Multiple sequence alignment - TraesCS5B01G006000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G006000 chr5B 100.000 2649 0 0 1 2649 7185957 7183309 0.000000e+00 4892
1 TraesCS5B01G006000 chr5B 97.186 2665 41 7 1 2649 7150218 7147572 0.000000e+00 4475
2 TraesCS5B01G006000 chr5B 92.490 2703 139 19 1 2641 7384285 7381585 0.000000e+00 3808
3 TraesCS5B01G006000 chr5B 91.679 2692 152 23 1 2639 7305697 7303025 0.000000e+00 3664
4 TraesCS5B01G006000 chr5B 97.276 2129 49 3 530 2649 7163305 7161177 0.000000e+00 3602
5 TraesCS5B01G006000 chr5B 94.744 780 23 2 999 1760 7355437 7354658 0.000000e+00 1197
6 TraesCS5B01G006000 chr5B 88.599 728 50 8 1 712 7448902 7448192 0.000000e+00 854
7 TraesCS5B01G006000 chr5B 96.586 498 7 2 1 488 7163795 7163298 0.000000e+00 817
8 TraesCS5B01G006000 chr5D 86.955 2637 263 29 3 2563 7121018 7118387 0.000000e+00 2889
9 TraesCS5B01G006000 chr5D 86.687 2629 269 37 3 2557 3868809 3871430 0.000000e+00 2841
10 TraesCS5B01G006000 chr5D 87.090 2564 249 38 78 2563 7126237 7123678 0.000000e+00 2826
11 TraesCS5B01G006000 chr5D 87.424 1821 171 30 3 1776 7131594 7129785 0.000000e+00 2041
12 TraesCS5B01G006000 chr5D 85.304 871 119 7 1778 2641 3891154 3892022 0.000000e+00 891
13 TraesCS5B01G006000 chr4A 86.321 2471 252 42 3 2403 18738384 18735930 0.000000e+00 2612
14 TraesCS5B01G006000 chr4A 83.831 2715 317 67 8 2641 18732033 18729360 0.000000e+00 2470
15 TraesCS5B01G006000 chr4A 81.860 215 22 9 2427 2641 18735786 18735589 5.870000e-37 165
16 TraesCS5B01G006000 chr5A 84.145 2649 300 59 82 2641 4785418 4782801 0.000000e+00 2455
17 TraesCS5B01G006000 chr5A 87.877 1757 144 34 3 1706 4864743 4866483 0.000000e+00 2001
18 TraesCS5B01G006000 chr5A 90.023 1293 97 13 508 1776 4796993 4795709 0.000000e+00 1644
19 TraesCS5B01G006000 chr5A 90.012 811 51 8 992 1776 4875807 4876613 0.000000e+00 1022
20 TraesCS5B01G006000 chr5A 81.166 223 31 8 2427 2641 4789278 4789059 4.530000e-38 169


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G006000 chr5B 7183309 7185957 2648 True 4892.000000 4892 100.000000 1 2649 1 chr5B.!!$R2 2648
1 TraesCS5B01G006000 chr5B 7147572 7150218 2646 True 4475.000000 4475 97.186000 1 2649 1 chr5B.!!$R1 2648
2 TraesCS5B01G006000 chr5B 7381585 7384285 2700 True 3808.000000 3808 92.490000 1 2641 1 chr5B.!!$R5 2640
3 TraesCS5B01G006000 chr5B 7303025 7305697 2672 True 3664.000000 3664 91.679000 1 2639 1 chr5B.!!$R3 2638
4 TraesCS5B01G006000 chr5B 7161177 7163795 2618 True 2209.500000 3602 96.931000 1 2649 2 chr5B.!!$R7 2648
5 TraesCS5B01G006000 chr5B 7354658 7355437 779 True 1197.000000 1197 94.744000 999 1760 1 chr5B.!!$R4 761
6 TraesCS5B01G006000 chr5B 7448192 7448902 710 True 854.000000 854 88.599000 1 712 1 chr5B.!!$R6 711
7 TraesCS5B01G006000 chr5D 3868809 3871430 2621 False 2841.000000 2841 86.687000 3 2557 1 chr5D.!!$F1 2554
8 TraesCS5B01G006000 chr5D 7118387 7131594 13207 True 2585.333333 2889 87.156333 3 2563 3 chr5D.!!$R1 2560
9 TraesCS5B01G006000 chr5D 3891154 3892022 868 False 891.000000 891 85.304000 1778 2641 1 chr5D.!!$F2 863
10 TraesCS5B01G006000 chr4A 18729360 18738384 9024 True 1749.000000 2612 84.004000 3 2641 3 chr4A.!!$R1 2638
11 TraesCS5B01G006000 chr5A 4864743 4866483 1740 False 2001.000000 2001 87.877000 3 1706 1 chr5A.!!$F1 1703
12 TraesCS5B01G006000 chr5A 4795709 4796993 1284 True 1644.000000 1644 90.023000 508 1776 1 chr5A.!!$R1 1268
13 TraesCS5B01G006000 chr5A 4782801 4789278 6477 True 1312.000000 2455 82.655500 82 2641 2 chr5A.!!$R2 2559
14 TraesCS5B01G006000 chr5A 4875807 4876613 806 False 1022.000000 1022 90.012000 992 1776 1 chr5A.!!$F2 784

