CGTCTTGGTTTAGGGTTCTTATTGTAA 59.612 37.037 0.00 0.00 0.00 2.41
498 544 4.404098 CGACGGGGAAGGGTTGGG 62.404 72.222 0.00 0.00 0.00 4.12
499 545 3.600898 GACGACGGGGAAGGGTTGG 62.601 68.421 0.00 0.00 0.00 3.77
501 547 1.896122 GATGACGACGGGGAAGGGTT 61.896 60.000 0.00 0.00 0.00 4.11
502 548 2.284405 ATGACGACGGGGAAGGGT 60.284 61.111 0.00 0.00 0.00 4.34
503 549 2.499685 GATGACGACGGGGAAGGG 59.500 66.667 0.00 0.00 0.00 3.95
504 550 1.686325 ATGGATGACGACGGGGAAGG 61.686 60.000 0.00 0.00 0.00 3.46
505 551 1.037493 TATGGATGACGACGGGGAAG 58.963 55.000 0.00 0.00 0.00 3.46
506 552 1.137479 GTTATGGATGACGACGGGGAA 59.863 52.381 0.00 0.00 0.00 3.97
507 553 0.748450 GTTATGGATGACGACGGGGA 59.252 55.000 0.00 0.00 0.00 4.81
508 554 0.750850 AGTTATGGATGACGACGGGG 59.249 55.000 0.00 0.00 0.00 5.73
509 555 1.407618 TGAGTTATGGATGACGACGGG 59.592 52.381 0.00 0.00 0.00 5.28
510 556 2.460918 GTGAGTTATGGATGACGACGG 58.539 52.381 0.00 0.00 0.00 4.79
511 557 2.099263 AGGTGAGTTATGGATGACGACG 59.901 50.000 0.00 0.00 0.00 5.12
512 558 3.491104 GGAGGTGAGTTATGGATGACGAC 60.491 52.174 0.00 0.00 0.00 4.34
513 559 2.693591 GGAGGTGAGTTATGGATGACGA 59.306 50.000 0.00 0.00 0.00 4.20
581 630 3.196469 TGATGAATCTGACCTGACCTGAC 59.804 47.826 0.00 0.00 0.00 3.51
590 639 6.825610 AGTTAGGAGAATGATGAATCTGACC 58.174 40.000 0.00 0.00 0.00 4.02
591 640 9.823647 TTTAGTTAGGAGAATGATGAATCTGAC 57.176 33.333 0.00 0.00 0.00 3.51
604 653 3.192466 GCGGCGATTTTAGTTAGGAGAA 58.808 45.455 12.98 0.00 0.00 2.87
635 684 0.796927 GGCCAGCTAAACGAACTGAC 59.203 55.000 0.00 0.00 33.10 3.51
639 688 0.521735 CCAAGGCCAGCTAAACGAAC 59.478 55.000 5.01 0.00 0.00 3.95
682 731 6.669631 TCCTACATCAGTATAACTCCTGACA 58.330 40.000 0.00 0.00 40.30 3.58
683 732 6.773685 ACTCCTACATCAGTATAACTCCTGAC 59.226 42.308 0.00 0.00 40.30 3.51
684 733 6.912426 ACTCCTACATCAGTATAACTCCTGA 58.088 40.000 0.00 0.00 41.61 3.86
685 734 7.094549 GCTACTCCTACATCAGTATAACTCCTG 60.095 44.444 0.00 0.00 0.00 3.86
686 735 6.943718 GCTACTCCTACATCAGTATAACTCCT 59.056 42.308 0.00 0.00 0.00 3.69
687 736 6.943718 AGCTACTCCTACATCAGTATAACTCC 59.056 42.308 0.00 0.00 0.00 3.85
688 737 7.094549 CCAGCTACTCCTACATCAGTATAACTC 60.095 44.444 0.00 0.00 0.00 3.01
689 738 6.717540 CCAGCTACTCCTACATCAGTATAACT 59.282 42.308 0.00 0.00 0.00 2.24
690 739 6.490721 ACCAGCTACTCCTACATCAGTATAAC 59.509 42.308 0.00 0.00 0.00 1.89
691 740 6.490381 CACCAGCTACTCCTACATCAGTATAA 59.510 42.308 0.00 0.00 0.00 0.98
692 741 6.004574 CACCAGCTACTCCTACATCAGTATA 58.995 44.000 0.00 0.00 0.00 1.47
693 742 4.830046 CACCAGCTACTCCTACATCAGTAT 59.170 45.833 0.00 0.00 0.00 2.12
694 743 4.207955 CACCAGCTACTCCTACATCAGTA 58.792 47.826 0.00 0.00 0.00 2.74
695 744 3.027412 CACCAGCTACTCCTACATCAGT 58.973 50.000 0.00 0.00 0.00 3.41
696 745 3.027412 ACACCAGCTACTCCTACATCAG 58.973 50.000 0.00 0.00 0.00 2.90
697 746 3.101643 ACACCAGCTACTCCTACATCA 57.898 47.619 0.00 0.00 0.00 3.07
698 747 3.318557 GGTACACCAGCTACTCCTACATC 59.681 52.174 0.00 0.00 35.64 3.06
699 748 3.297736 GGTACACCAGCTACTCCTACAT 58.702 50.000 0.00 0.00 35.64 2.29
700 749 2.622452 GGGTACACCAGCTACTCCTACA 60.622 54.545 0.00 0.00 39.85 2.74
701 750 2.030371 GGGTACACCAGCTACTCCTAC 58.970 57.143 0.00 0.00 39.85 3.18
702 751 1.063417 GGGGTACACCAGCTACTCCTA 60.063 57.143 10.04 0.00 42.91 2.94
703 752 0.325390 GGGGTACACCAGCTACTCCT 60.325 60.000 10.04 0.00 42.91 3.69
704 753 1.335882 GGGGGTACACCAGCTACTCC 61.336 65.000 17.96 0.00 42.91 3.85
705 754 0.616679 TGGGGGTACACCAGCTACTC 60.617 60.000 17.96 0.00 42.91 2.59
706 755 1.472460 TGGGGGTACACCAGCTACT 59.528 57.895 17.96 0.00 42.91 2.57
707 756 4.140354 TGGGGGTACACCAGCTAC 57.860 61.111 17.96 0.00 42.91 3.58
713 762 4.338710 TTGCGCTGGGGGTACACC 62.339 66.667 5.24 5.24 39.11 4.16
714 763 3.053896 GTTGCGCTGGGGGTACAC 61.054 66.667 9.73 0.00 0.00 2.90
715 764 4.338710 GGTTGCGCTGGGGGTACA 62.339 66.667 9.73 0.00 0.00 2.90
716 765 4.029809 AGGTTGCGCTGGGGGTAC 62.030 66.667 9.73 0.00 0.00 3.34
717 766 4.028490 CAGGTTGCGCTGGGGGTA 62.028 66.667 9.73 0.00 0.00 3.69
719 768 3.561120 TAACAGGTTGCGCTGGGGG 62.561 63.158 9.73 0.00 0.00 5.40
727 776 2.287977 AAAGGGGAGTAACAGGTTGC 57.712 50.000 0.00 0.00 0.00 4.17
754 803 3.392285 ACCGACCAGTAATTTATACCCCC 59.608 47.826 0.00 0.00 0.00 5.40
755 804 4.694760 ACCGACCAGTAATTTATACCCC 57.305 45.455 0.00 0.00 0.00 4.95
756 805 5.430886 ACAACCGACCAGTAATTTATACCC 58.569 41.667 0.00 0.00 0.00 3.69
816 865 2.690497 CGTACACAGAGGGACATCATCT 59.310 50.000 0.00 0.00 0.00 2.90
819 868 1.182667 CCGTACACAGAGGGACATCA 58.817 55.000 0.00 0.00 0.00 3.07
834 883 7.713507 CCCAGAGTTATAAATGAATTCACCGTA 59.286 37.037 11.07 3.75 0.00 4.02
837 886 8.519799 TTCCCAGAGTTATAAATGAATTCACC 57.480 34.615 11.07 0.00 0.00 4.02
901 950 7.601856 ACAATGACCACCAAGTAATAAATGTG 58.398 34.615 0.00 0.00 0.00 3.21
979 1028 6.000219 ACATCTAAAACAGAGTGAATGCAGT 59.000 36.000 0.00 0.00 36.48 4.40
980 1029 6.148315 TGACATCTAAAACAGAGTGAATGCAG 59.852 38.462 0.00 0.00 36.48 4.41
983 1032 7.864686 TGTTGACATCTAAAACAGAGTGAATG 58.135 34.615 0.00 0.00 36.48 2.67
1024 1077 0.607489 CCAACTGCAGAACTGGGAGG 60.607 60.000 23.35 5.97 0.00 4.30
1074 1127 4.101448 AGGTGATCCGTGGGCAGC 62.101 66.667 0.00 0.00 39.05 5.25
1084 1137 1.403814 TCATCGTCTGGGAGGTGATC 58.596 55.000 0.00 0.00 0.00 2.92
1170 1223 4.460034 TGACCATACTTCTGTGCGTAGTAA 59.540 41.667 0.00 0.00 30.66 2.24
1268 1321 3.515502 AGTTACTTCATGTAGGCTGCAGA 59.484 43.478 20.43 6.09 32.08 4.26
1339 1393 1.079888 GCCGCCTTTCACATTTGGG 60.080 57.895 0.00 0.00 0.00 4.12
1346 1400 1.448985 TCAACATAGCCGCCTTTCAC 58.551 50.000 0.00 0.00 0.00 3.18
1347 1401 2.016318 CATCAACATAGCCGCCTTTCA 58.984 47.619 0.00 0.00 0.00 2.69
1410 1464 6.147821 CACTTTGAATGGATACTCTTCACGTT 59.852 38.462 0.00 0.00 38.22 3.99
1417 1471 6.013379 TCCAAGTCACTTTGAATGGATACTCT 60.013 38.462 7.53 0.00 38.77 3.24
1446 1500 6.006759 TCATCTGCGATCTATCAACAGTAG 57.993 41.667 8.86 4.95 34.22 2.57
1450 1504 6.986250 ACTAATCATCTGCGATCTATCAACA 58.014 36.000 0.00 0.00 0.00 3.33
1480 1534 4.777140 TGCATCGTATTGAGAAATGACG 57.223 40.909 0.00 0.00 34.90 4.35
1607 1661 5.461078 TCCGTAAAGAAATATAAGAGCGTGC 59.539 40.000 0.00 0.00 0.00 5.34
1646 1700 4.443725 CACAGCAACGCAAAACATGAAATA 59.556 37.500 0.00 0.00 0.00 1.40
1836 1890 1.337821 GTACACTGAAAGACGCCTCG 58.662 55.000 0.00 0.00 37.43 4.63
1944 1998 8.755028 TGAAGTTATAGCATGAACCTGTAACTA 58.245 33.333 15.96 5.00 42.56 2.24
1957 2011 7.341805 AGGAACATGACTTGAAGTTATAGCAT 58.658 34.615 0.00 0.00 0.00 3.79
1959 2013 7.617041 AAGGAACATGACTTGAAGTTATAGC 57.383 36.000 0.00 0.00 0.00 2.97
2021 2078 2.109126 GGCTGGTCATCTTCGTGCC 61.109 63.158 0.00 0.00 0.00 5.01
2022 2079 1.078848 AGGCTGGTCATCTTCGTGC 60.079 57.895 0.00 0.00 0.00 5.34
2025 2082 1.066573 ACTTGAGGCTGGTCATCTTCG 60.067 52.381 0.00 0.00 0.00 3.79
2064 2121 5.865013 CACATTTCTGCATAGCAAATGACAA 59.135 36.000 18.13 2.16 38.36 3.18
2118 2175 5.357596 TGCATAGCAAATGACAATAGAAGCA 59.642 36.000 3.43 0.00 34.76 3.91
2130 2187 4.565166 CCACACATTTCTGCATAGCAAATG 59.435 41.667 12.40 12.40 40.47 2.32
2153 2272 4.082787 GGCTGAGAGTAGTCTATGCATCTC 60.083 50.000 19.55 2.19 34.50 2.75
2190 2310 4.412528 AGAGGGAAACTACAAAGACAACCT 59.587 41.667 0.00 0.00 0.00 3.50
2245 2365 1.070134 GTCCAAACCAAAAGGAAGGCC 59.930 52.381 0.00 0.00 32.30 5.19
2308 2428 5.277250 GCATTCAACATCGCAAAAGGAAAAA 60.277 36.000 0.00 0.00 0.00 1.94
2309 2429 4.210955 GCATTCAACATCGCAAAAGGAAAA 59.789 37.500 0.00 0.00 0.00 2.29
2310 2430 3.740321 GCATTCAACATCGCAAAAGGAAA 59.260 39.130 0.00 0.00 0.00 3.13
2311 2431 3.005684 AGCATTCAACATCGCAAAAGGAA 59.994 39.130 0.00 0.00 0.00 3.36
2312 2432 2.557924 AGCATTCAACATCGCAAAAGGA 59.442 40.909 0.00 0.00 0.00 3.36
2313 2433 2.950433 AGCATTCAACATCGCAAAAGG 58.050 42.857 0.00 0.00 0.00 3.11
2314 2434 4.445052 TCAAAGCATTCAACATCGCAAAAG 59.555 37.500 0.00 0.00 0.00 2.27
2315 2435 4.366586 TCAAAGCATTCAACATCGCAAAA 58.633 34.783 0.00 0.00 0.00 2.44
2316 2436 3.974912 TCAAAGCATTCAACATCGCAAA 58.025 36.364 0.00 0.00 0.00 3.68
2317 2437 3.639716 TCAAAGCATTCAACATCGCAA 57.360 38.095 0.00 0.00 0.00 4.85
2318 2438 3.252944 TCTTCAAAGCATTCAACATCGCA 59.747 39.130 0.00 0.00 0.00 5.10
