Multiple sequence alignment - TraesCS5B01G005600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G005600 chr5B 100.000 4010 0 0 1 4010 6972387 6976396 0.000000e+00 7406.0
1 TraesCS5B01G005600 chr5D 95.271 867 33 5 1 861 505950704 505951568 0.000000e+00 1367.0
2 TraesCS5B01G005600 chr5D 80.952 189 33 3 665 850 544717953 544718141 3.230000e-31 147.0
3 TraesCS5B01G005600 chr2D 93.519 864 27 4 1 859 622866585 622865746 0.000000e+00 1258.0
4 TraesCS5B01G005600 chr2D 73.077 234 57 6 1238 1468 10024641 10024411 1.190000e-10 78.7
5 TraesCS5B01G005600 chr7D 91.387 685 50 5 184 863 98876131 98876811 0.000000e+00 929.0
6 TraesCS5B01G005600 chr7D 83.065 496 47 9 395 858 25205224 25205714 2.230000e-112 416.0
7 TraesCS5B01G005600 chr7D 94.350 177 10 0 238 414 618264558 618264734 5.110000e-69 272.0
8 TraesCS5B01G005600 chr7D 85.654 237 26 5 616 851 137844775 137844546 4.000000e-60 243.0
9 TraesCS5B01G005600 chr7D 92.683 82 4 1 287 368 137845928 137845849 2.530000e-22 117.0
10 TraesCS5B01G005600 chr7A 88.735 648 32 10 189 835 709811261 709811868 0.000000e+00 754.0
11 TraesCS5B01G005600 chr7A 93.007 143 10 0 1 143 709811119 709811261 4.060000e-50 209.0
12 TraesCS5B01G005600 chr7A 86.232 138 19 0 714 851 137821027 137820890 2.500000e-32 150.0
13 TraesCS5B01G005600 chr7A 97.183 71 2 0 287 357 137821775 137821705 1.960000e-23 121.0
14 TraesCS5B01G005600 chr4A 86.026 229 23 4 3072 3299 18014624 18014844 1.860000e-58 237.0
15 TraesCS5B01G005600 chr4A 90.000 130 3 3 3479 3608 18014945 18015064 4.150000e-35 159.0
16 TraesCS5B01G005600 chr6D 84.545 110 17 0 2840 2949 16154443 16154334 4.240000e-20 110.0
17 TraesCS5B01G005600 chr6B 83.636 110 18 0 2840 2949 27910287 27910178 1.970000e-18 104.0
18 TraesCS5B01G005600 chr2B 81.333 75 14 0 1217 1291 13735344 13735418 1.200000e-05 62.1
19 TraesCS5B01G005600 chr3A 90.909 44 4 0 816 859 719612237 719612280 4.330000e-05 60.2


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G005600 chr5B 6972387 6976396 4009 False 7406.0 7406 100.000 1 4010 1 chr5B.!!$F1 4009
1 TraesCS5B01G005600 chr5D 505950704 505951568 864 False 1367.0 1367 95.271 1 861 1 chr5D.!!$F1 860
2 TraesCS5B01G005600 chr2D 622865746 622866585 839 True 1258.0 1258 93.519 1 859 1 chr2D.!!$R2 858
3 TraesCS5B01G005600 chr7D 98876131 98876811 680 False 929.0 929 91.387 184 863 1 chr7D.!!$F2 679
4 TraesCS5B01G005600 chr7A 709811119 709811868 749 False 481.5 754 90.871 1 835 2 chr7A.!!$F1 834


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
378 379 0.984230 TGGCTACTGCAGTAAAGGCT 59.016 50.0 31.55 9.8 41.91 4.58 F
2257 2269 0.033504 TGAAGACTCCTTGGACGTGC 59.966 55.0 0.00 0.0 31.62 5.34 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2328 2340 0.032217 TGCCCCCATGAAATTCTCCC 60.032 55.0 0.0 0.0 0.0 4.3 R
3652 3664 0.031616 GTCCTCCTCATCTCCCACCT 60.032 60.0 0.0 0.0 0.0 4.0 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
31 32 6.401394 CAGGATCAACTTGATTAGTCAGACA 58.599 40.000 5.73 0.00 37.20 3.41
81 82 4.080356 AGGAGGTGTAGCATGCAGAAATAA 60.080 41.667 21.98 0.00 0.00 1.40
126 127 2.125673 GTGTATGCCGTCCACGCT 60.126 61.111 0.00 0.00 38.18 5.07
178 179 2.417719 GTGAAGTGTGTGTCAGATCCC 58.582 52.381 0.00 0.00 0.00 3.85
203 204 2.040278 ACATCTGGTTGCCTCTTTAGCA 59.960 45.455 0.00 0.00 38.81 3.49
368 369 1.740025 GAGTTGGTCAATGGCTACTGC 59.260 52.381 0.00 0.00 38.76 4.40
378 379 0.984230 TGGCTACTGCAGTAAAGGCT 59.016 50.000 31.55 9.80 41.91 4.58
402 403 7.063544 GCTAGATGTTTTGTCTAACTCGTTCAT 59.936 37.037 0.00 0.00 0.00 2.57
689 700 2.033372 GGAGGAACAGGCCTAGAGTAC 58.967 57.143 3.98 0.00 38.73 2.73
690 701 2.623502 GGAGGAACAGGCCTAGAGTACA 60.624 54.545 3.98 0.00 38.73 2.90
769 780 3.764885 AATTGATTCCAACGCTACAGC 57.235 42.857 0.00 0.00 34.72 4.40
862 874 6.093495 CGGGTGCTAAAAATTCAGTCTCATAA 59.907 38.462 0.00 0.00 0.00 1.90
863 875 7.201732 CGGGTGCTAAAAATTCAGTCTCATAAT 60.202 37.037 0.00 0.00 0.00 1.28
864 876 8.131731 GGGTGCTAAAAATTCAGTCTCATAATC 58.868 37.037 0.00 0.00 0.00 1.75
865 877 8.897752 GGTGCTAAAAATTCAGTCTCATAATCT 58.102 33.333 0.00 0.00 0.00 2.40
872 884 8.902040 AAATTCAGTCTCATAATCTTTTTCGC 57.098 30.769 0.00 0.00 0.00 4.70
873 885 7.856145 ATTCAGTCTCATAATCTTTTTCGCT 57.144 32.000 0.00 0.00 0.00 4.93
874 886 8.948631 ATTCAGTCTCATAATCTTTTTCGCTA 57.051 30.769 0.00 0.00 0.00 4.26
875 887 7.993821 TCAGTCTCATAATCTTTTTCGCTAG 57.006 36.000 0.00 0.00 0.00 3.42
876 888 7.548097 TCAGTCTCATAATCTTTTTCGCTAGT 58.452 34.615 0.00 0.00 0.00 2.57
877 889 7.489435 TCAGTCTCATAATCTTTTTCGCTAGTG 59.511 37.037 0.00 0.00 0.00 2.74
878 890 6.256757 AGTCTCATAATCTTTTTCGCTAGTGC 59.743 38.462 0.00 0.00 0.00 4.40
879 891 6.256757 GTCTCATAATCTTTTTCGCTAGTGCT 59.743 38.462 0.00 0.00 36.97 4.40
880 892 6.477033 TCTCATAATCTTTTTCGCTAGTGCTC 59.523 38.462 0.00 0.00 36.97 4.26
881 893 6.106003 TCATAATCTTTTTCGCTAGTGCTCA 58.894 36.000 0.00 0.00 36.97 4.26
882 894 6.763135 TCATAATCTTTTTCGCTAGTGCTCAT 59.237 34.615 0.00 0.00 36.97 2.90
883 895 4.871993 ATCTTTTTCGCTAGTGCTCATG 57.128 40.909 0.00 0.00 36.97 3.07
884 896 3.002791 TCTTTTTCGCTAGTGCTCATGG 58.997 45.455 0.00 0.00 36.97 3.66
885 897 2.760634 TTTTCGCTAGTGCTCATGGA 57.239 45.000 0.00 0.00 36.97 3.41
886 898 2.988010 TTTCGCTAGTGCTCATGGAT 57.012 45.000 0.00 0.00 36.97 3.41
887 899 2.988010 TTCGCTAGTGCTCATGGATT 57.012 45.000 0.00 0.00 36.97 3.01
888 900 2.988010 TCGCTAGTGCTCATGGATTT 57.012 45.000 0.00 0.00 36.97 2.17
889 901 2.826428 TCGCTAGTGCTCATGGATTTC 58.174 47.619 0.00 0.00 36.97 2.17
890 902 1.869767 CGCTAGTGCTCATGGATTTCC 59.130 52.381 0.00 0.00 36.97 3.13
891 903 2.484417 CGCTAGTGCTCATGGATTTCCT 60.484 50.000 0.00 0.00 36.97 3.36
892 904 3.549794 GCTAGTGCTCATGGATTTCCTT 58.450 45.455 0.00 0.00 34.87 3.36