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
200 5484 3.247442 GTGTCCATTCGTGTCGTCAATA 58.753 45.455 0.0 0.0 0.0 1.9 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1765 7183 2.319136 AGTACGTGCGAGAGAGAGAT 57.681 50.0 0.0 0.0 0.0 2.75 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
200 5484 3.247442 GTGTCCATTCGTGTCGTCAATA 58.753 45.455 0.00 0.00 0.00 1.90
631 5978 8.968242 GTGGATGAGTCTTGTTGAATTTTAAAC 58.032 33.333 0.00 0.00 0.00 2.01
753 6101 3.574749 ACATAATATTGCCATGCACCCA 58.425 40.909 0.00 0.00 38.71 4.51
1795 7261 3.801293 TCGCACGTACTTTTTATTGCAC 58.199 40.909 0.00 0.00 0.00 4.57
1797 7263 4.685165 TCGCACGTACTTTTTATTGCACTA 59.315 37.500 0.00 0.00 0.00 2.74
1965 14271 3.709653 AGGTTGAAGAGTGTGGTGTTCTA 59.290 43.478 0.00 0.00 0.00 2.10
1972 14278 8.918202 TGAAGAGTGTGGTGTTCTATTTTAAT 57.082 30.769 0.00 0.00 0.00 1.40
2076 14382 1.203994 GTGTTGGCGTCCTCTAGCTAA 59.796 52.381 0.00 0.00 0.00 3.09
2185 14494 0.951040 CCAGAGTTGAACTGGCCGTC 60.951 60.000 0.90 0.00 46.30 4.79
2332 14644 3.351794 AGATCAGAGGTCACACGAGTA 57.648 47.619 0.00 0.00 0.00 2.59
2392 14708 2.352821 TGCAGTCCAATGGGCATGC 61.353 57.895 17.31 17.31 42.42 4.06
2598 14915 2.816087 CACACTGCCTAGTCAGCAATTT 59.184 45.455 0.00 0.00 40.35 1.82
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
589 5933 5.875224 TCATCCACTTAACATTGGACTTGA 58.125 37.500 0.00 0.00 44.80 3.02
631 5978 7.397892 TCTGTCTTGGTATAAGAGAACAGAG 57.602 40.000 0.00 0.00 30.96 3.35
1765 7183 2.319136 AGTACGTGCGAGAGAGAGAT 57.681 50.000 0.00 0.00 0.00 2.75
1797 7263 9.253832 TGTTATGAAATTATTGTTCACCCATCT 57.746 29.630 0.00 0.00 37.80 2.90
2185 14494 4.573201 GCCCATGTGATTTCCATCAAAATG 59.427 41.667 0.00 0.00 41.30 2.32
2392 14708 3.565902 TGTCTCGCTGTCTATGTCCATAG 59.434 47.826 7.81 7.81 41.58 2.23
2438 14755 4.630111 TCCAACATGGAATCAAAGCAAAC 58.370 39.130 0.00 0.00 45.00 2.93
2598 14915 1.070134 GCCGAGGGTTGCTACATGATA 59.930 52.381 0.00 0.00 0.00 2.15


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.