2339 2459 5.324697 GTCAGATAACGGAACAAAAGCATC 58.675 41.667 0.00 0.00 0.00 3.91
2340 2460 4.142902 CGTCAGATAACGGAACAAAAGCAT 60.143 41.667 0.00 0.00 38.96 3.79
2341 2461 3.185594 CGTCAGATAACGGAACAAAAGCA 59.814 43.478 0.00 0.00 38.96 3.91
2342 2462 3.430895 TCGTCAGATAACGGAACAAAAGC 59.569 43.478 0.00 0.00 42.80 3.51
2451 2571 3.693085 CAGGGATTCAGTTCATGACTTGG 59.307 47.826 0.00 0.00 37.77 3.61
2463 2583 1.815003 GTTCTTGTGCCAGGGATTCAG 59.185 52.381 0.00 0.00 0.00 3.02
2499 2619 0.035056 CAGGGGGTTAGTGCCTCTTG 60.035 60.000 0.00 0.00 29.58 3.02
2533 2653 3.005791 AGTTTCTTTGCGGGGATTTCAAG 59.994 43.478 0.00 0.00 0.00 3.02
2544 2664 6.201517 TCTTCAATTTCTGAGTTTCTTTGCG 58.798 36.000 0.00 0.00 34.81 4.85
2627 2748 9.698309 TTTCATGAAACAAAGAGTTACAAACAA 57.302 25.926 16.91 0.00 40.26 2.83
2648 2769 7.015001 AGCAAGGAGAGAAACAAAAGATTTCAT 59.985 33.333 0.78 0.00 38.32 2.57
2655 2776 3.067180 TGCAGCAAGGAGAGAAACAAAAG 59.933 43.478 0.00 0.00 0.00 2.27
2697 2818 9.729281 AACATGCTTCTAAATTGAATTTTGGAT 57.271 25.926 8.60 2.11 33.82 3.41
2707 2828 9.906660 TGGTAAGTAAAACATGCTTCTAAATTG 57.093 29.630 0.00 0.00 35.43 2.32
2721 2842 9.262358 TGTGGCATTTTAAATGGTAAGTAAAAC 57.738 29.630 17.89 0.00 31.47 2.43
2725 2846 8.861086 TCTTTGTGGCATTTTAAATGGTAAGTA 58.139 29.630 17.89 0.00 0.00 2.24
2818 2941 8.697292 TGCCTTTTTAAATGTAAGGTTGTTACT 58.303 29.630 15.40 0.00 40.43 2.24
2819 2942 8.874744 TGCCTTTTTAAATGTAAGGTTGTTAC 57.125 30.769 15.40 2.72 40.43 2.50
2821 2944 8.794335 TTTGCCTTTTTAAATGTAAGGTTGTT 57.206 26.923 15.40 0.00 40.43 2.83
2822 2945 8.972458 ATTTGCCTTTTTAAATGTAAGGTTGT 57.028 26.923 15.40 1.93 40.43 3.32
2833 2956 9.988815 TGCAAGAACTATATTTGCCTTTTTAAA 57.011 25.926 6.61 0.00 44.91 1.52
2834 2957 9.988815 TTGCAAGAACTATATTTGCCTTTTTAA 57.011 25.926 0.00 0.00 44.91 1.52
2837 2960 8.900983 TTTTGCAAGAACTATATTTGCCTTTT 57.099 26.923 0.00 0.00 44.91 2.27
2838 2961 7.118245 GCTTTTGCAAGAACTATATTTGCCTTT 59.882 33.333 0.00 0.00 44.91 3.11
2840 2963 6.101997 GCTTTTGCAAGAACTATATTTGCCT 58.898 36.000 0.00 0.00 44.91 4.75
2841 2964 6.336514 GCTTTTGCAAGAACTATATTTGCC 57.663 37.500 0.00 0.00 44.91 4.52
2851 2974 7.201548 TTCTTTTGAAGATGCTTTTGCAAGAAC 60.202 33.333 0.00 0.00 45.26 3.01
2852 2975 6.817641 TTCTTTTGAAGATGCTTTTGCAAGAA 59.182 30.769 0.00 0.00 45.26 2.52
2853 2976 6.339730 TTCTTTTGAAGATGCTTTTGCAAGA 58.660 32.000 0.00 0.00 45.26 3.02
2854 2977 6.592798 TTCTTTTGAAGATGCTTTTGCAAG 57.407 33.333 0.00 0.00 45.26 4.01
2866 2989 9.950496 AGCAGTCTTATTAGATTCTTTTGAAGA 57.050 29.630 0.00 0.00 42.30 2.87
2867 2990 9.985318 CAGCAGTCTTATTAGATTCTTTTGAAG 57.015 33.333 0.00 0.00 42.30 3.02
2868 2991 8.950210 CCAGCAGTCTTATTAGATTCTTTTGAA 58.050 33.333 0.00 0.00 43.30 2.69
2870 2993 7.148188 TGCCAGCAGTCTTATTAGATTCTTTTG 60.148 37.037 0.00 0.00 31.86 2.44
2871 2994 6.886459 TGCCAGCAGTCTTATTAGATTCTTTT 59.114 34.615 0.00 0.00 31.86 2.27
2873 2996 5.994250 TGCCAGCAGTCTTATTAGATTCTT 58.006 37.500 0.00 0.00 31.86 2.52
2875 2998 5.819901 ACTTGCCAGCAGTCTTATTAGATTC 59.180 40.000 0.00 0.00 31.86 2.52
2877 3000 5.121811 CACTTGCCAGCAGTCTTATTAGAT 58.878 41.667 0.00 0.00 31.86 1.98
2878 3001 4.020218 ACACTTGCCAGCAGTCTTATTAGA 60.020 41.667 0.00 0.00 0.00 2.10
2879 3002 4.093998 CACACTTGCCAGCAGTCTTATTAG 59.906 45.833 0.00 0.00 0.00 1.73
2880 3003 4.002982 CACACTTGCCAGCAGTCTTATTA 58.997 43.478 0.00 0.00 0.00 0.98
2881 3004 2.816087 CACACTTGCCAGCAGTCTTATT 59.184 45.455 0.00 0.00 0.00 1.40
2882 3005 2.038952 TCACACTTGCCAGCAGTCTTAT 59.961 45.455 0.00 0.00 0.00 1.73
2884 3007 0.181114 TCACACTTGCCAGCAGTCTT 59.819 50.000 0.00 0.00 0.00 3.01
2885 3008 0.181114 TTCACACTTGCCAGCAGTCT 59.819 50.000 0.00 0.00 0.00 3.24
2886 3009 0.590195 CTTCACACTTGCCAGCAGTC 59.410 55.000 0.00 0.00 0.00 3.51
2887 3010 0.820891 CCTTCACACTTGCCAGCAGT 60.821 55.000 0.00 0.00 0.00 4.40
2888 3011 0.820891 ACCTTCACACTTGCCAGCAG 60.821 55.000 0.00 0.00 0.00 4.24
2889 3012 0.472044 TACCTTCACACTTGCCAGCA 59.528 50.000 0.00 0.00 0.00 4.41
2891 3014 2.095059 GCAATACCTTCACACTTGCCAG 60.095 50.000 0.00 0.00 36.96 4.85
2892 3015 1.885887 GCAATACCTTCACACTTGCCA 59.114 47.619 0.00 0.00 36.96 4.92
2893 3016 2.162681 AGCAATACCTTCACACTTGCC 58.837 47.619 0.00 0.00 42.36 4.52
2894 3017 4.003648 ACTAGCAATACCTTCACACTTGC 58.996 43.478 0.00 0.00 41.85 4.01
2896 3019 5.187967 AGCTACTAGCAATACCTTCACACTT 59.812 40.000 10.73 0.00 45.56 3.16
2897 3020 4.712337 AGCTACTAGCAATACCTTCACACT 59.288 41.667 10.73 0.00 45.56 3.55
2898 3021 5.012328 AGCTACTAGCAATACCTTCACAC 57.988 43.478 10.73 0.00 45.56 3.82
2927 3050 6.327279 AGCATGTTGTTTTCCTAAGGTAAC 57.673 37.500 0.00 0.00 0.00 2.50
2928 3051 6.969993 AAGCATGTTGTTTTCCTAAGGTAA 57.030 33.333 0.00 0.00 0.00 2.85
2929 3052 6.969993 AAAGCATGTTGTTTTCCTAAGGTA 57.030 33.333 0.00 0.00 0.00 3.08
2931 3054 6.744112 TGTAAAGCATGTTGTTTTCCTAAGG 58.256 36.000 0.00 0.00 33.01 2.69
2932 3055 8.816640 AATGTAAAGCATGTTGTTTTCCTAAG 57.183 30.769 0.00 0.00 37.96 2.18
2933 3056 9.906660 CTAATGTAAAGCATGTTGTTTTCCTAA 57.093 29.630 0.00 0.00 37.96 2.69
2935 3058 7.867403 CACTAATGTAAAGCATGTTGTTTTCCT 59.133 33.333 0.00 0.00 37.96 3.36
2937 3060 8.479280 CACACTAATGTAAAGCATGTTGTTTTC 58.521 33.333 0.00 0.00 36.72 2.29
2938 3061 8.194104 TCACACTAATGTAAAGCATGTTGTTTT 58.806 29.630 0.00 0.00 36.72 2.43
2939 3062 7.711846 TCACACTAATGTAAAGCATGTTGTTT 58.288 30.769 0.00 0.00 36.72 2.83
2941 3064 6.710295 TCTCACACTAATGTAAAGCATGTTGT 59.290 34.615 0.00 0.00 36.72 3.32
2942 3065 7.095060 ACTCTCACACTAATGTAAAGCATGTTG 60.095 37.037 0.00 0.00 36.72 3.33
2943 3066 6.936900 ACTCTCACACTAATGTAAAGCATGTT 59.063 34.615 0.00 0.00 36.72 2.71
2945 3068 6.974932 ACTCTCACACTAATGTAAAGCATG 57.025 37.500 0.00 0.00 36.72 4.06
2946 3069 7.225538 GCATACTCTCACACTAATGTAAAGCAT 59.774 37.037 0.00 0.00 36.72 3.79
2947 3070 6.535150 GCATACTCTCACACTAATGTAAAGCA 59.465 38.462 0.00 0.00 36.72 3.91
2949 3072 8.709386 AAGCATACTCTCACACTAATGTAAAG 57.291 34.615 0.00 0.00 36.72 1.85
2952 3075 9.582431 GTTTAAGCATACTCTCACACTAATGTA 57.418 33.333 0.00 0.00 36.72 2.29
2954 3077 8.479313 TGTTTAAGCATACTCTCACACTAATG 57.521 34.615 0.00 0.00 0.00 1.90
2955 3078 9.102757 CATGTTTAAGCATACTCTCACACTAAT 57.897 33.333 4.33 0.00 0.00 1.73
2956 3079 8.311109 TCATGTTTAAGCATACTCTCACACTAA 58.689 33.333 4.33 0.00 0.00 2.24
2957 3080 7.836842 TCATGTTTAAGCATACTCTCACACTA 58.163 34.615 4.33 0.00 0.00 2.74
2959 3082 6.968131 TCATGTTTAAGCATACTCTCACAC 57.032 37.500 4.33 0.00 0.00 3.82
2960 3083 7.010460 CGATTCATGTTTAAGCATACTCTCACA 59.990 37.037 4.33 0.00 0.00 3.58
2961 3084 7.340699 CGATTCATGTTTAAGCATACTCTCAC 58.659 38.462 4.33 0.00 0.00 3.51
2962 3085 6.479990 CCGATTCATGTTTAAGCATACTCTCA 59.520 38.462 4.33 0.00 0.00 3.27
2963 3086 6.480320 ACCGATTCATGTTTAAGCATACTCTC 59.520 38.462 4.33 0.20 0.00 3.20
2964 3087 6.349300 ACCGATTCATGTTTAAGCATACTCT 58.651 36.000 4.33 0.00 0.00 3.24
2965 3088 6.257849 TGACCGATTCATGTTTAAGCATACTC 59.742 38.462 4.33 2.07 0.00 2.59
2966 3089 6.112734 TGACCGATTCATGTTTAAGCATACT 58.887 36.000 4.33 0.00 0.00 2.12
2968 3091 6.112734 ACTGACCGATTCATGTTTAAGCATA 58.887 36.000 4.33 0.00 32.17 3.14
2969 3092 4.943705 ACTGACCGATTCATGTTTAAGCAT 59.056 37.500 0.00 0.00 32.17 3.79
2970 3093 4.323417 ACTGACCGATTCATGTTTAAGCA 58.677 39.130 0.00 0.00 32.17 3.91
2972 3095 8.540492 GTGTATACTGACCGATTCATGTTTAAG 58.460 37.037 4.17 0.00 32.17 1.85
2973 3096 8.035984 TGTGTATACTGACCGATTCATGTTTAA 58.964 33.333 4.17 0.00 32.17 1.52
2974 3097 7.548967 TGTGTATACTGACCGATTCATGTTTA 58.451 34.615 4.17 0.00 32.17 2.01
2975 3098 6.403049 TGTGTATACTGACCGATTCATGTTT 58.597 36.000 4.17 0.00 32.17 2.83
2976 3099 5.972935 TGTGTATACTGACCGATTCATGTT 58.027 37.500 4.17 0.00 32.17 2.71
2977 3100 5.592104 TGTGTATACTGACCGATTCATGT 57.408 39.130 4.17 0.00 32.17 3.21
2978 3101 7.224557 TCAAATGTGTATACTGACCGATTCATG 59.775 37.037 4.17 0.00 32.17 3.07
2979 3102 7.272244 TCAAATGTGTATACTGACCGATTCAT 58.728 34.615 4.17 0.00 32.17 2.57
2980 3103 6.635755 TCAAATGTGTATACTGACCGATTCA 58.364 36.000 4.17 0.00 0.00 2.57
2981 3104 7.534085 TTCAAATGTGTATACTGACCGATTC 57.466 36.000 4.17 0.00 0.00 2.52