893 905 3.950395 GCTAGTGCTCATGGATTTCCTTT 59.050 43.478 0.00 0.00 34.87 3.11
894 906 4.400567 GCTAGTGCTCATGGATTTCCTTTT 59.599 41.667 0.00 0.00 34.87 2.27
895 907 5.449725 GCTAGTGCTCATGGATTTCCTTTTC 60.450 44.000 0.00 0.00 34.87 2.29
896 908 4.670765 AGTGCTCATGGATTTCCTTTTCT 58.329 39.130 0.00 0.00 36.82 2.52
897 909 5.082425 AGTGCTCATGGATTTCCTTTTCTT 58.918 37.500 0.00 0.00 36.82 2.52
898 910 5.184671 AGTGCTCATGGATTTCCTTTTCTTC 59.815 40.000 0.00 0.00 36.82 2.87
899 911 5.047802 GTGCTCATGGATTTCCTTTTCTTCA 60.048 40.000 0.00 0.00 36.82 3.02
900 912 5.718130 TGCTCATGGATTTCCTTTTCTTCAT 59.282 36.000 0.00 0.00 36.82 2.57
901 913 6.891361 TGCTCATGGATTTCCTTTTCTTCATA 59.109 34.615 0.00 0.00 36.82 2.15
902 914 7.562454 TGCTCATGGATTTCCTTTTCTTCATAT 59.438 33.333 0.00 0.00 36.82 1.78
903 915 9.071276 GCTCATGGATTTCCTTTTCTTCATATA 57.929 33.333 0.00 0.00 36.82 0.86
930 942 9.810870 AAAGTAAGGTAACCCAACATAAATACA 57.189 29.630 0.00 0.00 37.17 2.29
931 943 9.457436 AAGTAAGGTAACCCAACATAAATACAG 57.543 33.333 0.00 0.00 37.17 2.74
932 944 8.608598 AGTAAGGTAACCCAACATAAATACAGT 58.391 33.333 0.00 0.00 37.17 3.55
933 945 9.889128 GTAAGGTAACCCAACATAAATACAGTA 57.111 33.333 0.00 0.00 37.17 2.74
935 947 9.984590 AAGGTAACCCAACATAAATACAGTATT 57.015 29.630 0.00 0.00 37.17 1.89
936 948 9.623000 AGGTAACCCAACATAAATACAGTATTC 57.377 33.333 6.26 0.00 37.17 1.75
937 949 9.623000 GGTAACCCAACATAAATACAGTATTCT 57.377 33.333 6.26 0.78 0.00 2.40
940 952 9.528489 AACCCAACATAAATACAGTATTCTTGT 57.472 29.630 6.26 9.94 0.00 3.16
941 953 8.956426 ACCCAACATAAATACAGTATTCTTGTG 58.044 33.333 16.30 9.61 0.00 3.33
942 954 8.956426 CCCAACATAAATACAGTATTCTTGTGT 58.044 33.333 16.30 10.08 0.00 3.72
949 961 8.677148 AAATACAGTATTCTTGTGTTGTGACT 57.323 30.769 6.26 0.00 0.00 3.41
950 962 7.891183 ATACAGTATTCTTGTGTTGTGACTC 57.109 36.000 0.00 0.00 0.00 3.36
951 963 5.670485 ACAGTATTCTTGTGTTGTGACTCA 58.330 37.500 0.00 0.00 0.00 3.41
952 964 6.291377 ACAGTATTCTTGTGTTGTGACTCAT 58.709 36.000 0.00 0.00 0.00 2.90
953 965 7.441836 ACAGTATTCTTGTGTTGTGACTCATA 58.558 34.615 0.00 0.00 0.00 2.15
954 966 7.931407 ACAGTATTCTTGTGTTGTGACTCATAA 59.069 33.333 0.00 0.00 0.00 1.90
955 967 8.223769 CAGTATTCTTGTGTTGTGACTCATAAC 58.776 37.037 10.84 10.84 36.31 1.89
956 968 7.931407 AGTATTCTTGTGTTGTGACTCATAACA 59.069 33.333 15.28 15.28 41.68 2.41
957 969 7.750229 ATTCTTGTGTTGTGACTCATAACAT 57.250 32.000 20.39 4.94 44.50 2.71
958 970 6.544038 TCTTGTGTTGTGACTCATAACATG 57.456 37.500 20.39 14.64 44.50 3.21
959 971 4.747540 TGTGTTGTGACTCATAACATGC 57.252 40.909 20.39 11.63 44.50 4.06
960 972 3.501828 TGTGTTGTGACTCATAACATGCC 59.498 43.478 20.39 11.06 44.50 4.40
961 973 3.501828 GTGTTGTGACTCATAACATGCCA 59.498 43.478 20.39 0.00 44.50 4.92
962 974 4.156556 GTGTTGTGACTCATAACATGCCAT 59.843 41.667 20.39 0.00 44.50 4.40
963 975 4.395854 TGTTGTGACTCATAACATGCCATC 59.604 41.667 15.28 0.00 39.73 3.51
964 976 4.492494 TGTGACTCATAACATGCCATCT 57.508 40.909 0.00 0.00 0.00 2.90
965 977 4.847198 TGTGACTCATAACATGCCATCTT 58.153 39.130 0.00 0.00 0.00 2.40
966 978 5.255687 TGTGACTCATAACATGCCATCTTT 58.744 37.500 0.00 0.00 0.00 2.52
967 979 5.711506 TGTGACTCATAACATGCCATCTTTT 59.288 36.000 0.00 0.00 0.00 2.27
968 980 6.209192 TGTGACTCATAACATGCCATCTTTTT 59.791 34.615 0.00 0.00 0.00 1.94
969 981 6.529125 GTGACTCATAACATGCCATCTTTTTG 59.471 38.462 0.00 0.00 0.00 2.44
970 982 6.433716 TGACTCATAACATGCCATCTTTTTGA 59.566 34.615 0.00 0.00 0.00 2.69
971 983 7.039853 TGACTCATAACATGCCATCTTTTTGAA 60.040 33.333 0.00 0.00 0.00 2.69
972 984 7.318141 ACTCATAACATGCCATCTTTTTGAAG 58.682 34.615 0.00 0.00 0.00 3.02
973 985 7.039504 ACTCATAACATGCCATCTTTTTGAAGT 60.040 33.333 0.00 0.00 0.00 3.01
974 986 7.669427 TCATAACATGCCATCTTTTTGAAGTT 58.331 30.769 0.00 0.00 0.00 2.66
975 987 8.149647 TCATAACATGCCATCTTTTTGAAGTTT 58.850 29.630 0.00 0.00 0.00 2.66
976 988 6.607735 AACATGCCATCTTTTTGAAGTTTG 57.392 33.333 0.00 0.00 0.00 2.93
977 989 5.673514 ACATGCCATCTTTTTGAAGTTTGT 58.326 33.333 0.00 0.00 0.00 2.83
978 990 5.524646 ACATGCCATCTTTTTGAAGTTTGTG 59.475 36.000 0.00 0.00 0.00 3.33
979 991 4.440880 TGCCATCTTTTTGAAGTTTGTGG 58.559 39.130 0.00 0.00 0.00 4.17
980 992 4.161189 TGCCATCTTTTTGAAGTTTGTGGA 59.839 37.500 0.00 0.00 0.00 4.02
981 993 4.746611 GCCATCTTTTTGAAGTTTGTGGAG 59.253 41.667 0.00 0.00 0.00 3.86
982 994 5.291971 CCATCTTTTTGAAGTTTGTGGAGG 58.708 41.667 0.00 0.00 0.00 4.30
983 995 5.291971 CATCTTTTTGAAGTTTGTGGAGGG 58.708 41.667 0.00 0.00 0.00 4.30
984 996 3.132111 TCTTTTTGAAGTTTGTGGAGGGC 59.868 43.478 0.00 0.00 0.00 5.19
985 997 1.028905 TTTGAAGTTTGTGGAGGGCG 58.971 50.000 0.00 0.00 0.00 6.13
986 998 1.452145 TTGAAGTTTGTGGAGGGCGC 61.452 55.000 0.00 0.00 0.00 6.53
987 999 1.896660 GAAGTTTGTGGAGGGCGCA 60.897 57.895 10.83 0.00 0.00 6.09
988 1000 2.130073 GAAGTTTGTGGAGGGCGCAC 62.130 60.000 10.83 5.15 0.00 5.34
989 1001 3.670377 GTTTGTGGAGGGCGCACC 61.670 66.667 5.73 10.41 40.67 5.01
1003 1015 3.501396 CACCTAGGCGTGCAATGG 58.499 61.111 9.30 0.00 0.00 3.16
1009 1021 3.102097 GGCGTGCAATGGCTAGAC 58.898 61.111 6.52 0.00 46.30 2.59
1010 1022 2.703409 GCGTGCAATGGCTAGACG 59.297 61.111 0.00 0.00 41.91 4.18
1011 1023 1.809619 GCGTGCAATGGCTAGACGA 60.810 57.895 7.56 0.00 38.71 4.20
1012 1024 1.999051 CGTGCAATGGCTAGACGAC 59.001 57.895 0.00 0.00 38.71 4.34
1013 1025 0.458543 CGTGCAATGGCTAGACGACT 60.459 55.000 0.00 0.00 38.71 4.18
1014 1026 1.002366 GTGCAATGGCTAGACGACTG 58.998 55.000 0.00 0.00 41.91 3.51
1015 1027 0.894835 TGCAATGGCTAGACGACTGA 59.105 50.000 0.00 0.00 41.91 3.41
1016 1028 1.482182 TGCAATGGCTAGACGACTGAT 59.518 47.619 0.00 0.00 41.91 2.90
1017 1029 1.863454 GCAATGGCTAGACGACTGATG 59.137 52.381 0.00 0.00 36.96 3.07
1018 1030 2.477825 CAATGGCTAGACGACTGATGG 58.522 52.381 0.00 0.00 0.00 3.51