2984 3107 7.915293 AATTTCAAATGTGTATACTGACCGA 57.085 32.000 4.17 0.00 0.00 4.69
2985 3108 8.964420 AAAATTTCAAATGTGTATACTGACCG 57.036 30.769 4.17 0.00 0.00 4.79
3007 3130 9.719355 TGCTCAACTATAGTACAATCAGAAAAA 57.281 29.630 5.65 0.00 0.00 1.94
3008 3131 9.890629 ATGCTCAACTATAGTACAATCAGAAAA 57.109 29.630 5.65 0.00 0.00 2.29
3009 3132 9.890629 AATGCTCAACTATAGTACAATCAGAAA 57.109 29.630 5.65 0.00 0.00 2.52
3010 3133 9.534565 GAATGCTCAACTATAGTACAATCAGAA 57.465 33.333 5.65 0.00 0.00 3.02
3012 3135 8.976471 CAGAATGCTCAACTATAGTACAATCAG 58.024 37.037 5.65 0.00 0.00 2.90
3039 3261 9.669353 GATAAATGTCAATAGTGTAGCAAATGG 57.331 33.333 0.00 0.00 0.00 3.16
3040 3262 9.669353 GGATAAATGTCAATAGTGTAGCAAATG 57.331 33.333 0.00 0.00 0.00 2.32
3045 3267 5.388475 CGCGGATAAATGTCAATAGTGTAGC 60.388 44.000 0.00 0.00 0.00 3.58
3052 3274 4.506288 CACTGTCGCGGATAAATGTCAATA 59.494 41.667 6.13 0.00 0.00 1.90
3053 3275 3.309682 CACTGTCGCGGATAAATGTCAAT 59.690 43.478 6.13 0.00 0.00 2.57
3054 3276 2.670905 CACTGTCGCGGATAAATGTCAA 59.329 45.455 6.13 0.00 0.00 3.18
3055 3277 2.267426 CACTGTCGCGGATAAATGTCA 58.733 47.619 6.13 0.00 0.00 3.58
3056 3278 1.593006 CCACTGTCGCGGATAAATGTC 59.407 52.381 6.13 0.00 0.00 3.06
3057 3279 1.651987 CCACTGTCGCGGATAAATGT 58.348 50.000 6.13 0.00 0.00 2.71
3058 3280 0.304705 GCCACTGTCGCGGATAAATG 59.695 55.000 6.13 0.00 0.00 2.32
3059 3281 0.178068 AGCCACTGTCGCGGATAAAT 59.822 50.000 6.13 0.00 0.00 1.40
3060 3282 0.739462 CAGCCACTGTCGCGGATAAA 60.739 55.000 6.13 0.00 0.00 1.40
3061 3283 1.153647 CAGCCACTGTCGCGGATAA 60.154 57.895 6.13 0.00 0.00 1.75
3062 3284 1.600511 TTCAGCCACTGTCGCGGATA 61.601 55.000 6.13 0.00 30.48 2.59
3063 3285 2.244117 ATTCAGCCACTGTCGCGGAT 62.244 55.000 6.13 0.00 30.48 4.18
3064 3286 2.449031 AATTCAGCCACTGTCGCGGA 62.449 55.000 6.13 0.00 32.61 5.54
3065 3287 1.970917 GAATTCAGCCACTGTCGCGG 61.971 60.000 6.13 0.00 32.61 6.46
3066 3288 1.016130 AGAATTCAGCCACTGTCGCG 61.016 55.000 8.44 0.00 32.61 5.87
3067 3289 0.445436 CAGAATTCAGCCACTGTCGC 59.555 55.000 8.44 0.00 32.61 5.19
3068 3290 0.445436 GCAGAATTCAGCCACTGTCG 59.555 55.000 11.54 0.00 32.61 4.35
3069 3291 1.527034 TGCAGAATTCAGCCACTGTC 58.473 50.000 18.87 0.40 32.61 3.51
3070 3292 1.610522 GTTGCAGAATTCAGCCACTGT 59.389 47.619 18.87 0.00 32.61 3.55
3071 3293 1.610038 TGTTGCAGAATTCAGCCACTG 59.390 47.619 22.09 7.08 0.00 3.66
3072 3294 1.985473 TGTTGCAGAATTCAGCCACT 58.015 45.000 22.09 0.00 0.00 4.00
3073 3295 2.229543 TCATGTTGCAGAATTCAGCCAC 59.770 45.455 18.87 17.89 0.00 5.01
3074 3296 2.516906 TCATGTTGCAGAATTCAGCCA 58.483 42.857 18.87 11.45 0.00 4.75
3075 3297 3.795623 ATCATGTTGCAGAATTCAGCC 57.204 42.857 18.87 6.30 0.00 4.85
3076 3298 9.552114 GTATAATATCATGTTGCAGAATTCAGC 57.448 33.333 15.36 15.36 0.00 4.26
3118 3340 9.851686 TGCAAGTATTCTAAGATGGTATTCAAT 57.148 29.630 0.00 0.00 0.00 2.57
3119 3341 9.679661 TTGCAAGTATTCTAAGATGGTATTCAA 57.320 29.630 0.00 0.00 0.00 2.69
3120 3342 9.330063 CTTGCAAGTATTCTAAGATGGTATTCA 57.670 33.333 18.65 0.00 0.00 2.57
3121 3343 9.547753 TCTTGCAAGTATTCTAAGATGGTATTC 57.452 33.333 25.19 0.00 0.00 1.75
3122 3344 9.905713 TTCTTGCAAGTATTCTAAGATGGTATT 57.094 29.630 25.19 0.00 30.29 1.89
3123 3345 9.553064 CTTCTTGCAAGTATTCTAAGATGGTAT 57.447 33.333 25.19 0.00 30.29 2.73
3124 3346 8.540388 ACTTCTTGCAAGTATTCTAAGATGGTA 58.460 33.333 25.19 0.00 31.86 3.25
3125 3347 7.398024 ACTTCTTGCAAGTATTCTAAGATGGT 58.602 34.615 25.19 4.16 31.86 3.55
3126 3348 7.856145 ACTTCTTGCAAGTATTCTAAGATGG 57.144 36.000 25.19 3.55 31.86 3.51
3129 3351 9.371136 CACATACTTCTTGCAAGTATTCTAAGA 57.629 33.333 25.19 10.78 40.42 2.10
3130 3352 9.155975 ACACATACTTCTTGCAAGTATTCTAAG 57.844 33.333 25.19 20.65 40.42 2.18
3132 3354 9.582431 GTACACATACTTCTTGCAAGTATTCTA 57.418 33.333 25.19 9.74 40.42 2.10
3133 3355 8.094548 TGTACACATACTTCTTGCAAGTATTCT 58.905 33.333 25.19 7.01 40.42 2.40
3134 3356 8.251750 TGTACACATACTTCTTGCAAGTATTC 57.748 34.615 25.19 6.28 40.42 1.75
3135 3357 8.792830 ATGTACACATACTTCTTGCAAGTATT 57.207 30.769 25.19 13.17 40.42 1.89
3137 3359 9.884636 AATATGTACACATACTTCTTGCAAGTA 57.115 29.630 25.19 15.69 41.15 2.24
3138 3360 8.792830 AATATGTACACATACTTCTTGCAAGT 57.207 30.769 25.19 10.54 41.15 3.16
3139 3361 9.708222 GAAATATGTACACATACTTCTTGCAAG 57.292 33.333 20.81 20.81 40.15 4.01
3140 3362 9.225436 TGAAATATGTACACATACTTCTTGCAA 57.775 29.630 18.85 0.00 42.36 4.08
3141 3363 8.664798 GTGAAATATGTACACATACTTCTTGCA 58.335 33.333 18.85 7.29 42.36 4.08
3142 3364 8.883731 AGTGAAATATGTACACATACTTCTTGC 58.116 33.333 18.85 11.86 42.36 4.01
3169 3391 8.745590 GGGCATATTTTCCTCTAAAAACTACAA 58.254 33.333 0.00 0.00 40.37 2.41
3170 3392 8.113462 AGGGCATATTTTCCTCTAAAAACTACA 58.887 33.333 0.00 0.00 40.37 2.74
3171 3393 8.521170 AGGGCATATTTTCCTCTAAAAACTAC 57.479 34.615 0.00 0.00 40.37 2.73
3172 3394 9.541884 AAAGGGCATATTTTCCTCTAAAAACTA 57.458 29.630 0.00 0.00 40.37 2.24
3173 3395 8.314021 CAAAGGGCATATTTTCCTCTAAAAACT 58.686 33.333 0.00 0.00 40.37 2.66
3174 3396 7.064609 GCAAAGGGCATATTTTCCTCTAAAAAC 59.935 37.037 0.00 0.00 40.47 2.43
3175 3397 7.102993 GCAAAGGGCATATTTTCCTCTAAAAA 58.897 34.615 0.00 0.00 40.47 1.94
3176 3398 6.639563 GCAAAGGGCATATTTTCCTCTAAAA 58.360 36.000 0.00 0.00 43.97 1.52
3177 3399 6.220726 GCAAAGGGCATATTTTCCTCTAAA 57.779 37.500 0.00 0.00 43.97 1.85
3178 3400 5.812699 TGGCAAAGGGCATATTTTCCTCTAA 60.813 40.000 0.00 0.00 45.76 2.10
3179 3401 4.325737 TGGCAAAGGGCATATTTTCCTCTA 60.326 41.667 0.00 0.00 45.76 2.43
3180 3402 3.566332 TGGCAAAGGGCATATTTTCCTCT 60.566 43.478 0.00 0.00 45.76 3.69
3181 3403 2.765699 TGGCAAAGGGCATATTTTCCTC 59.234 45.455 0.00 0.00 45.76 3.71
3182 3404 2.831565 TGGCAAAGGGCATATTTTCCT 58.168 42.857 0.00 0.00 45.76 3.36
3192 3414 2.743060 CCAAGGTTGGCAAAGGGC 59.257 61.111 0.00 0.00 42.21 5.19
3201 3423 0.738389 AAGCACGTTGACCAAGGTTG 59.262 50.000 5.47 3.92 37.31 3.77
3202 3424 0.738389 CAAGCACGTTGACCAAGGTT 59.262 50.000 5.47 0.00 38.60 3.50
3203 3425 0.107410 TCAAGCACGTTGACCAAGGT 60.107 50.000 2.63 2.63 40.45 3.50
3204 3426 1.021202 TTCAAGCACGTTGACCAAGG 58.979 50.000 0.00 1.41 45.23 3.61
3205 3427 3.044986 CAATTCAAGCACGTTGACCAAG 58.955 45.455 0.00 0.00 45.23 3.61
3206 3428 2.685388 TCAATTCAAGCACGTTGACCAA 59.315 40.909 0.00 0.00 45.23 3.67
3207 3429 2.290367 CTCAATTCAAGCACGTTGACCA 59.710 45.455 0.00 0.00 45.23 4.02
3208 3430 2.350772 CCTCAATTCAAGCACGTTGACC 60.351 50.000 0.00 0.00 45.23 4.02
3209 3431 2.918131 GCCTCAATTCAAGCACGTTGAC 60.918 50.000 0.00 0.00 45.23 3.18
3210 3432 1.266718 GCCTCAATTCAAGCACGTTGA 59.733 47.619 0.00 0.00 43.82 3.18
3211 3433 1.267806 AGCCTCAATTCAAGCACGTTG 59.732 47.619 0.00 0.00 37.52 4.10
3212 3434 1.609208 AGCCTCAATTCAAGCACGTT 58.391 45.000 0.00 0.00 0.00 3.99
3213 3435 1.609208 AAGCCTCAATTCAAGCACGT 58.391 45.000 0.00 0.00 0.00 4.49
3214 3436 3.374988 TCATAAGCCTCAATTCAAGCACG 59.625 43.478 0.00 0.00 0.00 5.34
3215 3437 4.156556 TGTCATAAGCCTCAATTCAAGCAC 59.843 41.667 0.00 0.00 0.00 4.40
3216 3438 4.156556 GTGTCATAAGCCTCAATTCAAGCA 59.843 41.667 0.00 0.00 0.00 3.91
3217 3439 4.156556 TGTGTCATAAGCCTCAATTCAAGC 59.843 41.667 0.00 0.00 0.00 4.01
3218 3440 5.885230 TGTGTCATAAGCCTCAATTCAAG 57.115 39.130 0.00 0.00 0.00 3.02
3219 3441 7.936496 TTATGTGTCATAAGCCTCAATTCAA 57.064 32.000 0.00 0.00 0.00 2.69
3220 3442 9.625747 TTATTATGTGTCATAAGCCTCAATTCA 57.374 29.630 7.95 0.00 0.00 2.57
3223 3445 9.797642 TGATTATTATGTGTCATAAGCCTCAAT 57.202 29.630 7.95 3.63 0.00 2.57
3224 3446 9.797642 ATGATTATTATGTGTCATAAGCCTCAA 57.202 29.630 7.95 0.07 30.03 3.02
3225 3447 9.797642 AATGATTATTATGTGTCATAAGCCTCA 57.202 29.630 7.95 9.27 31.49 3.86
3250 3472 9.791820 CTGCATAACATCATAATTTTGTCAGAA 57.208 29.630 0.00 0.00 0.00 3.02
3251 3473 7.916977 GCTGCATAACATCATAATTTTGTCAGA 59.083 33.333 0.00 0.00 0.00 3.27
3252 3474 7.168637 GGCTGCATAACATCATAATTTTGTCAG 59.831 37.037 0.50 0.00 0.00 3.51
3253 3475 6.979817 GGCTGCATAACATCATAATTTTGTCA 59.020 34.615 0.50 0.00 0.00 3.58
3254 3476 6.421801 GGGCTGCATAACATCATAATTTTGTC 59.578 38.462 0.50 0.00 0.00 3.18
3255 3477 6.282930 GGGCTGCATAACATCATAATTTTGT 58.717 36.000 0.50 0.00 0.00 2.83
3256 3478 5.697633 GGGGCTGCATAACATCATAATTTTG 59.302 40.000 0.50 0.00 0.00 2.44
3257 3479 5.603813 AGGGGCTGCATAACATCATAATTTT 59.396 36.000 0.50 0.00 0.00 1.82
3258 3480 5.011329 CAGGGGCTGCATAACATCATAATTT 59.989 40.000 0.50 0.00 0.00 1.82
3259 3481 4.525487 CAGGGGCTGCATAACATCATAATT 59.475 41.667 0.50 0.00 0.00 1.40
3260 3482 4.084287 CAGGGGCTGCATAACATCATAAT 58.916 43.478 0.50 0.00 0.00 1.28
3261 3483 3.489355 CAGGGGCTGCATAACATCATAA 58.511 45.455 0.50 0.00 0.00 1.90
3262 3484 2.224843 CCAGGGGCTGCATAACATCATA 60.225 50.000 0.50 0.00 0.00 2.15
3263 3485 1.479942 CCAGGGGCTGCATAACATCAT 60.480 52.381 0.50 0.00 0.00 2.45
3264 3486 0.106569 CCAGGGGCTGCATAACATCA 60.107 55.000 0.50 0.00 0.00 3.07
3265 3487 0.825010 CCCAGGGGCTGCATAACATC 60.825 60.000 0.00 0.00 0.00 3.06
3266 3488 1.231068 CCCAGGGGCTGCATAACAT 59.769 57.895 0.00 0.00 0.00 2.71
3267 3489 1.505151 TTCCCAGGGGCTGCATAACA 61.505 55.000 5.33 0.00 34.68 2.41
3268 3490 0.324275 TTTCCCAGGGGCTGCATAAC 60.324 55.000 5.33 0.00 34.68 1.89
3269 3491 0.033208 CTTTCCCAGGGGCTGCATAA 60.033 55.000 5.33 0.00 34.68 1.90
3270 3492 1.214305 ACTTTCCCAGGGGCTGCATA 61.214 55.000 5.33 0.00 34.68 3.14
3271 3493 2.361771 CTTTCCCAGGGGCTGCAT 59.638 61.111 5.33 0.00 34.68 3.96
3272 3494 3.185203 ACTTTCCCAGGGGCTGCA 61.185 61.111 5.33 0.00 34.68 4.41
3273 3495 2.677875 CACTTTCCCAGGGGCTGC 60.678 66.667 5.33 0.00 34.68 5.25
3274 3496 2.036256 CCACTTTCCCAGGGGCTG 59.964 66.667 5.33 0.00 40.18 4.85
3278 3500 2.309136 ACAATTCCACTTTCCCAGGG 57.691 50.000 0.00 0.00 0.00 4.45
3279 3501 3.089284 GGTACAATTCCACTTTCCCAGG 58.911 50.000 0.00 0.00 0.00 4.45
3280 3502 3.761897 TGGTACAATTCCACTTTCCCAG 58.238 45.455 0.00 0.00 31.92 4.45
3281 3503 3.885976 TGGTACAATTCCACTTTCCCA 57.114 42.857 0.00 0.00 31.92 4.37
3292 3514 7.854943 CGATCACGAGGAGGTTGGTACAATT 62.855 48.000 0.00 0.00 43.26 2.32
3293 3515 6.466889 CGATCACGAGGAGGTTGGTACAAT 62.467 50.000 0.00 0.00 43.26 2.71
3294 3516 5.225327 CGATCACGAGGAGGTTGGTACAA 62.225 52.174 0.00 0.00 43.26 2.41
3295 3517 1.822990 GATCACGAGGAGGTTGGTACA 59.177 52.381 0.00 0.00 0.00 2.90
3296 3518 1.202268 CGATCACGAGGAGGTTGGTAC 60.202 57.143 0.00 0.00 42.66 3.34
3297 3519 1.100510 CGATCACGAGGAGGTTGGTA 58.899 55.000 0.00 0.00 42.66 3.25
3298 3520 0.898789 ACGATCACGAGGAGGTTGGT 60.899 55.000 0.00 0.00 42.66 3.67
3299 3521 0.458543 CACGATCACGAGGAGGTTGG 60.459 60.000 0.00 0.00 42.66 3.77
3300 3522 0.526211 TCACGATCACGAGGAGGTTG 59.474 55.000 0.00 0.00 42.66 3.77
3301 3523 1.135139 CATCACGATCACGAGGAGGTT 59.865 52.381 0.00 0.00 42.66 3.50
3302 3524 0.741326 CATCACGATCACGAGGAGGT 59.259 55.000 0.00 0.00 42.66 3.85
3303 3525 0.741326 ACATCACGATCACGAGGAGG 59.259 55.000 0.00 0.00 42.66 4.30
3304 3526 1.673400 AGACATCACGATCACGAGGAG 59.327 52.381 0.00 0.00 42.66 3.69
3305 3527 1.751437 AGACATCACGATCACGAGGA 58.249 50.000 0.00 0.00 42.66 3.71
3306 3528 2.600084 CGTAGACATCACGATCACGAGG 60.600 54.545 0.00 0.00 41.91 4.63
3307 3529 2.284417 TCGTAGACATCACGATCACGAG 59.716 50.000 0.00 0.00 43.05 4.18
3308 3530 2.273557 TCGTAGACATCACGATCACGA 58.726 47.619 0.00 0.00 43.05 4.35
3309 3531 2.732001 TCGTAGACATCACGATCACG 57.268 50.000 0.00 0.00 43.05 4.35
3315 3537 3.502595 ACCTCCATATCGTAGACATCACG 59.497 47.826 0.00 0.00 42.51 4.35
3316 3538 6.570672 TTACCTCCATATCGTAGACATCAC 57.429 41.667 0.00 0.00 42.51 3.06
3317 3539 7.776618 AATTACCTCCATATCGTAGACATCA 57.223 36.000 0.00 0.00 42.51 3.07
3318 3540 8.958506 AGTAATTACCTCCATATCGTAGACATC 58.041 37.037 12.05 0.00 42.51 3.06
3319 3541 8.880991 AGTAATTACCTCCATATCGTAGACAT 57.119 34.615 12.05 0.00 42.51 3.06
3320 3542 9.224267 GTAGTAATTACCTCCATATCGTAGACA 57.776 37.037 12.05 0.00 42.51 3.41
3351 3573 9.241919 TGAGCCTATGTTCATTTTAAATGAGAA 57.758 29.630 18.09 12.05 0.00 2.87
3352 3574 8.806429 TGAGCCTATGTTCATTTTAAATGAGA 57.194 30.769 18.09 10.98 0.00 3.27
3353 3575 9.459640 CATGAGCCTATGTTCATTTTAAATGAG 57.540 33.333 18.09 8.69 40.05 2.90
3354 3576 8.415553 CCATGAGCCTATGTTCATTTTAAATGA 58.584 33.333 15.46 15.46 40.05 2.57
3355 3577 7.170320 GCCATGAGCCTATGTTCATTTTAAATG 59.830 37.037 11.12 11.12 40.05 2.32
3356 3578 7.147689 TGCCATGAGCCTATGTTCATTTTAAAT 60.148 33.333 0.00 0.00 40.05 1.40
3357 3579 6.154192 TGCCATGAGCCTATGTTCATTTTAAA 59.846 34.615 0.00 0.00 40.05 1.52
3358 3580 5.655974 TGCCATGAGCCTATGTTCATTTTAA 59.344 36.000 0.00 0.00 40.05 1.52
3359 3581 5.199723 TGCCATGAGCCTATGTTCATTTTA 58.800 37.500 0.00 0.00 40.05 1.52
3360 3582 4.025360 TGCCATGAGCCTATGTTCATTTT 58.975 39.130 0.00 0.00 40.05 1.82
3361 3583 3.634504 TGCCATGAGCCTATGTTCATTT 58.365 40.909 0.00 0.00 40.05 2.32
3362 3584 3.220110 CTGCCATGAGCCTATGTTCATT 58.780 45.455 0.00 0.00 40.05 2.57
3363 3585 2.860009 CTGCCATGAGCCTATGTTCAT 58.140 47.619 0.00 0.00 42.42 2.57
3364 3586 1.748244 GCTGCCATGAGCCTATGTTCA 60.748 52.381 0.00 0.00 42.71 3.18
3365 3587 0.950116 GCTGCCATGAGCCTATGTTC 59.050 55.000 0.00 0.00 42.71 3.18
3366 3588 0.256752 TGCTGCCATGAGCCTATGTT 59.743 50.000 4.11 0.00 42.71 2.71
3367 3589 0.256752 TTGCTGCCATGAGCCTATGT 59.743 50.000 4.11 0.00 42.71 2.29
3368 3590 1.337071 CTTTGCTGCCATGAGCCTATG 59.663 52.381 4.11 0.00 42.71 2.23
3369 3591 1.688772 CTTTGCTGCCATGAGCCTAT 58.311 50.000 4.11 0.00 42.71 2.57
3370 3592 1.033746 GCTTTGCTGCCATGAGCCTA 61.034 55.000 4.11 0.00 42.71 3.93
3371 3593 2.348888 GCTTTGCTGCCATGAGCCT 61.349 57.895 4.11 0.00 42.71 4.58
3372 3594 1.885163 AAGCTTTGCTGCCATGAGCC 61.885 55.000 4.11 0.00 39.62 4.70
3373 3595 0.037605 AAAGCTTTGCTGCCATGAGC 60.038 50.000 11.80 0.00 39.62 4.26
3374 3596 3.380637 AGATAAAGCTTTGCTGCCATGAG 59.619 43.478 22.02 0.00 39.62 2.90
3375 3597 3.359033 AGATAAAGCTTTGCTGCCATGA 58.641 40.909 22.02 0.00 39.62 3.07
3376 3598 3.795623 AGATAAAGCTTTGCTGCCATG 57.204 42.857 22.02 0.00 39.62 3.66
3377 3599 3.118884 CCAAGATAAAGCTTTGCTGCCAT 60.119 43.478 22.02 5.76 39.62 4.40
3378 3600 2.231964 CCAAGATAAAGCTTTGCTGCCA 59.768 45.455 22.02 0.25 39.62 4.92
3379 3601 2.232208 ACCAAGATAAAGCTTTGCTGCC 59.768 45.455 22.02 6.06 39.62 4.85
3391 3613 9.255304 GCAAATAAAAAGAACACACCAAGATAA 57.745 29.630 0.00 0.00 0.00 1.75
3392 3614 8.417106 TGCAAATAAAAAGAACACACCAAGATA 58.583 29.630 0.00 0.00 0.00 1.98
3394 3616 6.634805 TGCAAATAAAAAGAACACACCAAGA 58.365 32.000 0.00 0.00 0.00 3.02
3395 3617 6.509997 GCTGCAAATAAAAAGAACACACCAAG 60.510 38.462 0.00 0.00 0.00 3.61
3396 3618 5.293079 GCTGCAAATAAAAAGAACACACCAA 59.707 36.000 0.00 0.00 0.00 3.67
3397 3619 4.808364 GCTGCAAATAAAAAGAACACACCA 59.192 37.500 0.00 0.00 0.00 4.17
3398 3620 5.049828 AGCTGCAAATAAAAAGAACACACC 58.950 37.500 1.02 0.00 0.00 4.16
3399 3621 6.413269 CAAGCTGCAAATAAAAAGAACACAC 58.587 36.000 1.02 0.00 0.00 3.82
3400 3622 5.006552 GCAAGCTGCAAATAAAAAGAACACA 59.993 36.000 1.02 0.00 44.26 3.72
3401 3623 5.434706 GCAAGCTGCAAATAAAAAGAACAC 58.565 37.500 1.02 0.00 44.26 3.32
3402 3624 5.655893 GCAAGCTGCAAATAAAAAGAACA 57.344 34.783 1.02 0.00 44.26 3.18
3439 3661 2.793288 TACGGGAAAAGGATTGGTCC 57.207 50.000 0.00 0.00 45.45 4.46
3442 3664 5.417580 TCAAATCTTACGGGAAAAGGATTGG 59.582 40.000 0.00 0.00 0.00 3.16
3443 3665 6.509418 TCAAATCTTACGGGAAAAGGATTG 57.491 37.500 0.00 0.00 0.00 2.67
3444 3666 6.071560 GGTTCAAATCTTACGGGAAAAGGATT 60.072 38.462 0.00 0.00 0.00 3.01
3446 3668 4.763279 GGTTCAAATCTTACGGGAAAAGGA 59.237 41.667 0.00 0.00 0.00 3.36
3447 3669 4.765339 AGGTTCAAATCTTACGGGAAAAGG 59.235 41.667 0.00 0.00 0.00 3.11
3448 3670 5.390567 CGAGGTTCAAATCTTACGGGAAAAG 60.391 44.000 0.00 0.00 0.00 2.27
3451 3673 3.592059 CGAGGTTCAAATCTTACGGGAA 58.408 45.455 0.00 0.00 0.00 3.97
3452 3674 2.093869 CCGAGGTTCAAATCTTACGGGA 60.094 50.000 0.00 0.00 36.27 5.14
3453 3675 2.093869 TCCGAGGTTCAAATCTTACGGG 60.094 50.000 0.00 0.00 39.62 5.28
3455 3677 5.600908 TTTTCCGAGGTTCAAATCTTACG 57.399 39.130 0.00 0.00 0.00 3.18
3456 3678 6.322491 CCATTTTCCGAGGTTCAAATCTTAC 58.678 40.000 0.00 0.00 0.00 2.34
3459 3681 3.193479 GCCATTTTCCGAGGTTCAAATCT 59.807 43.478 0.00 0.00 0.00 2.40
3460 3682 3.193479 AGCCATTTTCCGAGGTTCAAATC 59.807 43.478 0.00 0.00 0.00 2.17
3461 3683 3.056607 CAGCCATTTTCCGAGGTTCAAAT 60.057 43.478 0.00 0.00 0.00 2.32