1019 1031 2.073252 ATGGCTAGACGACTGATGGA 57.927 50.000 0.00 0.00 0.00 3.41
1020 1032 1.103803 TGGCTAGACGACTGATGGAC 58.896 55.000 0.00 0.00 0.00 4.02
1021 1033 0.386113 GGCTAGACGACTGATGGACC 59.614 60.000 0.00 0.00 0.00 4.46
1022 1034 1.394618 GCTAGACGACTGATGGACCT 58.605 55.000 0.00 0.00 0.00 3.85
1023 1035 1.751924 GCTAGACGACTGATGGACCTT 59.248 52.381 0.00 0.00 0.00 3.50
1024 1036 2.166664 GCTAGACGACTGATGGACCTTT 59.833 50.000 0.00 0.00 0.00 3.11
1025 1037 2.751166 AGACGACTGATGGACCTTTG 57.249 50.000 0.00 0.00 0.00 2.77
1026 1038 1.276421 AGACGACTGATGGACCTTTGG 59.724 52.381 0.00 0.00 0.00 3.28
1027 1039 1.275291 GACGACTGATGGACCTTTGGA 59.725 52.381 0.00 0.00 0.00 3.53
1028 1040 1.697432 ACGACTGATGGACCTTTGGAA 59.303 47.619 0.00 0.00 0.00 3.53
1029 1041 2.305927 ACGACTGATGGACCTTTGGAAT 59.694 45.455 0.00 0.00 0.00 3.01
1030 1042 2.679837 CGACTGATGGACCTTTGGAATG 59.320 50.000 0.00 0.00 0.00 2.67
1031 1043 3.619733 CGACTGATGGACCTTTGGAATGA 60.620 47.826 0.00 0.00 0.00 2.57
1032 1044 4.335416 GACTGATGGACCTTTGGAATGAA 58.665 43.478 0.00 0.00 0.00 2.57
1033 1045 4.939255 ACTGATGGACCTTTGGAATGAAT 58.061 39.130 0.00 0.00 0.00 2.57
1034 1046 4.708421 ACTGATGGACCTTTGGAATGAATG 59.292 41.667 0.00 0.00 0.00 2.67
1035 1047 4.025360 TGATGGACCTTTGGAATGAATGG 58.975 43.478 0.00 0.00 0.00 3.16
1036 1048 2.818921 TGGACCTTTGGAATGAATGGG 58.181 47.619 0.00 0.00 0.00 4.00
1037 1049 2.381618 TGGACCTTTGGAATGAATGGGA 59.618 45.455 0.00 0.00 0.00 4.37
1038 1050 3.026694 GGACCTTTGGAATGAATGGGAG 58.973 50.000 0.00 0.00 0.00 4.30
1039 1051 3.309121 GGACCTTTGGAATGAATGGGAGA 60.309 47.826 0.00 0.00 0.00 3.71
1040 1052 4.540715 GACCTTTGGAATGAATGGGAGAT 58.459 43.478 0.00 0.00 0.00 2.75
1041 1053 4.540715 ACCTTTGGAATGAATGGGAGATC 58.459 43.478 0.00 0.00 0.00 2.75
1042 1054 3.893813 CCTTTGGAATGAATGGGAGATCC 59.106 47.826 0.00 0.00 0.00 3.36
1052 1064 1.985622 TGGGAGATCCAAATCCTGGT 58.014 50.000 0.47 0.00 46.51 4.00
1053 1065 3.144068 TGGGAGATCCAAATCCTGGTA 57.856 47.619 0.47 0.00 46.51 3.25
1054 1066 2.777692 TGGGAGATCCAAATCCTGGTAC 59.222 50.000 0.47 0.00 46.51 3.34
1055 1067 3.049344 GGGAGATCCAAATCCTGGTACT 58.951 50.000 0.47 0.00 46.51 2.73
1056 1068 3.459969 GGGAGATCCAAATCCTGGTACTT 59.540 47.826 0.47 0.00 46.51 2.24
1057 1069 4.455606 GGAGATCCAAATCCTGGTACTTG 58.544 47.826 0.00 0.00 46.51 3.16
1058 1070 4.080299 GGAGATCCAAATCCTGGTACTTGT 60.080 45.833 0.00 0.00 46.51 3.16
1059 1071 5.104259 AGATCCAAATCCTGGTACTTGTC 57.896 43.478 0.00 0.00 46.51 3.18
1060 1072 4.536090 AGATCCAAATCCTGGTACTTGTCA 59.464 41.667 0.00 0.00 46.51 3.58
1061 1073 4.286297 TCCAAATCCTGGTACTTGTCAG 57.714 45.455 0.00 0.00 46.51 3.51
1062 1074 2.749621 CCAAATCCTGGTACTTGTCAGC 59.250 50.000 0.00 0.00 40.78 4.26
1063 1075 3.560025 CCAAATCCTGGTACTTGTCAGCT 60.560 47.826 0.00 0.00 40.78 4.24
1064 1076 4.323485 CCAAATCCTGGTACTTGTCAGCTA 60.323 45.833 0.00 0.00 40.78 3.32
1065 1077 4.473477 AATCCTGGTACTTGTCAGCTAC 57.527 45.455 0.00 0.00 0.00 3.58
1066 1078 2.884320 TCCTGGTACTTGTCAGCTACA 58.116 47.619 0.00 0.00 35.88 2.74
1067 1079 2.561419 TCCTGGTACTTGTCAGCTACAC 59.439 50.000 0.00 0.00 38.00 2.90
1068 1080 2.299013 CCTGGTACTTGTCAGCTACACA 59.701 50.000 0.00 0.00 38.00 3.72
1069 1081 3.055819 CCTGGTACTTGTCAGCTACACAT 60.056 47.826 0.00 0.00 38.00 3.21
1070 1082 4.563580 CCTGGTACTTGTCAGCTACACATT 60.564 45.833 0.00 0.00 38.00 2.71
1071 1083 4.314961 TGGTACTTGTCAGCTACACATTG 58.685 43.478 0.00 0.00 38.00 2.82
1072 1084 3.125316 GGTACTTGTCAGCTACACATTGC 59.875 47.826 0.00 0.00 38.00 3.56
1073 1085 2.849942 ACTTGTCAGCTACACATTGCA 58.150 42.857 0.00 0.00 38.00 4.08
1074 1086 3.213506 ACTTGTCAGCTACACATTGCAA 58.786 40.909 0.00 0.00 38.00 4.08
1075 1087 3.251729 ACTTGTCAGCTACACATTGCAAG 59.748 43.478 4.94 0.00 38.00 4.01
1076 1088 2.849942 TGTCAGCTACACATTGCAAGT 58.150 42.857 4.94 0.00 31.43 3.16
1077 1089 2.807967 TGTCAGCTACACATTGCAAGTC 59.192 45.455 4.94 0.00 31.43 3.01
1078 1090 2.807967 GTCAGCTACACATTGCAAGTCA 59.192 45.455 4.94 0.00 0.00 3.41
1079 1091 3.438087 GTCAGCTACACATTGCAAGTCAT 59.562 43.478 4.94 0.00 0.00 3.06
1080 1092 3.686241 TCAGCTACACATTGCAAGTCATC 59.314 43.478 4.94 0.00 0.00 2.92
1081 1093 3.012518 AGCTACACATTGCAAGTCATCC 58.987 45.455 4.94 0.00 0.00 3.51
1082 1094 3.012518 GCTACACATTGCAAGTCATCCT 58.987 45.455 4.94 0.00 0.00 3.24
1083 1095 3.441572 GCTACACATTGCAAGTCATCCTT 59.558 43.478 4.94 0.00 0.00 3.36
1091 1103 1.915141 CAAGTCATCCTTGTTGCCCT 58.085 50.000 0.00 0.00 44.64 5.19
1092 1104 1.815003 CAAGTCATCCTTGTTGCCCTC 59.185 52.381 0.00 0.00 44.64 4.30
1093 1105 0.036010 AGTCATCCTTGTTGCCCTCG 60.036 55.000 0.00 0.00 0.00 4.63
1094 1106 1.377202 TCATCCTTGTTGCCCTCGC 60.377 57.895 0.00 0.00 0.00 5.03
1095 1107 2.044946 ATCCTTGTTGCCCTCGCC 60.045 61.111 0.00 0.00 0.00 5.54
1096 1108 2.905996 ATCCTTGTTGCCCTCGCCA 61.906 57.895 0.00 0.00 0.00 5.69
1097 1109 2.826777 ATCCTTGTTGCCCTCGCCAG 62.827 60.000 0.00 0.00 0.00 4.85
1098 1110 3.058160 CTTGTTGCCCTCGCCAGG 61.058 66.667 0.00 0.00 39.98 4.45
1099 1111 3.551496 CTTGTTGCCCTCGCCAGGA 62.551 63.158 0.00 0.00 43.65 3.86
1100 1112 3.126703 TTGTTGCCCTCGCCAGGAA 62.127 57.895 0.00 0.00 43.65 3.36
1101 1113 3.056328 GTTGCCCTCGCCAGGAAC 61.056 66.667 0.00 0.00 43.65 3.62
1102 1114 4.344865 TTGCCCTCGCCAGGAACC 62.345 66.667 0.00 0.00 43.65 3.62
1105 1117 4.452733 CCCTCGCCAGGAACCGTC 62.453 72.222 0.00 0.00 43.65 4.79
1106 1118 4.796231 CCTCGCCAGGAACCGTCG 62.796 72.222 0.00 0.00 43.65 5.12
1107 1119 4.796231 CTCGCCAGGAACCGTCGG 62.796 72.222 10.48 10.48 0.00 4.79
1111 1123 4.452733 CCAGGAACCGTCGGCTCC 62.453 72.222 23.67 23.67 38.18 4.70
1112 1124 3.691342 CAGGAACCGTCGGCTCCA 61.691 66.667 30.45 0.00 40.21 3.86