3462 3684 2.295909 CAGCCATTTTCCGAGGTTCAAA 59.704 45.455 0.00 0.00 0.00 2.69
3463 3685 1.885887 CAGCCATTTTCCGAGGTTCAA 59.114 47.619 0.00 0.00 0.00 2.69
3464 3686 1.533625 CAGCCATTTTCCGAGGTTCA 58.466 50.000 0.00 0.00 0.00 3.18
3465 3687 0.811281 CCAGCCATTTTCCGAGGTTC 59.189 55.000 0.00 0.00 0.00 3.62
3466 3688 1.250840 GCCAGCCATTTTCCGAGGTT 61.251 55.000 0.00 0.00 0.00 3.50
3467 3689 1.678970 GCCAGCCATTTTCCGAGGT 60.679 57.895 0.00 0.00 0.00 3.85
3468 3690 2.764314 CGCCAGCCATTTTCCGAGG 61.764 63.158 0.00 0.00 0.00 4.63
3469 3691 1.097547 ATCGCCAGCCATTTTCCGAG 61.098 55.000 0.00 0.00 0.00 4.63
3470 3692 1.077787 ATCGCCAGCCATTTTCCGA 60.078 52.632 0.00 0.00 0.00 4.55
3471 3693 1.356624 GATCGCCAGCCATTTTCCG 59.643 57.895 0.00 0.00 0.00 4.30
3472 3694 1.735973 GGATCGCCAGCCATTTTCC 59.264 57.895 0.00 0.00 0.00 3.13
3473 3695 1.356624 CGGATCGCCAGCCATTTTC 59.643 57.895 0.00 0.00 0.00 2.29
3474 3696 2.120909 CCGGATCGCCAGCCATTTT 61.121 57.895 0.00 0.00 0.00 1.82
3475 3697 2.516930 CCGGATCGCCAGCCATTT 60.517 61.111 0.00 0.00 0.00 2.32
3476 3698 3.797353 ACCGGATCGCCAGCCATT 61.797 61.111 9.46 0.00 0.00 3.16
3477 3699 4.552365 CACCGGATCGCCAGCCAT 62.552 66.667 9.46 0.00 0.00 4.40
3490 3712 4.910585 GGTAGATGGGCCGCACCG 62.911 72.222 0.00 0.00 40.62 4.94
3491 3713 4.564110 GGGTAGATGGGCCGCACC 62.564 72.222 0.00 2.92 37.93 5.01
3492 3714 3.757248 CTGGGTAGATGGGCCGCAC 62.757 68.421 0.00 0.00 0.00 5.34
3493 3715 3.479203 CTGGGTAGATGGGCCGCA 61.479 66.667 0.00 0.00 0.00 5.69
3494 3716 2.265467 TTTCTGGGTAGATGGGCCGC 62.265 60.000 0.00 0.00 31.81 6.53
3495 3717 0.254747 TTTTCTGGGTAGATGGGCCG 59.745 55.000 0.00 0.00 31.81 6.13
3496 3718 2.379005 CTTTTTCTGGGTAGATGGGCC 58.621 52.381 0.00 0.00 31.81 5.80
3497 3719 1.751351 GCTTTTTCTGGGTAGATGGGC 59.249 52.381 0.00 0.00 31.81 5.36
3498 3720 3.282885 GAGCTTTTTCTGGGTAGATGGG 58.717 50.000 0.00 0.00 31.81 4.00
3499 3721 3.944015 CTGAGCTTTTTCTGGGTAGATGG 59.056 47.826 0.00 0.00 31.81 3.51
3500 3722 3.376546 GCTGAGCTTTTTCTGGGTAGATG 59.623 47.826 0.00 0.00 31.81 2.90
3501 3723 3.615155 GCTGAGCTTTTTCTGGGTAGAT 58.385 45.455 0.00 0.00 31.81 1.98
3502 3724 2.290323 GGCTGAGCTTTTTCTGGGTAGA 60.290 50.000 3.72 0.00 0.00 2.59
3503 3725 2.087646 GGCTGAGCTTTTTCTGGGTAG 58.912 52.381 3.72 0.00 0.00 3.18
3504 3726 1.423541 TGGCTGAGCTTTTTCTGGGTA 59.576 47.619 3.72 0.00 0.00 3.69
3505 3727 0.185901 TGGCTGAGCTTTTTCTGGGT 59.814 50.000 3.72 0.00 0.00 4.51
3506 3728 1.331214 TTGGCTGAGCTTTTTCTGGG 58.669 50.000 3.72 0.00 0.00 4.45
3507 3729 3.582780 GATTTGGCTGAGCTTTTTCTGG 58.417 45.455 3.72 0.00 0.00 3.86
3508 3730 3.257624 AGGATTTGGCTGAGCTTTTTCTG 59.742 43.478 3.72 0.00 0.00 3.02
3509 3731 3.504375 AGGATTTGGCTGAGCTTTTTCT 58.496 40.909 3.72 0.00 0.00 2.52
3510 3732 3.367806 GGAGGATTTGGCTGAGCTTTTTC 60.368 47.826 3.72 0.00 0.00 2.29
3511 3733 2.564504 GGAGGATTTGGCTGAGCTTTTT 59.435 45.455 3.72 0.00 0.00 1.94
3512 3734 2.174360 GGAGGATTTGGCTGAGCTTTT 58.826 47.619 3.72 0.00 0.00 2.27
3513 3735 1.076024 TGGAGGATTTGGCTGAGCTTT 59.924 47.619 3.72 0.00 0.00 3.51
3514 3736 0.700564 TGGAGGATTTGGCTGAGCTT 59.299 50.000 3.72 0.00 0.00 3.74
3515 3737 0.924823 ATGGAGGATTTGGCTGAGCT 59.075 50.000 3.72 0.00 0.00 4.09
3516 3738 1.772836 AATGGAGGATTTGGCTGAGC 58.227 50.000 0.00 0.00 0.00 4.26
3517 3739 3.750130 CGATAATGGAGGATTTGGCTGAG 59.250 47.826 0.00 0.00 0.00 3.35
3518 3740 3.390967 TCGATAATGGAGGATTTGGCTGA 59.609 43.478 0.00 0.00 0.00 4.26
3519 3741 3.743521 TCGATAATGGAGGATTTGGCTG 58.256 45.455 0.00 0.00 0.00 4.85
3520 3742 4.392940 CTTCGATAATGGAGGATTTGGCT 58.607 43.478 0.00 0.00 0.00 4.75
3521 3743 3.057946 GCTTCGATAATGGAGGATTTGGC 60.058 47.826 0.00 0.00 0.00 4.52
3522 3744 3.503748 GGCTTCGATAATGGAGGATTTGG 59.496 47.826 0.00 0.00 0.00 3.28
3523 3745 4.392940 AGGCTTCGATAATGGAGGATTTG 58.607 43.478 0.00 0.00 0.00 2.32
3524 3746 4.505742 GGAGGCTTCGATAATGGAGGATTT 60.506 45.833 0.00 0.00 0.00 2.17
3525 3747 3.008485 GGAGGCTTCGATAATGGAGGATT 59.992 47.826 0.00 0.00 0.00 3.01
3526 3748 2.569404 GGAGGCTTCGATAATGGAGGAT 59.431 50.000 0.00 0.00 0.00 3.24
3527 3749 1.971357 GGAGGCTTCGATAATGGAGGA 59.029 52.381 0.00 0.00 0.00 3.71
3528 3750 1.974236 AGGAGGCTTCGATAATGGAGG 59.026 52.381 0.00 0.00 0.00 4.30
3529 3751 3.760580 AAGGAGGCTTCGATAATGGAG 57.239 47.619 0.00 0.00 0.00 3.86
3530 3752 3.492656 CGAAAGGAGGCTTCGATAATGGA 60.493 47.826 0.06 0.00 46.73 3.41
3531 3753 2.802816 CGAAAGGAGGCTTCGATAATGG 59.197 50.000 0.06 0.00 46.73 3.16
3532 3754 2.221981 GCGAAAGGAGGCTTCGATAATG 59.778 50.000 10.30 0.00 46.73 1.90
3533 3755 2.103263 AGCGAAAGGAGGCTTCGATAAT 59.897 45.455 10.30 0.00 46.73 1.28
3534 3756 1.480954 AGCGAAAGGAGGCTTCGATAA 59.519 47.619 10.30 0.00 46.73 1.75
3535 3757 1.067212 GAGCGAAAGGAGGCTTCGATA 59.933 52.381 10.30 0.00 44.21 2.92
3536 3758 0.179097 GAGCGAAAGGAGGCTTCGAT 60.179 55.000 10.30 3.57 46.58 3.59
3537 3759 1.215647 GAGCGAAAGGAGGCTTCGA 59.784 57.895 10.30 0.00 46.73 3.71
3538 3760 1.079819 TGAGCGAAAGGAGGCTTCG 60.080 57.895 2.06 2.06 46.55 3.79
3539 3761 1.365368 GCTGAGCGAAAGGAGGCTTC 61.365 60.000 0.00 0.00 40.16 3.86
3540 3762 1.376553 GCTGAGCGAAAGGAGGCTT 60.377 57.895 0.00 0.00 40.16 4.35
3541 3763 2.267324 GCTGAGCGAAAGGAGGCT 59.733 61.111 0.00 0.00 43.42 4.58
3542 3764 1.961180 TAGGCTGAGCGAAAGGAGGC 61.961 60.000 0.00 0.00 0.00 4.70
3543 3765 0.755686 ATAGGCTGAGCGAAAGGAGG 59.244 55.000 0.00 0.00 0.00 4.30
3544 3766 2.611225 AATAGGCTGAGCGAAAGGAG 57.389 50.000 0.00 0.00 0.00 3.69
3545 3767 2.632377 CAAATAGGCTGAGCGAAAGGA 58.368 47.619 0.00 0.00 0.00 3.36
3546 3768 1.672881 CCAAATAGGCTGAGCGAAAGG 59.327 52.381 0.00 0.00 0.00 3.11
3563 3785 2.304831 TGATGGTGGATCCGGCCAA 61.305 57.895 25.58 12.14 40.20 4.52
3567 3789 1.521457 CACGTGATGGTGGATCCGG 60.521 63.158 10.90 0.00 39.52 5.14
3568 3790 0.806102 GTCACGTGATGGTGGATCCG 60.806 60.000 23.12 0.00 38.46 4.18
3569 3791 0.462047 GGTCACGTGATGGTGGATCC 60.462 60.000 23.12 11.64 38.46 3.36
3570 3792 0.249120 TGGTCACGTGATGGTGGATC 59.751 55.000 23.12 5.73 38.46 3.36
3571 3793 0.911769 ATGGTCACGTGATGGTGGAT 59.088 50.000 23.12 4.96 38.46 3.41
3572 3794 0.690192 AATGGTCACGTGATGGTGGA 59.310 50.000 23.12 2.68 38.46 4.02
3573 3795 1.468520 GAAATGGTCACGTGATGGTGG 59.531 52.381 23.12 0.00 38.46 4.61
3576 3798 3.009026 TGATGAAATGGTCACGTGATGG 58.991 45.455 23.12 0.00 39.72 3.51
3577 3799 4.154737 ACTTGATGAAATGGTCACGTGATG 59.845 41.667 23.12 0.00 39.72 3.07
3580 3802 4.690748 AGTACTTGATGAAATGGTCACGTG 59.309 41.667 9.94 9.94 39.72 4.49
3581 3803 4.894784 AGTACTTGATGAAATGGTCACGT 58.105 39.130 0.00 0.00 39.72 4.49
3582 3804 5.867174 TGTAGTACTTGATGAAATGGTCACG 59.133 40.000 0.00 0.00 39.72 4.35
3584 3806 7.549134 GTCATGTAGTACTTGATGAAATGGTCA 59.451 37.037 18.70 0.00 41.67 4.02
3586 3808 6.823689 GGTCATGTAGTACTTGATGAAATGGT 59.176 38.462 18.70 0.00 35.23 3.55
3588 3810 7.848223 TGGTCATGTAGTACTTGATGAAATG 57.152 36.000 18.70 4.81 35.23 2.32
3589 3811 7.064609 CGTTGGTCATGTAGTACTTGATGAAAT 59.935 37.037 18.70 0.00 35.23 2.17
3590 3812 6.367695 CGTTGGTCATGTAGTACTTGATGAAA 59.632 38.462 18.70 12.05 35.23 2.69
3591 3813 5.867174 CGTTGGTCATGTAGTACTTGATGAA 59.133 40.000 18.70 12.72 35.23 2.57
3592 3814 5.047590 ACGTTGGTCATGTAGTACTTGATGA 60.048 40.000 18.70 6.56 35.23 2.92
3595 3817 4.321452 GGACGTTGGTCATGTAGTACTTGA 60.321 45.833 13.38 13.38 45.28 3.02
3596 3818 3.924686 GGACGTTGGTCATGTAGTACTTG 59.075 47.826 0.00 9.39 45.28 3.16
3598 3820 2.494870 GGGACGTTGGTCATGTAGTACT 59.505 50.000 0.00 0.00 45.28 2.73
3615 3837 0.178301 GAAGGATCTGGTTCCGGGAC 59.822 60.000 3.45 3.45 40.94 4.46
3616 3838 0.042731 AGAAGGATCTGGTTCCGGGA 59.957 55.000 0.00 0.00 40.94 5.14
3617 3839 1.413077 GTAGAAGGATCTGGTTCCGGG 59.587 57.143 0.00 0.00 40.94 5.73
3619 3841 3.384789 TCATGTAGAAGGATCTGGTTCCG 59.615 47.826 0.00 0.00 40.94 4.30
3620 3842 4.443598 GGTCATGTAGAAGGATCTGGTTCC 60.444 50.000 0.00 0.00 37.10 3.62
3622 3844 4.104086 TGGTCATGTAGAAGGATCTGGTT 58.896 43.478 0.00 0.00 37.10 3.67
3623 3845 3.724478 TGGTCATGTAGAAGGATCTGGT 58.276 45.455 0.00 0.00 37.10 4.00
3625 3847 5.350504 AGTTGGTCATGTAGAAGGATCTG 57.649 43.478 0.00 0.00 37.10 2.90
3626 3848 5.738909 CAAGTTGGTCATGTAGAAGGATCT 58.261 41.667 0.00 0.00 39.82 2.75
3627 3849 4.333926 GCAAGTTGGTCATGTAGAAGGATC 59.666 45.833 4.75 0.00 0.00 3.36
3628 3850 4.265073 GCAAGTTGGTCATGTAGAAGGAT 58.735 43.478 4.75 0.00 0.00 3.24
3629 3851 3.559171 GGCAAGTTGGTCATGTAGAAGGA 60.559 47.826 4.75 0.00 0.00 3.36
3630 3852 2.749621 GGCAAGTTGGTCATGTAGAAGG 59.250 50.000 4.75 0.00 0.00 3.46
3632 3854 3.788227 AGGCAAGTTGGTCATGTAGAA 57.212 42.857 4.75 0.00 0.00 2.10
3634 3856 3.679389 AGAAGGCAAGTTGGTCATGTAG 58.321 45.455 4.75 0.00 0.00 2.74
3635 3857 3.788227 AGAAGGCAAGTTGGTCATGTA 57.212 42.857 4.75 0.00 0.00 2.29
3636 3858 2.664402 AGAAGGCAAGTTGGTCATGT 57.336 45.000 4.75 0.00 0.00 3.21
3638 3860 3.788227 TGTAGAAGGCAAGTTGGTCAT 57.212 42.857 4.75 0.00 0.00 3.06
3639 3861 3.788227 ATGTAGAAGGCAAGTTGGTCA 57.212 42.857 4.75 0.00 0.00 4.02
3640 3862 3.366374 GCAATGTAGAAGGCAAGTTGGTC 60.366 47.826 4.75 0.00 0.00 4.02
3641 3863 2.558359 GCAATGTAGAAGGCAAGTTGGT 59.442 45.455 4.75 0.00 0.00 3.67
3643 3865 3.503363 TCAGCAATGTAGAAGGCAAGTTG 59.497 43.478 0.00 0.00 0.00 3.16
3644 3866 3.754965 TCAGCAATGTAGAAGGCAAGTT 58.245 40.909 0.00 0.00 0.00 2.66
3645 3867 3.423539 TCAGCAATGTAGAAGGCAAGT 57.576 42.857 0.00 0.00 0.00 3.16
3646 3868 4.352600 CTTCAGCAATGTAGAAGGCAAG 57.647 45.455 8.31 0.00 36.11 4.01
3652 3874 6.156256 ACATAGTACCCTTCAGCAATGTAGAA 59.844 38.462 0.00 0.00 0.00 2.10
3653 3875 5.661312 ACATAGTACCCTTCAGCAATGTAGA 59.339 40.000 0.00 0.00 0.00 2.59
3654 3876 5.918608 ACATAGTACCCTTCAGCAATGTAG 58.081 41.667 0.00 0.00 0.00 2.74
3655 3877 5.950544 ACATAGTACCCTTCAGCAATGTA 57.049 39.130 0.00 0.00 0.00 2.29
3656 3878 4.844349 ACATAGTACCCTTCAGCAATGT 57.156 40.909 0.00 0.00 0.00 2.71
3657 3879 5.918608 ACTACATAGTACCCTTCAGCAATG 58.081 41.667 0.00 0.00 34.13 2.82
3658 3880 7.256332 CCATACTACATAGTACCCTTCAGCAAT 60.256 40.741 0.84 0.00 41.18 3.56
3661 3883 5.773680 TCCATACTACATAGTACCCTTCAGC 59.226 44.000 0.84 0.00 41.18 4.26
3662 3884 7.670140 TCATCCATACTACATAGTACCCTTCAG 59.330 40.741 0.84 0.00 41.18 3.02
3664 3886 7.670559 ACTCATCCATACTACATAGTACCCTTC 59.329 40.741 0.84 0.00 41.18 3.46
3667 3889 7.361885 CGAACTCATCCATACTACATAGTACCC 60.362 44.444 0.84 0.00 41.18 3.69
3668 3890 7.174599 ACGAACTCATCCATACTACATAGTACC 59.825 40.741 0.84 0.00 41.18 3.34
3669 3891 8.097078 ACGAACTCATCCATACTACATAGTAC 57.903 38.462 0.84 0.00 41.18 2.73
3670 3892 8.687292 AACGAACTCATCCATACTACATAGTA 57.313 34.615 1.33 1.33 42.43 1.82
3672 3894 8.873215 AAAACGAACTCATCCATACTACATAG 57.127 34.615 0.00 0.00 0.00 2.23
3696 3918 4.444591 ATGAAGGCAAGTTCATGGCAAAAA 60.445 37.500 7.24 0.00 43.97 1.94
3697 3919 3.071312 ATGAAGGCAAGTTCATGGCAAAA 59.929 39.130 7.24 0.00 43.97 2.44
3698 3920 2.633967 ATGAAGGCAAGTTCATGGCAAA 59.366 40.909 7.24 0.00 43.97 3.68
3699 3921 2.250031 ATGAAGGCAAGTTCATGGCAA 58.750 42.857 7.24 0.00 43.97 4.52
3700 3922 1.927487 ATGAAGGCAAGTTCATGGCA 58.073 45.000 7.24 0.00 43.97 4.92
3701 3923 3.429410 GGTTATGAAGGCAAGTTCATGGC 60.429 47.826 15.01 9.19 45.00 4.40
3702 3924 3.763360 TGGTTATGAAGGCAAGTTCATGG 59.237 43.478 15.01 0.00 45.00 3.66
3703 3925 5.047802 AGTTGGTTATGAAGGCAAGTTCATG 60.048 40.000 15.01 0.00 45.00 3.07
3704 3926 5.079643 AGTTGGTTATGAAGGCAAGTTCAT 58.920 37.500 11.55 11.55 46.61 2.57
3705 3927 4.469657 AGTTGGTTATGAAGGCAAGTTCA 58.530 39.130 0.00 0.00 40.68 3.18
3706 3928 6.759497 ATAGTTGGTTATGAAGGCAAGTTC 57.241 37.500 0.00 0.00 0.00 3.01
3707 3929 6.719370 TGAATAGTTGGTTATGAAGGCAAGTT 59.281 34.615 0.00 0.00 0.00 2.66
3709 3931 6.757897 TGAATAGTTGGTTATGAAGGCAAG 57.242 37.500 0.00 0.00 0.00 4.01
3710 3932 7.716799 AATGAATAGTTGGTTATGAAGGCAA 57.283 32.000 0.00 0.00 0.00 4.52
3711 3933 8.052748 AGTAATGAATAGTTGGTTATGAAGGCA 58.947 33.333 0.00 0.00 0.00 4.75
3712 3934 8.345565 CAGTAATGAATAGTTGGTTATGAAGGC 58.654 37.037 0.00 0.00 0.00 4.35
3713 3935 9.396022 ACAGTAATGAATAGTTGGTTATGAAGG 57.604 33.333 0.00 0.00 0.00 3.46
3717 3939 9.773328 CACAACAGTAATGAATAGTTGGTTATG 57.227 33.333 0.00 0.00 42.73 1.90
3718 3940 8.956426 CCACAACAGTAATGAATAGTTGGTTAT 58.044 33.333 0.00 0.00 42.73 1.89
3719 3941 7.940137 ACCACAACAGTAATGAATAGTTGGTTA 59.060 33.333 0.00 0.00 42.73 2.85
3720 3942 6.775629 ACCACAACAGTAATGAATAGTTGGTT 59.224 34.615 0.00 0.00 42.73 3.67
3722 3944 6.429692 TGACCACAACAGTAATGAATAGTTGG 59.570 38.462 0.00 0.00 42.73 3.77
3723 3945 7.173218 ACTGACCACAACAGTAATGAATAGTTG 59.827 37.037 0.00 0.00 45.10 3.16
3724 3946 7.224297 ACTGACCACAACAGTAATGAATAGTT 58.776 34.615 0.00 0.00 45.10 2.24
3725 3947 6.769512 ACTGACCACAACAGTAATGAATAGT 58.230 36.000 0.00 0.00 45.10 2.12
3736 3958 3.973657 ACTACGTTACTGACCACAACAG 58.026 45.455 0.00 0.00 40.68 3.16
3737 3959 5.710513 ATACTACGTTACTGACCACAACA 57.289 39.130 0.00 0.00 0.00 3.33
3738 3960 6.963805 GTCTATACTACGTTACTGACCACAAC 59.036 42.308 0.00 0.00 0.00 3.32
3740 3962 6.314648 CAGTCTATACTACGTTACTGACCACA 59.685 42.308 0.00 0.00 37.18 4.17
3741 3963 6.314896 ACAGTCTATACTACGTTACTGACCAC 59.685 42.308 7.24 0.00 38.14 4.16
3742 3964 6.409704 ACAGTCTATACTACGTTACTGACCA 58.590 40.000 7.24 0.00 38.14 4.02
3743 3965 6.917217 ACAGTCTATACTACGTTACTGACC 57.083 41.667 7.24 0.00 38.14 4.02
3750 3972 8.589629 CGCAAAATTAACAGTCTATACTACGTT 58.410 33.333 0.00 0.00 33.48 3.99
3752 3974 8.257841 GTCGCAAAATTAACAGTCTATACTACG 58.742 37.037 0.00 0.00 33.48 3.51
3753 3975 9.079833 TGTCGCAAAATTAACAGTCTATACTAC 57.920 33.333 0.00 0.00 33.48 2.73
3754 3976 9.297586 CTGTCGCAAAATTAACAGTCTATACTA 57.702 33.333 0.00 0.00 35.51 1.82
3763 3985 5.270083 TCAACACTGTCGCAAAATTAACAG 58.730 37.500 0.00 0.00 43.69 3.16
3765 3987 6.747659 AATCAACACTGTCGCAAAATTAAC 57.252 33.333 0.00 0.00 0.00 2.01
3766 3988 8.910666 CATAAATCAACACTGTCGCAAAATTAA 58.089 29.630 0.00 0.00 0.00 1.40
3768 3990 7.114811 GTCATAAATCAACACTGTCGCAAAATT 59.885 33.333 0.00 0.00 0.00 1.82
3769 3991 6.582295 GTCATAAATCAACACTGTCGCAAAAT 59.418 34.615 0.00 0.00 0.00 1.82
3770 3992 5.912396 GTCATAAATCAACACTGTCGCAAAA 59.088 36.000 0.00 0.00 0.00 2.44
3773 3995 4.061596 TGTCATAAATCAACACTGTCGCA 58.938 39.130 0.00 0.00 0.00 5.10
3774 3996 4.388773 TCTGTCATAAATCAACACTGTCGC 59.611 41.667 0.00 0.00 0.00 5.19
3775 3997 6.653273 ATCTGTCATAAATCAACACTGTCG 57.347 37.500 0.00 0.00 0.00 4.35
3778 4000 7.539710 CCACAAATCTGTCATAAATCAACACTG 59.460 37.037 0.00 0.00 31.64 3.66
3780 4002 6.808212 CCCACAAATCTGTCATAAATCAACAC 59.192 38.462 0.00 0.00 31.64 3.32
3781 4003 6.718912 TCCCACAAATCTGTCATAAATCAACA 59.281 34.615 0.00 0.00 31.64 3.33
3782 4004 7.156876 TCCCACAAATCTGTCATAAATCAAC 57.843 36.000 0.00 0.00 31.64 3.18
3783 4005 7.959658 ATCCCACAAATCTGTCATAAATCAA 57.040 32.000 0.00 0.00 31.64 2.57
3784 4006 9.473007 TTTATCCCACAAATCTGTCATAAATCA 57.527 29.630 0.00 0.00 31.64 2.57
3787 4009 8.062065 GGTTTATCCCACAAATCTGTCATAAA 57.938 34.615 0.00 0.00 31.64 1.40
3805 4027 8.706322 ACATACATAAATGAAGGGGGTTTATC 57.294 34.615 0.00 0.00 0.00 1.75
3806 4028 9.582648 GTACATACATAAATGAAGGGGGTTTAT 57.417 33.333 0.00 0.00 0.00 1.40
3807 4029 8.783903 AGTACATACATAAATGAAGGGGGTTTA 58.216 33.333 0.00 0.00 0.00 2.01
3811 4033 6.003950 CCAGTACATACATAAATGAAGGGGG 58.996 44.000 0.00 0.00 0.00 5.40
3812 4034 6.601332 ACCAGTACATACATAAATGAAGGGG 58.399 40.000 0.00 0.00 0.00 4.79
3813 4035 6.710744 GGACCAGTACATACATAAATGAAGGG 59.289 42.308 0.00 0.00 0.00 3.95
3815 4037 8.731275 TTGGACCAGTACATACATAAATGAAG 57.269 34.615 0.00 0.00 0.00 3.02
3816 4038 7.282224 GCTTGGACCAGTACATACATAAATGAA 59.718 37.037 0.00 0.00 0.00 2.57
3817 4039 6.765989 GCTTGGACCAGTACATACATAAATGA 59.234 38.462 0.00 0.00 0.00 2.57
3818 4040 6.542005 TGCTTGGACCAGTACATACATAAATG 59.458 38.462 0.00 0.00 0.00 2.32
3820 4042 6.056090 TGCTTGGACCAGTACATACATAAA 57.944 37.500 0.00 0.00 0.00 1.40
3821 4043 5.685520 TGCTTGGACCAGTACATACATAA 57.314 39.130 0.00 0.00 0.00 1.90
3823 4045 4.568072 TTGCTTGGACCAGTACATACAT 57.432 40.909 0.00 0.00 0.00 2.29
3824 4046 4.359434 TTTGCTTGGACCAGTACATACA 57.641 40.909 0.00 0.00 0.00 2.29
3825 4047 5.897377 ATTTTGCTTGGACCAGTACATAC 57.103 39.130 0.00 0.00 0.00 2.39
3826 4048 6.007076 TGAATTTTGCTTGGACCAGTACATA 58.993 36.000 0.00 0.00 0.00 2.29