1113 1125 3.382832 AGGAACCGTCGGCTCCAG 61.383 66.667 30.45 0.00 40.21 3.86
1114 1126 4.452733 GGAACCGTCGGCTCCAGG 62.453 72.222 25.63 0.00 37.84 4.45
1134 1146 4.680237 TCTGCCGTGCGGAGGTTG 62.680 66.667 15.45 0.00 39.19 3.77
1146 1158 4.339335 AGGTTGGTCCTCTGGCTT 57.661 55.556 0.00 0.00 44.42 4.35
1147 1159 1.763770 AGGTTGGTCCTCTGGCTTG 59.236 57.895 0.00 0.00 44.42 4.01
1148 1160 1.973812 GGTTGGTCCTCTGGCTTGC 60.974 63.158 0.00 0.00 0.00 4.01
1149 1161 1.228245 GTTGGTCCTCTGGCTTGCA 60.228 57.895 0.00 0.00 0.00 4.08
1150 1162 0.610232 GTTGGTCCTCTGGCTTGCAT 60.610 55.000 0.00 0.00 0.00 3.96
1151 1163 0.991146 TTGGTCCTCTGGCTTGCATA 59.009 50.000 0.00 0.00 0.00 3.14
1152 1164 0.253044 TGGTCCTCTGGCTTGCATAC 59.747 55.000 0.00 0.00 0.00 2.39
1153 1165 0.464554 GGTCCTCTGGCTTGCATACC 60.465 60.000 0.00 0.00 0.00 2.73
1154 1166 0.543749 GTCCTCTGGCTTGCATACCT 59.456 55.000 7.02 0.00 0.00 3.08
1155 1167 0.543277 TCCTCTGGCTTGCATACCTG 59.457 55.000 7.02 6.58 0.00 4.00
1164 1176 3.819188 GCATACCTGCTGGCAGAC 58.181 61.111 20.86 10.37 46.30 3.51
1165 1177 1.222936 GCATACCTGCTGGCAGACT 59.777 57.895 20.86 10.26 46.30 3.24
1166 1178 0.813210 GCATACCTGCTGGCAGACTC 60.813 60.000 20.86 0.40 46.30 3.36
1167 1179 0.179062 CATACCTGCTGGCAGACTCC 60.179 60.000 20.86 0.00 46.30 3.85
1168 1180 0.618680 ATACCTGCTGGCAGACTCCA 60.619 55.000 20.86 5.46 46.30 3.86
1169 1181 1.544825 TACCTGCTGGCAGACTCCAC 61.545 60.000 20.86 0.00 46.30 4.02
1170 1182 2.745698 CTGCTGGCAGACTCCACA 59.254 61.111 20.86 4.25 46.30 4.17
1171 1183 1.375652 CTGCTGGCAGACTCCACAG 60.376 63.158 20.86 10.87 46.30 3.66
1172 1184 2.046507 GCTGGCAGACTCCACAGG 60.047 66.667 20.86 0.00 31.74 4.00
1173 1185 2.667418 CTGGCAGACTCCACAGGG 59.333 66.667 9.42 0.00 31.74 4.45
1174 1186 2.122413 TGGCAGACTCCACAGGGT 60.122 61.111 0.00 0.00 34.93 4.34
1175 1187 1.770110 TGGCAGACTCCACAGGGTT 60.770 57.895 0.00 0.00 34.93 4.11
1176 1188 0.472925 TGGCAGACTCCACAGGGTTA 60.473 55.000 0.00 0.00 34.93 2.85
1177 1189 0.912486 GGCAGACTCCACAGGGTTAT 59.088 55.000 0.00 0.00 34.93 1.89
1178 1190 2.116238 GGCAGACTCCACAGGGTTATA 58.884 52.381 0.00 0.00 34.93 0.98
1179 1191 2.706190 GGCAGACTCCACAGGGTTATAT 59.294 50.000 0.00 0.00 34.93 0.86
1180 1192 3.495100 GGCAGACTCCACAGGGTTATATG 60.495 52.174 0.00 0.00 34.93 1.78
1181 1193 3.733337 CAGACTCCACAGGGTTATATGC 58.267 50.000 0.00 0.00 34.93 3.14
1182 1194 2.706190 AGACTCCACAGGGTTATATGCC 59.294 50.000 0.00 0.00 34.93 4.40
1183 1195 2.438021 GACTCCACAGGGTTATATGCCA 59.562 50.000 1.43 0.00 34.93 4.92
1184 1196 3.056080 ACTCCACAGGGTTATATGCCAT 58.944 45.455 1.43 0.00 34.93 4.40
1185 1197 3.073062 ACTCCACAGGGTTATATGCCATC 59.927 47.826 1.43 0.00 34.93 3.51
1186 1198 2.038426 TCCACAGGGTTATATGCCATCG 59.962 50.000 1.43 0.00 34.93 3.84
1187 1199 2.426522 CACAGGGTTATATGCCATCGG 58.573 52.381 1.43 0.00 0.00 4.18
1197 1209 3.987404 GCCATCGGCCACATATCC 58.013 61.111 2.24 0.00 44.06 2.59
1198 1210 1.675641 GCCATCGGCCACATATCCC 60.676 63.158 2.24 0.00 44.06 3.85
1199 1211 2.069776 CCATCGGCCACATATCCCT 58.930 57.895 2.24 0.00 0.00 4.20
1200 1212 0.401738 CCATCGGCCACATATCCCTT 59.598 55.000 2.24 0.00 0.00 3.95
1201 1213 1.628340 CCATCGGCCACATATCCCTTA 59.372 52.381 2.24 0.00 0.00 2.69
1202 1214 2.355108 CCATCGGCCACATATCCCTTAG 60.355 54.545 2.24 0.00 0.00 2.18
1203 1215 0.685097 TCGGCCACATATCCCTTAGC 59.315 55.000 2.24 0.00 0.00 3.09
1204 1216 0.396435 CGGCCACATATCCCTTAGCA 59.604 55.000 2.24 0.00 0.00 3.49
1205 1217 1.609061 CGGCCACATATCCCTTAGCAG 60.609 57.143 2.24 0.00 0.00 4.24
1206 1218 1.528129 GCCACATATCCCTTAGCAGC 58.472 55.000 0.00 0.00 0.00 5.25
1207 1219 1.202806 GCCACATATCCCTTAGCAGCA 60.203 52.381 0.00 0.00 0.00 4.41
1208 1220 2.775890 CCACATATCCCTTAGCAGCAG 58.224 52.381 0.00 0.00 0.00 4.24
1209 1221 2.551721 CCACATATCCCTTAGCAGCAGG 60.552 54.545 0.00 0.00 0.00 4.85
1210 1222 1.072965 ACATATCCCTTAGCAGCAGGC 59.927 52.381 0.00 0.00 45.30 4.85
1239 1251 2.854522 CCGGCTGGTTACTTTCTGG 58.145 57.895 2.29 0.00 0.00 3.86
1240 1252 0.676782 CCGGCTGGTTACTTTCTGGG 60.677 60.000 2.29 0.00 0.00 4.45
1241 1253 1.305930 CGGCTGGTTACTTTCTGGGC 61.306 60.000 0.00 0.00 0.00 5.36
1242 1254 0.251165 GGCTGGTTACTTTCTGGGCA 60.251 55.000 0.00 0.00 0.00 5.36
1243 1255 0.881796 GCTGGTTACTTTCTGGGCAC 59.118 55.000 0.00 0.00 0.00 5.01
1255 1267 2.661537 GGGCACCGTTTTTGCTGC 60.662 61.111 0.00 0.00 40.86 5.25
1256 1268 2.417097 GGCACCGTTTTTGCTGCT 59.583 55.556 0.00 0.00 40.07 4.24
1257 1269 1.950630 GGCACCGTTTTTGCTGCTG 60.951 57.895 0.00 0.00 40.07 4.41
1258 1270 1.065600 GCACCGTTTTTGCTGCTGA 59.934 52.632 0.00 0.00 37.00 4.26
1259 1271 0.527385 GCACCGTTTTTGCTGCTGAA 60.527 50.000 0.00 0.00 37.00 3.02
1260 1272 1.199624 CACCGTTTTTGCTGCTGAAC 58.800 50.000 0.00 2.52 0.00 3.18
1261 1273 0.102300 ACCGTTTTTGCTGCTGAACC 59.898 50.000 0.00 0.00 0.00 3.62
1262 1274 0.385390 CCGTTTTTGCTGCTGAACCT 59.615 50.000 0.00 0.00 0.00 3.50
1263 1275 1.480205 CGTTTTTGCTGCTGAACCTG 58.520 50.000 0.00 0.00 0.00 4.00
1264 1276 1.856802 GTTTTTGCTGCTGAACCTGG 58.143 50.000 0.00 0.00 0.00 4.45
1265 1277 0.752054 TTTTTGCTGCTGAACCTGGG 59.248 50.000 0.00 0.00 0.00 4.45
1266 1278 0.396974 TTTTGCTGCTGAACCTGGGT 60.397 50.000 0.00 0.00 0.00 4.51
1267 1279 1.108727 TTTGCTGCTGAACCTGGGTG 61.109 55.000 0.00 0.00 0.00 4.61
1268 1280 2.674380 GCTGCTGAACCTGGGTGG 60.674 66.667 0.00 0.00 42.93 4.61
1269 1281 2.674380 CTGCTGAACCTGGGTGGC 60.674 66.667 0.00 0.00 40.22 5.01
1270 1282 4.284550 TGCTGAACCTGGGTGGCC 62.285 66.667 0.00 0.00 40.22 5.36
1280 1292 4.360405 GGGTGGCCCGGACAACAT 62.360 66.667 11.47 0.00 32.13 2.71
1281 1293 2.750237 GGTGGCCCGGACAACATC 60.750 66.667 2.31 0.00 0.00 3.06
1282 1294 2.033448 GTGGCCCGGACAACATCA 59.967 61.111 0.73 0.00 0.00 3.07