3828 4050 4.211125 TGAATTTTGCTTGGACCAGTACA 58.789 39.130 0.00 0.00 0.00 2.90
3829 4051 4.846779 TGAATTTTGCTTGGACCAGTAC 57.153 40.909 0.00 0.00 0.00 2.73
3830 4052 5.076182 TGATGAATTTTGCTTGGACCAGTA 58.924 37.500 0.00 0.00 0.00 2.74
3832 4054 4.524316 TGATGAATTTTGCTTGGACCAG 57.476 40.909 0.00 0.00 0.00 4.00
3833 4055 4.588106 TCTTGATGAATTTTGCTTGGACCA 59.412 37.500 0.00 0.00 0.00 4.02
3834 4056 5.138125 TCTTGATGAATTTTGCTTGGACC 57.862 39.130 0.00 0.00 0.00 4.46
3835 4057 8.937634 ATATTCTTGATGAATTTTGCTTGGAC 57.062 30.769 0.00 0.00 42.28 4.02
3836 4058 8.751242 TGATATTCTTGATGAATTTTGCTTGGA 58.249 29.630 0.00 0.00 42.28 3.53
3837 4059 8.936070 TGATATTCTTGATGAATTTTGCTTGG 57.064 30.769 0.00 0.00 42.28 3.61
3840 4062 9.079833 CGTTTGATATTCTTGATGAATTTTGCT 57.920 29.630 0.00 0.00 42.28 3.91
3851 4073 9.653287 AGACAGTAAATCGTTTGATATTCTTGA 57.347 29.630 0.00 0.00 33.40 3.02
3859 4081 8.836413 TGAAGAAAAGACAGTAAATCGTTTGAT 58.164 29.630 0.00 0.00 35.98 2.57
3860 4082 8.120465 GTGAAGAAAAGACAGTAAATCGTTTGA 58.880 33.333 0.00 0.00 29.53 2.69
3861 4083 7.376072 GGTGAAGAAAAGACAGTAAATCGTTTG 59.624 37.037 0.00 0.00 29.53 2.93
3862 4084 7.282450 AGGTGAAGAAAAGACAGTAAATCGTTT 59.718 33.333 0.00 0.00 31.62 3.60
3863 4085 6.766467 AGGTGAAGAAAAGACAGTAAATCGTT 59.234 34.615 0.00 0.00 0.00 3.85
3865 4087 6.787085 AGGTGAAGAAAAGACAGTAAATCG 57.213 37.500 0.00 0.00 0.00 3.34
3866 4088 7.228706 TCCAAGGTGAAGAAAAGACAGTAAATC 59.771 37.037 0.00 0.00 0.00 2.17
3869 4091 5.996644 TCCAAGGTGAAGAAAAGACAGTAA 58.003 37.500 0.00 0.00 0.00 2.24
3870 4092 5.623956 TCCAAGGTGAAGAAAAGACAGTA 57.376 39.130 0.00 0.00 0.00 2.74
3873 4095 7.468084 CGTTTAATCCAAGGTGAAGAAAAGACA 60.468 37.037 0.00 0.00 0.00 3.41
3875 4097 6.544564 ACGTTTAATCCAAGGTGAAGAAAAGA 59.455 34.615 0.00 0.00 0.00 2.52
3877 4099 6.702716 ACGTTTAATCCAAGGTGAAGAAAA 57.297 33.333 0.00 0.00 0.00 2.29
3878 4100 7.282675 TGTTACGTTTAATCCAAGGTGAAGAAA 59.717 33.333 0.00 0.00 0.00 2.52
3879 4101 6.766944 TGTTACGTTTAATCCAAGGTGAAGAA 59.233 34.615 0.00 0.00 0.00 2.52
3881 4103 6.548441 TGTTACGTTTAATCCAAGGTGAAG 57.452 37.500 0.00 0.00 0.00 3.02
3882 4104 7.513371 AATGTTACGTTTAATCCAAGGTGAA 57.487 32.000 0.00 0.00 0.00 3.18
3887 4109 9.666626 TGTGTAAAATGTTACGTTTAATCCAAG 57.333 29.630 2.77 0.00 42.26 3.61
3925 4278 9.107177 CTGTACATCAGAGCTAAGAATTCATTT 57.893 33.333 8.44 0.00 46.27 2.32
3926 4279 8.263640 ACTGTACATCAGAGCTAAGAATTCATT 58.736 33.333 8.44 2.10 46.27 2.57
3927 4280 7.790027 ACTGTACATCAGAGCTAAGAATTCAT 58.210 34.615 8.44 0.00 46.27 2.57
3931 4284 8.575589 CATCTACTGTACATCAGAGCTAAGAAT 58.424 37.037 11.07 0.00 46.27 2.40
3934 4287 7.503521 TCATCTACTGTACATCAGAGCTAAG 57.496 40.000 11.07 0.00 46.27 2.18
3937 4290 6.975196 AATCATCTACTGTACATCAGAGCT 57.025 37.500 11.07 0.00 46.27 4.09
3942 4295 6.976934 TGGCTAATCATCTACTGTACATCA 57.023 37.500 0.00 0.00 0.00 3.07
3943 4296 8.523658 TGTATGGCTAATCATCTACTGTACATC 58.476 37.037 0.00 0.00 0.00 3.06
3944 4297 8.422577 TGTATGGCTAATCATCTACTGTACAT 57.577 34.615 0.00 0.00 0.00 2.29
3946 4299 9.144747 CATTGTATGGCTAATCATCTACTGTAC 57.855 37.037 0.00 0.00 0.00 2.90
3947 4300 9.088987 TCATTGTATGGCTAATCATCTACTGTA 57.911 33.333 0.00 0.00 0.00 2.74
3949 4302 9.445878 AATCATTGTATGGCTAATCATCTACTG 57.554 33.333 0.00 0.00 0.00 2.74
3956 4309 8.849168 CACCTTAAATCATTGTATGGCTAATCA 58.151 33.333 0.00 0.00 0.00 2.57
3958 4311 7.287466 TGCACCTTAAATCATTGTATGGCTAAT 59.713 33.333 0.00 0.00 0.00 1.73
3959 4312 6.605194 TGCACCTTAAATCATTGTATGGCTAA 59.395 34.615 0.00 0.00 0.00 3.09
3960 4313 6.125719 TGCACCTTAAATCATTGTATGGCTA 58.874 36.000 0.00 0.00 0.00 3.93
3961 4314 4.955450 TGCACCTTAAATCATTGTATGGCT 59.045 37.500 0.00 0.00 0.00 4.75
3962 4315 5.261209 TGCACCTTAAATCATTGTATGGC 57.739 39.130 0.00 0.00 0.00 4.40
3963 4316 6.866480 AGTTGCACCTTAAATCATTGTATGG 58.134 36.000 0.00 0.00 0.00 2.74
3976 4329 9.325198 CAGTGATTACATTATAGTTGCACCTTA 57.675 33.333 0.00 0.00 0.00 2.69
3977 4330 8.046708 TCAGTGATTACATTATAGTTGCACCTT 58.953 33.333 0.00 0.00 0.00 3.50
3978 4331 7.564793 TCAGTGATTACATTATAGTTGCACCT 58.435 34.615 0.00 0.00 0.00 4.00
3980 4333 9.490663 GTTTCAGTGATTACATTATAGTTGCAC 57.509 33.333 0.00 0.00 0.00 4.57
3981 4334 9.225436 TGTTTCAGTGATTACATTATAGTTGCA 57.775 29.630 0.00 0.00 0.00 4.08
3987 4340 8.673711 GCAGGTTGTTTCAGTGATTACATTATA 58.326 33.333 8.82 0.00 0.00 0.98
3988 4341 7.394359 AGCAGGTTGTTTCAGTGATTACATTAT 59.606 33.333 8.82 0.00 0.00 1.28
3989 4342 6.714810 AGCAGGTTGTTTCAGTGATTACATTA 59.285 34.615 8.82 0.00 0.00 1.90
3990 4343 5.536161 AGCAGGTTGTTTCAGTGATTACATT 59.464 36.000 8.82 0.00 0.00 2.71
3992 4345 4.275689 CAGCAGGTTGTTTCAGTGATTACA 59.724 41.667 0.00 0.00 0.00 2.41
3993 4346 4.787598 CAGCAGGTTGTTTCAGTGATTAC 58.212 43.478 0.00 0.00 0.00 1.89
3994 4347 3.253188 GCAGCAGGTTGTTTCAGTGATTA 59.747 43.478 0.00 0.00 0.00 1.75
3995 4348 2.035066 GCAGCAGGTTGTTTCAGTGATT 59.965 45.455 0.00 0.00 0.00 2.57
3997 4350 1.024271 GCAGCAGGTTGTTTCAGTGA 58.976 50.000 0.00 0.00 0.00 3.41
3998 4351 0.740149 TGCAGCAGGTTGTTTCAGTG 59.260 50.000 0.00 0.00 0.00 3.66
3999 4352 1.473258 TTGCAGCAGGTTGTTTCAGT 58.527 45.000 0.00 0.00 0.00 3.41
4000 4353 2.582728 TTTGCAGCAGGTTGTTTCAG 57.417 45.000 0.00 0.00 0.00 3.02
4001 4354 3.540314 ATTTTGCAGCAGGTTGTTTCA 57.460 38.095 0.00 0.00 0.00 2.69
4002 4355 4.025480 CAGAATTTTGCAGCAGGTTGTTTC 60.025 41.667 0.00 0.00 0.00 2.78
4003 4356 3.872771 CAGAATTTTGCAGCAGGTTGTTT 59.127 39.130 0.00 0.00 0.00 2.83
4004 4357 3.132646 TCAGAATTTTGCAGCAGGTTGTT 59.867 39.130 0.00 0.00 0.00 2.83
4005 4358 2.694628 TCAGAATTTTGCAGCAGGTTGT 59.305 40.909 0.00 0.00 0.00 3.32
4006 4359 3.374220 TCAGAATTTTGCAGCAGGTTG 57.626 42.857 0.00 0.00 0.00 3.77
4007 4360 4.039488 TCAATCAGAATTTTGCAGCAGGTT 59.961 37.500 0.00 0.00 0.00 3.50
4009 4362 4.182693 TCAATCAGAATTTTGCAGCAGG 57.817 40.909 0.00 0.00 0.00 4.85
4010 4363 5.464057 TGTTTCAATCAGAATTTTGCAGCAG 59.536 36.000 0.00 0.00 35.83 4.24
4011 4364 5.358090 TGTTTCAATCAGAATTTTGCAGCA 58.642 33.333 0.00 0.00 35.83 4.41
4014 4367 6.111382 TGGTTGTTTCAATCAGAATTTTGCA 58.889 32.000 0.00 0.00 35.83 4.08
4015 4368 6.601741 TGGTTGTTTCAATCAGAATTTTGC 57.398 33.333 0.00 0.00 35.83 3.68
4025 4378 9.797556 GGGTATAGTTATTTGGTTGTTTCAATC 57.202 33.333 0.00 0.00 0.00 2.67
4026 4379 9.315363 TGGGTATAGTTATTTGGTTGTTTCAAT 57.685 29.630 0.00 0.00 0.00 2.57
4027 4380 8.707796 TGGGTATAGTTATTTGGTTGTTTCAA 57.292 30.769 0.00 0.00 0.00 2.69
4028 4381 8.707796 TTGGGTATAGTTATTTGGTTGTTTCA 57.292 30.769 0.00 0.00 0.00 2.69
4029 4382 9.984190 TTTTGGGTATAGTTATTTGGTTGTTTC 57.016 29.630 0.00 0.00 0.00 2.78
4033 4386 7.547722 GCCTTTTTGGGTATAGTTATTTGGTTG 59.452 37.037 0.00 0.00 36.00 3.77
4034 4387 7.456585 AGCCTTTTTGGGTATAGTTATTTGGTT 59.543 33.333 0.00 0.00 46.10 3.67
4035 4388 6.957606 AGCCTTTTTGGGTATAGTTATTTGGT 59.042 34.615 0.00 0.00 46.10 3.67
4036 4389 7.418337 AGCCTTTTTGGGTATAGTTATTTGG 57.582 36.000 0.00 0.00 46.10 3.28
4049 4402 0.249996 CTGTGCCAAGCCTTTTTGGG 60.250 55.000 6.88 0.00 46.23 4.12
4051 4404 2.101249 TCTTCTGTGCCAAGCCTTTTTG 59.899 45.455 0.00 0.00 0.00 2.44
4052 4405 2.387757 TCTTCTGTGCCAAGCCTTTTT 58.612 42.857 0.00 0.00 0.00 1.94
4053 4406 2.071778 TCTTCTGTGCCAAGCCTTTT 57.928 45.000 0.00 0.00 0.00 2.27
4054 4407 2.071778 TTCTTCTGTGCCAAGCCTTT 57.928 45.000 0.00 0.00 0.00 3.11
4056 4409 1.322442 GTTTCTTCTGTGCCAAGCCT 58.678 50.000 0.00 0.00 0.00 4.58
4057 4410 1.032014 TGTTTCTTCTGTGCCAAGCC 58.968 50.000 0.00 0.00 0.00 4.35
4058 4411 2.869233 TTGTTTCTTCTGTGCCAAGC 57.131 45.000 0.00 0.00 0.00 4.01
4059 4412 3.318839 TGGATTGTTTCTTCTGTGCCAAG 59.681 43.478 0.00 0.00 0.00 3.61
4063 4416 3.737774 GCTTTGGATTGTTTCTTCTGTGC 59.262 43.478 0.00 0.00 0.00 4.57
4064 4417 5.192327 AGCTTTGGATTGTTTCTTCTGTG 57.808 39.130 0.00 0.00 0.00 3.66
4065 4418 5.859205 AAGCTTTGGATTGTTTCTTCTGT 57.141 34.783 0.00 0.00 0.00 3.41
4066 4419 6.420008 CAGAAAGCTTTGGATTGTTTCTTCTG 59.580 38.462 18.30 8.89 35.72 3.02
4067 4420 6.322201 TCAGAAAGCTTTGGATTGTTTCTTCT 59.678 34.615 18.30 0.00 35.72 2.85
4068 4421 6.507023 TCAGAAAGCTTTGGATTGTTTCTTC 58.493 36.000 18.30 0.00 35.72 2.87