1283 1295 2.033448 TGGCCCGGACAACATCAC 59.967 61.111 0.73 0.00 0.00 3.06
1284 1296 2.750237 GGCCCGGACAACATCACC 60.750 66.667 0.73 0.00 0.00 4.02
1285 1297 3.124921 GCCCGGACAACATCACCG 61.125 66.667 0.73 0.00 45.24 4.94
1286 1298 3.124921 CCCGGACAACATCACCGC 61.125 66.667 0.73 0.00 44.45 5.68
1287 1299 3.124921 CCGGACAACATCACCGCC 61.125 66.667 0.00 0.00 44.45 6.13
1288 1300 2.047274 CGGACAACATCACCGCCT 60.047 61.111 0.00 0.00 40.19 5.52
1289 1301 1.216977 CGGACAACATCACCGCCTA 59.783 57.895 0.00 0.00 40.19 3.93
1290 1302 0.179084 CGGACAACATCACCGCCTAT 60.179 55.000 0.00 0.00 40.19 2.57
1291 1303 1.742411 CGGACAACATCACCGCCTATT 60.742 52.381 0.00 0.00 40.19 1.73
1292 1304 1.940613 GGACAACATCACCGCCTATTC 59.059 52.381 0.00 0.00 0.00 1.75
1293 1305 2.627945 GACAACATCACCGCCTATTCA 58.372 47.619 0.00 0.00 0.00 2.57
1294 1306 2.351726 GACAACATCACCGCCTATTCAC 59.648 50.000 0.00 0.00 0.00 3.18
1295 1307 2.027192 ACAACATCACCGCCTATTCACT 60.027 45.455 0.00 0.00 0.00 3.41
1296 1308 3.009723 CAACATCACCGCCTATTCACTT 58.990 45.455 0.00 0.00 0.00 3.16
1297 1309 2.632377 ACATCACCGCCTATTCACTTG 58.368 47.619 0.00 0.00 0.00 3.16
1298 1310 2.236146 ACATCACCGCCTATTCACTTGA 59.764 45.455 0.00 0.00 0.00 3.02
1299 1311 3.118261 ACATCACCGCCTATTCACTTGAT 60.118 43.478 0.00 0.00 0.00 2.57
1300 1312 2.905075 TCACCGCCTATTCACTTGATG 58.095 47.619 0.00 0.00 0.00 3.07
1301 1313 2.499693 TCACCGCCTATTCACTTGATGA 59.500 45.455 0.00 0.00 34.65 2.92
1302 1314 2.609459 CACCGCCTATTCACTTGATGAC 59.391 50.000 0.00 0.00 36.92 3.06
1303 1315 2.236146 ACCGCCTATTCACTTGATGACA 59.764 45.455 0.00 0.00 36.92 3.58
1304 1316 3.270027 CCGCCTATTCACTTGATGACAA 58.730 45.455 0.00 0.00 36.92 3.18
1305 1317 3.879295 CCGCCTATTCACTTGATGACAAT 59.121 43.478 0.00 0.00 36.92 2.71
1306 1318 4.024556 CCGCCTATTCACTTGATGACAATC 60.025 45.833 0.00 0.00 36.92 2.67
1307 1319 4.318333 CGCCTATTCACTTGATGACAATCG 60.318 45.833 0.00 0.00 36.92 3.34
1308 1320 4.811024 GCCTATTCACTTGATGACAATCGA 59.189 41.667 0.00 0.00 36.92 3.59
1309 1321 5.277058 GCCTATTCACTTGATGACAATCGAC 60.277 44.000 0.00 0.00 36.92 4.20
1310 1322 6.045318 CCTATTCACTTGATGACAATCGACT 58.955 40.000 0.00 0.00 36.92 4.18
1311 1323 6.199908 CCTATTCACTTGATGACAATCGACTC 59.800 42.308 0.00 0.00 36.92 3.36
1312 1324 4.790765 TCACTTGATGACAATCGACTCT 57.209 40.909 0.00 0.00 35.37 3.24
1313 1325 4.488879 TCACTTGATGACAATCGACTCTG 58.511 43.478 0.00 0.00 35.37 3.35
1314 1326 3.615937 CACTTGATGACAATCGACTCTGG 59.384 47.826 0.00 0.00 35.37 3.86
1315 1327 3.259374 ACTTGATGACAATCGACTCTGGT 59.741 43.478 0.00 0.00 35.37 4.00
1316 1328 3.961480 TGATGACAATCGACTCTGGTT 57.039 42.857 0.00 0.00 35.37 3.67
1317 1329 3.588955 TGATGACAATCGACTCTGGTTG 58.411 45.455 0.00 0.00 35.37 3.77
1318 1330 1.795768 TGACAATCGACTCTGGTTGC 58.204 50.000 0.00 0.00 0.00 4.17
1319 1331 0.716108 GACAATCGACTCTGGTTGCG 59.284 55.000 0.00 0.00 0.00 4.85
1320 1332 1.291877 ACAATCGACTCTGGTTGCGC 61.292 55.000 0.00 0.00 0.00 6.09
1321 1333 1.741770 AATCGACTCTGGTTGCGCC 60.742 57.895 4.18 0.00 37.90 6.53
1322 1334 2.449031 AATCGACTCTGGTTGCGCCA 62.449 55.000 4.18 0.00 46.95 5.69
1323 1335 3.414700 CGACTCTGGTTGCGCCAC 61.415 66.667 4.18 3.19 43.61 5.01
1324 1336 2.280797 GACTCTGGTTGCGCCACA 60.281 61.111 14.15 4.79 43.61 4.17
1325 1337 1.672356 GACTCTGGTTGCGCCACAT 60.672 57.895 14.15 0.00 43.61 3.21
1326 1338 1.915614 GACTCTGGTTGCGCCACATG 61.916 60.000 14.15 5.44 43.61 3.21
1327 1339 3.332493 CTCTGGTTGCGCCACATGC 62.332 63.158 14.15 0.00 43.61 4.06
1328 1340 3.367743 CTGGTTGCGCCACATGCT 61.368 61.111 14.15 0.00 43.61 3.79
1329 1341 2.033294 TGGTTGCGCCACATGCTA 59.967 55.556 14.15 0.00 43.61 3.49
1330 1342 1.585267 CTGGTTGCGCCACATGCTAA 61.585 55.000 14.15 0.00 43.61 3.09
1331 1343 1.154035 GGTTGCGCCACATGCTAAC 60.154 57.895 14.15 4.21 38.05 2.34
1332 1344 1.586154 GGTTGCGCCACATGCTAACT 61.586 55.000 14.15 0.00 38.05 2.24
1333 1345 1.083489 GTTGCGCCACATGCTAACTA 58.917 50.000 4.18 0.00 38.05 2.24
1334 1346 1.670811 GTTGCGCCACATGCTAACTAT 59.329 47.619 4.18 0.00 38.05 2.12
1335 1347 1.298602 TGCGCCACATGCTAACTATG 58.701 50.000 4.18 0.00 38.05 2.23
1336 1348 0.588252 GCGCCACATGCTAACTATGG 59.412 55.000 0.00 0.00 38.05 2.74
1337 1349 1.953559 CGCCACATGCTAACTATGGT 58.046 50.000 0.00 0.00 38.05 3.55
1338 1350 2.805295 GCGCCACATGCTAACTATGGTA 60.805 50.000 0.00 0.00 38.05 3.25
1339 1351 3.059884 CGCCACATGCTAACTATGGTAG 58.940 50.000 0.00 0.00 38.05 3.18
1340 1352 3.492656 CGCCACATGCTAACTATGGTAGT 60.493 47.826 0.00 0.00 38.16 2.73
1341 1353 3.809832 GCCACATGCTAACTATGGTAGTG 59.190 47.826 0.00 0.00 36.61 2.74
1342 1354 3.809832 CCACATGCTAACTATGGTAGTGC 59.190 47.826 0.00 0.00 39.39 4.40
1343 1355 4.441792 CACATGCTAACTATGGTAGTGCA 58.558 43.478 6.26 6.26 40.50 4.57
1344 1356 4.509230 CACATGCTAACTATGGTAGTGCAG 59.491 45.833 8.93 2.96 39.87 4.41
1345 1357 3.819564 TGCTAACTATGGTAGTGCAGG 57.180 47.619 0.00 0.00 39.39 4.85
1346 1358 3.104512 TGCTAACTATGGTAGTGCAGGT 58.895 45.455 0.00 0.00 39.39 4.00
1347 1359 3.132289 TGCTAACTATGGTAGTGCAGGTC 59.868 47.826 0.00 0.00 39.39 3.85
1348 1360 3.492829 GCTAACTATGGTAGTGCAGGTCC 60.493 52.174 0.00 0.00 39.39 4.46
1349 1361 2.552093 ACTATGGTAGTGCAGGTCCT 57.448 50.000 0.00 0.00 37.69 3.85
1350 1362 2.111384 ACTATGGTAGTGCAGGTCCTG 58.889 52.381 15.15 15.15 37.69 3.86
1351 1363 1.414181 CTATGGTAGTGCAGGTCCTGG 59.586 57.143 20.72 2.60 31.21 4.45
1352 1364 1.274703 ATGGTAGTGCAGGTCCTGGG 61.275 60.000 20.72 0.00 31.21 4.45
1353 1365 1.612442 GGTAGTGCAGGTCCTGGGA 60.612 63.158 20.72 0.00 31.21 4.37
1354 1366 1.617947 GGTAGTGCAGGTCCTGGGAG 61.618 65.000 20.72 0.00 31.21 4.30
1355 1367 1.990060 TAGTGCAGGTCCTGGGAGC 60.990 63.158 20.72 10.48 42.36 4.70
1361 1373 3.647367 GGTCCTGGGAGCTGCATA 58.353 61.111 7.79 0.00 39.31 3.14