4069 4422 6.469782 TCAGAAAGCTTTGGATTGTTTCTT 57.530 33.333 18.30 0.00 35.72 2.52
4070 4423 6.127366 TGTTCAGAAAGCTTTGGATTGTTTCT 60.127 34.615 18.30 0.51 37.84 2.52
4071 4424 6.042143 TGTTCAGAAAGCTTTGGATTGTTTC 58.958 36.000 18.30 0.00 0.00 2.78
4072 4425 5.976458 TGTTCAGAAAGCTTTGGATTGTTT 58.024 33.333 18.30 0.00 0.00 2.83
4075 4428 4.980434 CACTGTTCAGAAAGCTTTGGATTG 59.020 41.667 18.30 9.52 0.00 2.67
4076 4429 4.038402 CCACTGTTCAGAAAGCTTTGGATT 59.962 41.667 18.30 0.00 0.00 3.01
4077 4430 3.571401 CCACTGTTCAGAAAGCTTTGGAT 59.429 43.478 18.30 0.00 0.00 3.41
4079 4432 2.544486 GCCACTGTTCAGAAAGCTTTGG 60.544 50.000 18.30 10.06 0.00 3.28
4080 4433 2.735823 GCCACTGTTCAGAAAGCTTTG 58.264 47.619 18.30 3.78 0.00 2.77
4081 4434 1.334869 CGCCACTGTTCAGAAAGCTTT 59.665 47.619 12.53 12.53 0.00 3.51
4083 4436 0.179045 ACGCCACTGTTCAGAAAGCT 60.179 50.000 6.83 0.00 0.00 3.74
4084 4437 1.461127 CTACGCCACTGTTCAGAAAGC 59.539 52.381 6.83 5.38 0.00 3.51
4085 4438 1.461127 GCTACGCCACTGTTCAGAAAG 59.539 52.381 6.83 0.00 0.00 2.62
4086 4439 1.508632 GCTACGCCACTGTTCAGAAA 58.491 50.000 6.83 0.00 0.00 2.52
4087 4440 3.210857 GCTACGCCACTGTTCAGAA 57.789 52.632 6.83 0.00 0.00 3.02
4088 4441 4.988065 GCTACGCCACTGTTCAGA 57.012 55.556 6.83 0.00 0.00 3.27
4099 4452 2.202892 GCTACCCTGTGGCTACGC 60.203 66.667 0.00 0.00 37.08 4.42
4100 4453 2.298158 CTGGCTACCCTGTGGCTACG 62.298 65.000 2.62 0.00 39.93 3.51
4101 4454 1.522569 CTGGCTACCCTGTGGCTAC 59.477 63.158 2.62 0.00 39.93 3.58
4102 4455 1.689233 CCTGGCTACCCTGTGGCTA 60.689 63.158 2.62 0.00 39.93 3.93
4103 4456 3.011517 CCTGGCTACCCTGTGGCT 61.012 66.667 2.62 0.00 39.93 4.75
4104 4457 4.115199 CCCTGGCTACCCTGTGGC 62.115 72.222 0.00 0.00 39.31 5.01
4105 4458 2.610859 ACCCTGGCTACCCTGTGG 60.611 66.667 0.00 0.00 37.80 4.17
4107 4460 2.610859 CCACCCTGGCTACCCTGT 60.611 66.667 0.00 0.00 0.00 4.00
4108 4461 2.610859 ACCACCCTGGCTACCCTG 60.611 66.667 0.00 0.00 42.67 4.45
4109 4462 2.285442 GACCACCCTGGCTACCCT 60.285 66.667 0.00 0.00 42.67 4.34
4113 4466 3.000819 CGTGGACCACCCTGGCTA 61.001 66.667 19.11 0.00 42.67 3.93
4116 4469 4.016706 GTCCGTGGACCACCCTGG 62.017 72.222 19.11 14.18 45.02 4.45
4127 4480 2.521958 AAATCTCAGGGCGGTCCGTG 62.522 60.000 13.94 3.38 46.74 4.94
4128 4481 2.291043 AAATCTCAGGGCGGTCCGT 61.291 57.895 13.94 0.00 41.52 4.69
4129 4482 1.815421 CAAATCTCAGGGCGGTCCG 60.815 63.158 6.99 6.99 41.52 4.79
4130 4483 1.452108 CCAAATCTCAGGGCGGTCC 60.452 63.158 0.00 0.00 0.00 4.46
4131 4484 2.115291 GCCAAATCTCAGGGCGGTC 61.115 63.158 0.00 0.00 38.04 4.79
4132 4485 2.044946 GCCAAATCTCAGGGCGGT 60.045 61.111 0.00 0.00 38.04 5.68
4136 4489 1.380380 GGTGGGCCAAATCTCAGGG 60.380 63.158 8.40 0.00 34.09 4.45
4137 4490 1.383799 TGGTGGGCCAAATCTCAGG 59.616 57.895 8.40 0.00 42.83 3.86
4147 4500 2.085343 ATATGGGCTGATGGTGGGCC 62.085 60.000 0.00 0.00 46.56 5.80
4148 4501 0.698238 TATATGGGCTGATGGTGGGC 59.302 55.000 0.00 0.00 0.00 5.36
4149 4502 1.283029 CCTATATGGGCTGATGGTGGG 59.717 57.143 0.00 0.00 0.00 4.61
4150 4503 2.269023 TCCTATATGGGCTGATGGTGG 58.731 52.381 0.00 0.00 36.20 4.61
4151 4504 4.581309 ATTCCTATATGGGCTGATGGTG 57.419 45.455 0.00 0.00 36.20 4.17
4152 4505 6.915468 AATATTCCTATATGGGCTGATGGT 57.085 37.500 0.00 0.00 36.20 3.55
4153 4506 8.599624 AAAAATATTCCTATATGGGCTGATGG 57.400 34.615 0.00 0.00 36.20 3.51
4183 4536 3.242739 TGTTTTCTTTCTCTGCGCTGAAC 60.243 43.478 18.03 10.82 0.00 3.18
4184 4537 2.942376 TGTTTTCTTTCTCTGCGCTGAA 59.058 40.909 18.03 11.96 0.00 3.02
4185 4538 2.560504 TGTTTTCTTTCTCTGCGCTGA 58.439 42.857 16.55 16.55 0.00 4.26
4186 4539 3.486584 GATGTTTTCTTTCTCTGCGCTG 58.513 45.455 9.73 8.88 0.00 5.18
4187 4540 2.158449 CGATGTTTTCTTTCTCTGCGCT 59.842 45.455 9.73 0.00 0.00 5.92
4188 4541 2.499896 CGATGTTTTCTTTCTCTGCGC 58.500 47.619 0.00 0.00 0.00 6.09
4192 4545 2.485814 GCTGGCGATGTTTTCTTTCTCT 59.514 45.455 0.00 0.00 0.00 3.10
4193 4546 2.485814 AGCTGGCGATGTTTTCTTTCTC 59.514 45.455 0.00 0.00 0.00 2.87
4194 4547 2.508526 AGCTGGCGATGTTTTCTTTCT 58.491 42.857 0.00 0.00 0.00 2.52
4195 4548 2.997485 AGCTGGCGATGTTTTCTTTC 57.003 45.000 0.00 0.00 0.00 2.62
4198 4551 1.359848 CGTAGCTGGCGATGTTTTCT 58.640 50.000 0.00 0.00 0.00 2.52
4199 4552 0.373716 CCGTAGCTGGCGATGTTTTC 59.626 55.000 13.00 0.00 0.00 2.29
4200 4553 1.644786 GCCGTAGCTGGCGATGTTTT 61.645 55.000 13.00 0.00 46.75 2.43
4201 4554 2.106683 GCCGTAGCTGGCGATGTTT 61.107 57.895 13.00 0.00 46.75 2.83
4202 4555 2.511600 GCCGTAGCTGGCGATGTT 60.512 61.111 13.00 0.00 46.75 2.71
4210 4563 2.031919 TGTGGGTTGCCGTAGCTG 59.968 61.111 0.00 0.00 40.80 4.24
4211 4564 2.347490 CTGTGGGTTGCCGTAGCT 59.653 61.111 0.00 0.00 40.80 3.32
4212 4565 2.536997 ATCCTGTGGGTTGCCGTAGC 62.537 60.000 0.00 0.00 40.48 3.58
4214 4567 1.195442 TGATCCTGTGGGTTGCCGTA 61.195 55.000 0.00 0.00 0.00 4.02
4215 4568 1.852157 ATGATCCTGTGGGTTGCCGT 61.852 55.000 0.00 0.00 0.00 5.68
4216 4569 0.680921 AATGATCCTGTGGGTTGCCG 60.681 55.000 0.00 0.00 0.00 5.69
4217 4570 1.478105 GAAATGATCCTGTGGGTTGCC 59.522 52.381 0.00 0.00 0.00 4.52
4229 4582 2.789893 GTGCGAGTACGAGGAAATGATC 59.210 50.000 0.00 0.00 42.66 2.92
4230 4583 2.165641 TGTGCGAGTACGAGGAAATGAT 59.834 45.455 0.00 0.00 42.66 2.45
4231 4584 1.542472 TGTGCGAGTACGAGGAAATGA 59.458 47.619 0.00 0.00 42.66 2.57
4233 4586 2.607187 CTTGTGCGAGTACGAGGAAAT 58.393 47.619 0.00 0.00 42.66 2.17
4234 4587 2.060326 CTTGTGCGAGTACGAGGAAA 57.940 50.000 0.00 0.00 42.66 3.13
4235 4588 3.786809 CTTGTGCGAGTACGAGGAA 57.213 52.632 0.00 0.00 42.66 3.36
4237 4590 4.478195 CCTTGTGCGAGTACGAGG 57.522 61.111 12.17 12.17 43.82 4.63
4256 4609 5.972935 TGAGAACGATTAACAGGCTGATTA 58.027 37.500 23.66 12.86 0.00 1.75
4257 4610 4.832248 TGAGAACGATTAACAGGCTGATT 58.168 39.130 23.66 13.88 0.00 2.57
4258 4611 4.471904 TGAGAACGATTAACAGGCTGAT 57.528 40.909 23.66 12.76 0.00 2.90
4259 4612 3.953712 TGAGAACGATTAACAGGCTGA 57.046 42.857 23.66 0.00 0.00 4.26
4260 4613 3.997021 AGTTGAGAACGATTAACAGGCTG 59.003 43.478 14.16 14.16 36.23 4.85
4261 4614 4.246458 GAGTTGAGAACGATTAACAGGCT 58.754 43.478 0.00 0.00 36.23 4.58
4262 4615 3.371285 GGAGTTGAGAACGATTAACAGGC 59.629 47.826 0.00 0.00 36.23 4.85
4263 4616 3.933332 GGGAGTTGAGAACGATTAACAGG 59.067 47.826 0.00 0.00 36.23 4.00
4265 4618 3.256383 TCGGGAGTTGAGAACGATTAACA 59.744 43.478 0.00 0.00 36.23 2.41
4267 4620 4.441079 GGATCGGGAGTTGAGAACGATTAA 60.441 45.833 0.00 0.00 43.42 1.40
4268 4621 3.067742 GGATCGGGAGTTGAGAACGATTA 59.932 47.826 0.00 0.00 43.42 1.75
4270 4623 1.409427 GGATCGGGAGTTGAGAACGAT 59.591 52.381 0.00 0.00 45.70 3.73
4271 4624 0.815734 GGATCGGGAGTTGAGAACGA 59.184 55.000 0.00 0.00 38.00 3.85
4272 4625 0.818296 AGGATCGGGAGTTGAGAACG 59.182 55.000 0.00 0.00 36.23 3.95
4273 4626 1.825474 TCAGGATCGGGAGTTGAGAAC 59.175 52.381 0.00 0.00 0.00 3.01
4274 4627 1.825474 GTCAGGATCGGGAGTTGAGAA 59.175 52.381 0.00 0.00 0.00 2.87
4275 4628 1.006043 AGTCAGGATCGGGAGTTGAGA 59.994 52.381 0.00 0.00 0.00 3.27
4280 4633 1.187087 GTTCAGTCAGGATCGGGAGT 58.813 55.000 0.00 0.00 0.00 3.85
4281 4634 0.101399 CGTTCAGTCAGGATCGGGAG 59.899 60.000 0.00 0.00 0.00 4.30
4284 4637 1.471287 TGTACGTTCAGTCAGGATCGG 59.529 52.381 0.00 0.00 35.02 4.18
4285 4638 2.095415 TGTGTACGTTCAGTCAGGATCG 60.095 50.000 0.00 0.00 36.38 3.69
4286 4639 3.190744 TCTGTGTACGTTCAGTCAGGATC 59.809 47.826 11.23 0.00 33.89 3.36
4287 4640 3.154710 TCTGTGTACGTTCAGTCAGGAT 58.845 45.455 11.23 0.00 33.89 3.24
4290 4643 5.043189 TGTATCTGTGTACGTTCAGTCAG 57.957 43.478 0.00 0.00 33.89 3.51
4292 4645 5.458891 AGTTGTATCTGTGTACGTTCAGTC 58.541 41.667 0.00 0.00 33.89 3.51
4296 4649 8.684973 AGAATAAGTTGTATCTGTGTACGTTC 57.315 34.615 0.00 0.00 0.00 3.95
4297 4650 8.301720 TGAGAATAAGTTGTATCTGTGTACGTT 58.698 33.333 0.00 0.00 0.00 3.99
4298 4651 7.823665 TGAGAATAAGTTGTATCTGTGTACGT 58.176 34.615 0.00 0.00 0.00 3.57
4300 4653 9.640963 AACTGAGAATAAGTTGTATCTGTGTAC 57.359 33.333 0.00 0.00 0.00 2.90
4301 4654 9.856488 GAACTGAGAATAAGTTGTATCTGTGTA 57.144 33.333 0.00 0.00 0.00 2.90
4304 4657 7.036220 CGGAACTGAGAATAAGTTGTATCTGT 58.964 38.462 0.00 0.00 0.00 3.41
4305 4658 7.221067 GTCGGAACTGAGAATAAGTTGTATCTG 59.779 40.741 0.00 0.00 0.00 2.90
4307 4660