1362 1374 2.149530 GGTCCTGGGAGCTGCATAT 58.850 57.895 7.79 0.00 39.31 1.78
1363 1375 1.352083 GGTCCTGGGAGCTGCATATA 58.648 55.000 7.79 0.00 39.31 0.86
1364 1376 1.912043 GGTCCTGGGAGCTGCATATAT 59.088 52.381 7.79 0.00 39.31 0.86
1365 1377 2.307098 GGTCCTGGGAGCTGCATATATT 59.693 50.000 7.79 0.00 39.31 1.28
1366 1378 3.341823 GTCCTGGGAGCTGCATATATTG 58.658 50.000 7.79 0.00 0.00 1.90
1367 1379 2.981784 TCCTGGGAGCTGCATATATTGT 59.018 45.455 7.79 0.00 0.00 2.71
1368 1380 3.008375 TCCTGGGAGCTGCATATATTGTC 59.992 47.826 7.79 0.00 0.00 3.18
1369 1381 3.008813 CCTGGGAGCTGCATATATTGTCT 59.991 47.826 7.79 0.00 0.00 3.41
1370 1382 4.223700 CCTGGGAGCTGCATATATTGTCTA 59.776 45.833 7.79 0.00 0.00 2.59
1371 1383 5.152623 TGGGAGCTGCATATATTGTCTAC 57.847 43.478 7.79 0.00 0.00 2.59
1372 1384 4.592778 TGGGAGCTGCATATATTGTCTACA 59.407 41.667 7.79 0.00 0.00 2.74
1373 1385 5.174395 GGGAGCTGCATATATTGTCTACAG 58.826 45.833 7.79 0.00 0.00 2.74
1374 1386 5.174395 GGAGCTGCATATATTGTCTACAGG 58.826 45.833 0.00 0.00 0.00 4.00
1375 1387 5.279708 GGAGCTGCATATATTGTCTACAGGT 60.280 44.000 0.00 0.00 37.12 4.00
1376 1388 5.788450 AGCTGCATATATTGTCTACAGGTC 58.212 41.667 1.02 0.00 29.06 3.85
1377 1389 5.541868 AGCTGCATATATTGTCTACAGGTCT 59.458 40.000 1.02 0.00 29.06 3.85
1378 1390 5.636965 GCTGCATATATTGTCTACAGGTCTG 59.363 44.000 0.00 0.00 0.00 3.51
1379 1391 5.541845 TGCATATATTGTCTACAGGTCTGC 58.458 41.667 0.00 0.00 0.00 4.26
1380 1392 4.932200 GCATATATTGTCTACAGGTCTGCC 59.068 45.833 0.00 0.00 0.00 4.85
1381 1393 5.511373 GCATATATTGTCTACAGGTCTGCCA 60.511 44.000 0.00 0.00 37.19 4.92
1382 1394 2.770164 ATTGTCTACAGGTCTGCCAC 57.230 50.000 0.00 0.00 37.19 5.01
1383 1395 1.717032 TTGTCTACAGGTCTGCCACT 58.283 50.000 0.00 0.00 37.19 4.00
1384 1396 0.969149 TGTCTACAGGTCTGCCACTG 59.031 55.000 0.00 0.00 40.48 3.66
1385 1397 0.390472 GTCTACAGGTCTGCCACTGC 60.390 60.000 0.00 0.00 38.25 4.40
1386 1398 1.078848 CTACAGGTCTGCCACTGCC 60.079 63.158 0.00 0.00 38.25 4.85
1387 1399 1.830587 CTACAGGTCTGCCACTGCCA 61.831 60.000 0.00 0.00 38.25 4.92
1388 1400 1.414866 TACAGGTCTGCCACTGCCAA 61.415 55.000 0.00 0.00 38.25 4.52
1389 1401 2.113986 AGGTCTGCCACTGCCAAC 59.886 61.111 0.00 0.00 37.19 3.77
1390 1402 3.357079 GGTCTGCCACTGCCAACG 61.357 66.667 0.00 0.00 36.33 4.10
1391 1403 3.357079 GTCTGCCACTGCCAACGG 61.357 66.667 0.00 0.00 36.33 4.44
1392 1404 4.641645 TCTGCCACTGCCAACGGG 62.642 66.667 0.00 0.00 36.33 5.28
1393 1405 4.641645 CTGCCACTGCCAACGGGA 62.642 66.667 0.00 0.00 36.33 5.14
1394 1406 4.947147 TGCCACTGCCAACGGGAC 62.947 66.667 0.00 0.00 36.33 4.46
1395 1407 4.947147 GCCACTGCCAACGGGACA 62.947 66.667 0.00 0.00 35.59 4.02
1396 1408 2.034066 CCACTGCCAACGGGACAT 59.966 61.111 0.00 0.00 35.59 3.06
1397 1409 1.603455 CCACTGCCAACGGGACATT 60.603 57.895 0.00 0.00 35.59 2.71
1398 1410 1.178534 CCACTGCCAACGGGACATTT 61.179 55.000 0.00 0.00 35.59 2.32
1399 1411 0.039256 CACTGCCAACGGGACATTTG 60.039 55.000 0.00 0.00 35.59 2.32
1400 1412 0.467290 ACTGCCAACGGGACATTTGT 60.467 50.000 0.00 0.00 35.59 2.83
1401 1413 0.039256 CTGCCAACGGGACATTTGTG 60.039 55.000 0.00 0.00 35.59 3.33
1402 1414 0.753479 TGCCAACGGGACATTTGTGT 60.753 50.000 0.00 0.00 35.59 3.72
1403 1415 0.387565 GCCAACGGGACATTTGTGTT 59.612 50.000 0.00 0.00 35.59 3.32
1404 1416 1.202475 GCCAACGGGACATTTGTGTTT 60.202 47.619 0.00 0.00 35.59 2.83
1405 1417 2.034812 GCCAACGGGACATTTGTGTTTA 59.965 45.455 0.00 0.00 35.59 2.01
1406 1418 3.305744 GCCAACGGGACATTTGTGTTTAT 60.306 43.478 0.00 0.00 35.59 1.40
1407 1419 4.481463 CCAACGGGACATTTGTGTTTATC 58.519 43.478 0.00 0.00 35.59 1.75
1408 1420 4.155449 CAACGGGACATTTGTGTTTATCG 58.845 43.478 0.00 0.00 0.00 2.92
1409 1421 2.160813 ACGGGACATTTGTGTTTATCGC 59.839 45.455 0.00 0.00 0.00 4.58
1410 1422 2.418628 CGGGACATTTGTGTTTATCGCT 59.581 45.455 0.00 0.00 0.00 4.93
1411 1423 3.119990 CGGGACATTTGTGTTTATCGCTT 60.120 43.478 0.00 0.00 0.00 4.68
1412 1424 4.412207 GGGACATTTGTGTTTATCGCTTC 58.588 43.478 0.00 0.00 0.00 3.86
1413 1425 4.412207 GGACATTTGTGTTTATCGCTTCC 58.588 43.478 0.00 0.00 0.00 3.46
1414 1426 4.412207 GACATTTGTGTTTATCGCTTCCC 58.588 43.478 0.00 0.00 0.00 3.97
1415 1427 4.079253 ACATTTGTGTTTATCGCTTCCCT 58.921 39.130 0.00 0.00 0.00 4.20
1416 1428 4.156008 ACATTTGTGTTTATCGCTTCCCTC 59.844 41.667 0.00 0.00 0.00 4.30
1417 1429 3.695830 TTGTGTTTATCGCTTCCCTCT 57.304 42.857 0.00 0.00 0.00 3.69
1418 1430 3.695830 TGTGTTTATCGCTTCCCTCTT 57.304 42.857 0.00 0.00 0.00 2.85
1419 1431 3.334691 TGTGTTTATCGCTTCCCTCTTG 58.665 45.455 0.00 0.00 0.00 3.02
1420 1432 3.007506 TGTGTTTATCGCTTCCCTCTTGA 59.992 43.478 0.00 0.00 0.00 3.02
1421 1433 4.192317 GTGTTTATCGCTTCCCTCTTGAT 58.808 43.478 0.00 0.00 0.00 2.57
1422 1434 4.034510 GTGTTTATCGCTTCCCTCTTGATG 59.965 45.833 0.00 0.00 0.00 3.07
1423 1435 4.192317 GTTTATCGCTTCCCTCTTGATGT 58.808 43.478 0.00 0.00 0.00 3.06
1424 1436 4.487714 TTATCGCTTCCCTCTTGATGTT 57.512 40.909 0.00 0.00 0.00 2.71
1425 1437 2.386661 TCGCTTCCCTCTTGATGTTC 57.613 50.000 0.00 0.00 0.00 3.18
1426 1438 1.623311 TCGCTTCCCTCTTGATGTTCA 59.377 47.619 0.00 0.00 0.00 3.18
1427 1439 1.734465 CGCTTCCCTCTTGATGTTCAC 59.266 52.381 0.00 0.00 0.00 3.18
1428 1440 2.613977 CGCTTCCCTCTTGATGTTCACT 60.614 50.000 0.00 0.00 0.00 3.41
1429 1441 2.746362 GCTTCCCTCTTGATGTTCACTG 59.254 50.000 0.00 0.00 0.00 3.66
1430 1442 3.808618 GCTTCCCTCTTGATGTTCACTGT 60.809 47.826 0.00 0.00 0.00 3.55
1431 1443 3.685139 TCCCTCTTGATGTTCACTGTC 57.315 47.619 0.00 0.00 0.00 3.51
1432 1444 2.029020 TCCCTCTTGATGTTCACTGTCG 60.029 50.000 0.00 0.00 0.00 4.35
1433 1445 2.341257 CCTCTTGATGTTCACTGTCGG 58.659 52.381 0.00 0.00 0.00 4.79
1434 1446 2.289072 CCTCTTGATGTTCACTGTCGGT 60.289 50.000 0.00 0.00 0.00 4.69
1435 1447 2.733552 CTCTTGATGTTCACTGTCGGTG 59.266 50.000 5.35 5.35 46.60 4.94
1436 1448 1.195448 CTTGATGTTCACTGTCGGTGC 59.805 52.381 6.95 0.00 44.98 5.01
1437 1449 0.392706 TGATGTTCACTGTCGGTGCT 59.607 50.000 6.95 0.00 44.98 4.40
1438 1450 0.792640 GATGTTCACTGTCGGTGCTG 59.207 55.000 6.95 0.00 44.98 4.41
1439 1451 0.106708 ATGTTCACTGTCGGTGCTGT 59.893 50.000 6.95 0.00 44.98 4.40
1440 1452 0.747852 TGTTCACTGTCGGTGCTGTA 59.252 50.000 6.95 0.00 44.98 2.74
1441 1453 1.137282 TGTTCACTGTCGGTGCTGTAA 59.863 47.619 6.95 0.00 44.98 2.41
1442 1454 2.206750 GTTCACTGTCGGTGCTGTAAA 58.793 47.619 6.95 0.00 44.98 2.01
1443 1455 2.148916 TCACTGTCGGTGCTGTAAAG 57.851 50.000 6.95 0.00 44.98 1.85
1444 1456 1.411246 TCACTGTCGGTGCTGTAAAGT 59.589 47.619 6.95 0.00 44.98 2.66
1445 1457 2.624364 TCACTGTCGGTGCTGTAAAGTA 59.376 45.455 6.95 0.00 44.98 2.24
1446 1458 3.257375 TCACTGTCGGTGCTGTAAAGTAT 59.743 43.478 6.95 0.00 44.98 2.12
1447 1459 3.367932 CACTGTCGGTGCTGTAAAGTATG 59.632 47.826 0.00 0.00 39.22 2.39
1448 1460 2.930040 CTGTCGGTGCTGTAAAGTATGG 59.070 50.000 0.00 0.00 0.00 2.74
1449 1461 2.277084 GTCGGTGCTGTAAAGTATGGG 58.723 52.381 0.00 0.00 0.00 4.00
1450 1462 1.208535 TCGGTGCTGTAAAGTATGGGG 59.791 52.381 0.00 0.00 0.00 4.96
1451 1463 1.208535 CGGTGCTGTAAAGTATGGGGA 59.791 52.381 0.00 0.00 0.00 4.81
1452 1464 2.741878 CGGTGCTGTAAAGTATGGGGAG 60.742 54.545 0.00 0.00 0.00 4.30
1453 1465 2.504175 GGTGCTGTAAAGTATGGGGAGA 59.496 50.000 0.00 0.00 0.00 3.71
1454 1466 3.432326 GGTGCTGTAAAGTATGGGGAGAG 60.432 52.174 0.00 0.00 0.00 3.20
1455 1467 2.771943 TGCTGTAAAGTATGGGGAGAGG 59.228 50.000 0.00 0.00 0.00 3.69
1456 1468 3.039011 GCTGTAAAGTATGGGGAGAGGA 58.961 50.000 0.00 0.00 0.00 3.71
1457 1469 3.181464 GCTGTAAAGTATGGGGAGAGGAC 60.181 52.174 0.00 0.00 0.00 3.85
1458 1470 4.030913 CTGTAAAGTATGGGGAGAGGACA 58.969 47.826 0.00 0.00 0.00 4.02
1459 1471 4.631234 TGTAAAGTATGGGGAGAGGACAT 58.369 43.478 0.00 0.00 0.00 3.06
1460 1472 4.408921 TGTAAAGTATGGGGAGAGGACATG 59.591 45.833 0.00 0.00 0.00 3.21
1461 1473 2.109229 AGTATGGGGAGAGGACATGG 57.891 55.000 0.00 0.00 0.00 3.66
1462 1474 1.059913 GTATGGGGAGAGGACATGGG 58.940 60.000 0.00 0.00 0.00 4.00
1463 1475 0.768221 TATGGGGAGAGGACATGGGC 60.768 60.000 0.00 0.00 0.00 5.36
1464 1476 2.692368 GGGGAGAGGACATGGGCA 60.692 66.667 0.00 0.00 0.00 5.36
1465 1477 2.592308 GGGAGAGGACATGGGCAC 59.408 66.667 0.00 0.00 0.00 5.01
1466 1478 1.997874 GGGAGAGGACATGGGCACT 60.998 63.158 0.00 0.00 0.00 4.40
1467 1479 1.524482 GGAGAGGACATGGGCACTC 59.476 63.158 0.00 0.86 0.00 3.51
1468 1480 1.267574 GGAGAGGACATGGGCACTCA 61.268 60.000 0.00 0.00 32.52 3.41
1469 1481 0.615331 GAGAGGACATGGGCACTCAA 59.385 55.000 0.00 0.00 32.52 3.02
1470 1482 0.617413 AGAGGACATGGGCACTCAAG 59.383 55.000 0.00 0.00 32.52 3.02
1471 1483 1.001641 AGGACATGGGCACTCAAGC 60.002 57.895 0.00 0.00 0.00 4.01
1472 1484 2.401766 GGACATGGGCACTCAAGCG 61.402 63.158 0.00 0.00 34.64 4.68
1473 1485 1.672356 GACATGGGCACTCAAGCGT 60.672 57.895 0.00 0.00 34.64 5.07
1474 1486 1.915614 GACATGGGCACTCAAGCGTG 61.916 60.000 0.00 0.00 37.94 5.34
1480 1492 2.551270 CACTCAAGCGTGCGAACC 59.449 61.111 0.00 0.00 0.00 3.62
1481 1493 1.956170 CACTCAAGCGTGCGAACCT 60.956 57.895 0.00 0.00 0.00 3.50
1482 1494 0.666274 CACTCAAGCGTGCGAACCTA 60.666 55.000 0.00 0.00 0.00 3.08
1483 1495 0.388649 ACTCAAGCGTGCGAACCTAG 60.389 55.000 0.00 0.00 0.00 3.02
1484 1496 0.109272 CTCAAGCGTGCGAACCTAGA 60.109 55.000 0.00 0.00 0.00 2.43
1485 1497 0.109272 TCAAGCGTGCGAACCTAGAG 60.109 55.000 0.00 0.00 0.00 2.43
1486 1498 0.109272 CAAGCGTGCGAACCTAGAGA 60.109 55.000 0.00 0.00 0.00 3.10
1487 1499 0.171455 AAGCGTGCGAACCTAGAGAG 59.829 55.000 0.00 0.00 0.00 3.20
1488 1500 0.961358 AGCGTGCGAACCTAGAGAGT 60.961 55.000 0.00 0.00 0.00 3.24
1489 1501 0.731417 GCGTGCGAACCTAGAGAGTA 59.269 55.000 0.00 0.00 0.00 2.59
1490 1502 1.334243 GCGTGCGAACCTAGAGAGTAT 59.666 52.381 0.00 0.00 0.00 2.12
1491 1503 2.602694 GCGTGCGAACCTAGAGAGTATC 60.603 54.545 0.00 0.00 0.00 2.24
1492 1504 2.031857 CGTGCGAACCTAGAGAGTATCC 60.032 54.545 0.00 0.00 33.66 2.59
1493 1505 2.031857 GTGCGAACCTAGAGAGTATCCG 60.032 54.545 0.00 0.00 33.66 4.18
1494 1506 1.536331 GCGAACCTAGAGAGTATCCGG 59.464 57.143 0.00 0.00 33.66 5.14
1495 1507 2.809665 GCGAACCTAGAGAGTATCCGGA 60.810 54.545 6.61 6.61 33.66 5.14
1496 1508 3.068560 CGAACCTAGAGAGTATCCGGAG 58.931 54.545 11.34 0.00 33.66 4.63
1497 1509 3.494749 CGAACCTAGAGAGTATCCGGAGT 60.495 52.174 11.34 0.48 33.66 3.85
1498 1510 4.463070 GAACCTAGAGAGTATCCGGAGTT 58.537 47.826 11.34 4.01 33.66 3.01
1499 1511 4.089408 ACCTAGAGAGTATCCGGAGTTC 57.911 50.000 11.34 7.43 33.66 3.01
1500 1512 3.181441 ACCTAGAGAGTATCCGGAGTTCC 60.181 52.174 11.34 0.00 33.66 3.62
1501 1513 2.368311 AGAGAGTATCCGGAGTTCCC 57.632 55.000 11.34 0.00 33.66 3.97
1502 1514 1.854280 AGAGAGTATCCGGAGTTCCCT 59.146 52.381 11.34 2.89 33.66 4.20
1503 1515 2.158579 AGAGAGTATCCGGAGTTCCCTC 60.159 54.545 11.34 12.30 33.66 4.30
1504 1516 1.569548 AGAGTATCCGGAGTTCCCTCA 59.430 52.381 11.34 0.00 35.84 3.86
1505 1517 2.024273 AGAGTATCCGGAGTTCCCTCAA 60.024 50.000 11.34 0.00 35.84 3.02
1506 1518 2.101082 GAGTATCCGGAGTTCCCTCAAC 59.899 54.545 11.34 0.00 39.64 3.18
1507 1519 1.829222 GTATCCGGAGTTCCCTCAACA 59.171 52.381 11.34 0.00 39.64 3.33
1508 1520 1.358152 ATCCGGAGTTCCCTCAACAA 58.642 50.000 11.34 0.00 39.64 2.83
1509 1521 1.133363 TCCGGAGTTCCCTCAACAAA 58.867 50.000 0.00 0.00 39.64 2.83
1510 1522 1.071699 TCCGGAGTTCCCTCAACAAAG 59.928 52.381 0.00 0.00 39.64 2.77
1511 1523 0.875059 CGGAGTTCCCTCAACAAAGC 59.125 55.000 0.00 0.00 39.64 3.51
1512 1524 1.248486 GGAGTTCCCTCAACAAAGCC 58.752 55.000 0.00 0.00 39.64 4.35
1513 1525 1.202940 GGAGTTCCCTCAACAAAGCCT 60.203 52.381 0.00 0.00 39.64 4.58
1514 1526 1.882623 GAGTTCCCTCAACAAAGCCTG 59.117 52.381 0.00 0.00 37.48 4.85
1515 1527 1.215423 AGTTCCCTCAACAAAGCCTGT 59.785 47.619 0.00 0.00 41.27 4.00
1516 1528 1.338020 GTTCCCTCAACAAAGCCTGTG 59.662 52.381 0.00 0.00 38.67 3.66
1517 1529 0.178992 TCCCTCAACAAAGCCTGTGG 60.179 55.000 0.00 0.00 38.67 4.17
1529 1541 3.540211 CCTGTGGCAAGGAGTACTG 57.460 57.895 0.00 0.00 40.02 2.74
1530 1542 0.687354 CCTGTGGCAAGGAGTACTGT 59.313 55.000 0.00 0.00 40.02 3.55
1531 1543 1.072331 CCTGTGGCAAGGAGTACTGTT 59.928 52.381 0.00 0.00 40.02 3.16
1532 1544 2.301870 CCTGTGGCAAGGAGTACTGTTA 59.698 50.000 0.00 0.00 40.02 2.41
1533 1545 3.055094 CCTGTGGCAAGGAGTACTGTTAT 60.055 47.826 0.00 0.00 40.02 1.89
1534 1546 3.935203 CTGTGGCAAGGAGTACTGTTATG 59.065 47.826 0.00 0.00 0.00 1.90
1535 1547 2.678336 GTGGCAAGGAGTACTGTTATGC 59.322 50.000 0.00 5.56 0.00 3.14
1536 1548 2.571653 TGGCAAGGAGTACTGTTATGCT 59.428 45.455 0.00 0.00 33.09 3.79
1537 1549 3.772572 TGGCAAGGAGTACTGTTATGCTA 59.227 43.478 0.00 0.66 33.09 3.49
1538 1550 4.224147 TGGCAAGGAGTACTGTTATGCTAA 59.776 41.667 0.00 0.00 33.09 3.09
1539 1551 4.811557 GGCAAGGAGTACTGTTATGCTAAG 59.188 45.833 0.00 0.00 33.09 2.18
1540 1552 4.271291 GCAAGGAGTACTGTTATGCTAAGC 59.729 45.833 0.00 0.00 0.00 3.09
1541 1553 4.674281 AGGAGTACTGTTATGCTAAGCC 57.326 45.455 0.00 0.00 0.00 4.35
1542 1554 4.290942 AGGAGTACTGTTATGCTAAGCCT 58.709 43.478 0.00 0.00 0.00 4.58
1543 1555 5.455872 AGGAGTACTGTTATGCTAAGCCTA 58.544 41.667 0.00 0.00 0.00 3.93
1544 1556 5.897824 AGGAGTACTGTTATGCTAAGCCTAA 59.102 40.000 0.00 0.00 0.00 2.69
1545 1557 6.383147 AGGAGTACTGTTATGCTAAGCCTAAA 59.617 38.462 0.00 0.00 0.00 1.85
1546 1558 7.046033 GGAGTACTGTTATGCTAAGCCTAAAA 58.954 38.462 0.00 0.00 0.00 1.52
1547 1559 7.224949 GGAGTACTGTTATGCTAAGCCTAAAAG 59.775 40.741 0.00 0.00 32.69 2.27
1548 1560 7.621796 AGTACTGTTATGCTAAGCCTAAAAGT 58.378 34.615 0.00 0.00 39.36 2.66
1549 1561 6.743575 ACTGTTATGCTAAGCCTAAAAGTG 57.256 37.500 0.00 0.00 36.41 3.16
1550 1562 5.123979 ACTGTTATGCTAAGCCTAAAAGTGC 59.876 40.000 0.00 0.00 36.41 4.40
1551 1563 4.398044 TGTTATGCTAAGCCTAAAAGTGCC 59.602 41.667 0.00 0.00 0.00 5.01
1552 1564 2.577606 TGCTAAGCCTAAAAGTGCCA 57.422 45.000 0.00 0.00 0.00 4.92
1553 1565 2.870175 TGCTAAGCCTAAAAGTGCCAA 58.130 42.857 0.00 0.00 0.00 4.52
1554 1566 3.226777 TGCTAAGCCTAAAAGTGCCAAA 58.773 40.909 0.00 0.00 0.00 3.28
1555 1567 3.255642 TGCTAAGCCTAAAAGTGCCAAAG 59.744 43.478 0.00 0.00 0.00 2.77
1556 1568 3.367395 GCTAAGCCTAAAAGTGCCAAAGG 60.367 47.826 0.00 0.00 0.00 3.11
1557 1569 2.675658 AGCCTAAAAGTGCCAAAGGA 57.324 45.000 0.00 0.00 0.00 3.36
1558 1570 2.957474 AGCCTAAAAGTGCCAAAGGAA 58.043 42.857 0.00 0.00 0.00 3.36
1559 1571 3.304829 AGCCTAAAAGTGCCAAAGGAAA 58.695 40.909 0.00 0.00 0.00 3.13
1560 1572 3.321968 AGCCTAAAAGTGCCAAAGGAAAG 59.678 43.478 0.00 0.00 0.00 2.62
1561 1573 3.320826 GCCTAAAAGTGCCAAAGGAAAGA 59.679 43.478 0.00 0.00 0.00 2.52
1562 1574 4.021104 GCCTAAAAGTGCCAAAGGAAAGAT 60.021 41.667 0.00 0.00 0.00 2.40
1563 1575 5.511373 GCCTAAAAGTGCCAAAGGAAAGATT 60.511 40.000 0.00 0.00 0.00 2.40
1564 1576 5.928264 CCTAAAAGTGCCAAAGGAAAGATTG 59.072 40.000 0.00 0.00 0.00 2.67
1565 1577 5.612725 AAAAGTGCCAAAGGAAAGATTGA 57.387 34.783 0.00 0.00 0.00 2.57
1566 1578 5.813513 AAAGTGCCAAAGGAAAGATTGAT 57.186 34.783 0.00 0.00 0.00 2.57
1567 1579 4.796038 AGTGCCAAAGGAAAGATTGATG 57.204 40.909 0.00 0.00 0.00 3.07
1568 1580 4.410099 AGTGCCAAAGGAAAGATTGATGA 58.590 39.130 0.00 0.00 0.00 2.92
1569 1581 5.021458 AGTGCCAAAGGAAAGATTGATGAT 58.979 37.500 0.00 0.00 0.00 2.45
1570 1582 5.105473 AGTGCCAAAGGAAAGATTGATGATG 60.105 40.000 0.00 0.00 0.00 3.07
1571 1583 5.018149 TGCCAAAGGAAAGATTGATGATGA 58.982 37.500 0.00 0.00 0.00 2.92
1572 1584 5.481122 TGCCAAAGGAAAGATTGATGATGAA 59.519 36.000 0.00 0.00 0.00 2.57
1573 1585 6.040878 GCCAAAGGAAAGATTGATGATGAAG 58.959 40.000 0.00 0.00 0.00 3.02
1574 1586 6.040878 CCAAAGGAAAGATTGATGATGAAGC 58.959 40.000 0.00 0.00 0.00 3.86
1575 1587 5.848833 AAGGAAAGATTGATGATGAAGCC 57.151 39.130 0.00 0.00 0.00 4.35
1576 1588 4.213513 AGGAAAGATTGATGATGAAGCCC 58.786 43.478 0.00 0.00 0.00 5.19
1577 1589 4.079327 AGGAAAGATTGATGATGAAGCCCT 60.079 41.667 0.00 0.00 0.00 5.19
1578 1590 4.277921 GGAAAGATTGATGATGAAGCCCTC 59.722 45.833 0.00 0.00 0.00 4.30
1579 1591 3.505480 AGATTGATGATGAAGCCCTCC 57.495 47.619 0.00 0.00 0.00 4.30
1580 1592 2.149578 GATTGATGATGAAGCCCTCCG 58.850 52.381 0.00 0.00 0.00 4.63
1581 1593 0.181114 TTGATGATGAAGCCCTCCGG 59.819 55.000 0.00 0.00 0.00 5.14
1582 1594 0.690744 TGATGATGAAGCCCTCCGGA 60.691 55.000 2.93 2.93 0.00 5.14
1583 1595 0.689623 GATGATGAAGCCCTCCGGAT 59.310 55.000 3.57 0.00 0.00 4.18
1584 1596 0.399454 ATGATGAAGCCCTCCGGATG 59.601 55.000 3.57 0.81 0.00 3.51
1585 1597 0.690744 TGATGAAGCCCTCCGGATGA 60.691 55.000 3.57 0.00 0.00 2.92
1586 1598 0.250081 GATGAAGCCCTCCGGATGAC 60.250 60.000 3.57 0.00 0.00 3.06
1587 1599 0.692419 ATGAAGCCCTCCGGATGACT 60.692 55.000 3.57 0.00 0.00 3.41
1588 1600 1.144936 GAAGCCCTCCGGATGACTG 59.855 63.158 3.57 0.00 0.00 3.51
1589 1601 2.932130 GAAGCCCTCCGGATGACTGC 62.932 65.000 3.57 0.93 0.00 4.40
1590 1602 3.474570 GCCCTCCGGATGACTGCT 61.475 66.667 3.57 0.00 0.00 4.24
1591 1603 2.818132 CCCTCCGGATGACTGCTC 59.182 66.667 3.57 0.00 0.00 4.26
1592 1604 2.060383 CCCTCCGGATGACTGCTCA 61.060 63.158 3.57 0.00 0.00 4.26
1593 1605 1.406065 CCCTCCGGATGACTGCTCAT 61.406 60.000 3.57 0.00 40.07 2.90
1594 1606 0.467384 CCTCCGGATGACTGCTCATT 59.533 55.000 3.57 0.00 37.24 2.57
1595 1607 1.539929 CCTCCGGATGACTGCTCATTC 60.540 57.143 3.57 0.00 37.24 2.67
1596 1608 0.465705 TCCGGATGACTGCTCATTCC 59.534 55.000 0.00 0.00 37.24 3.01
1597 1609 0.533755 CCGGATGACTGCTCATTCCC 60.534 60.000 0.00 0.00 37.24 3.97
1598 1610 0.467384 CGGATGACTGCTCATTCCCT 59.533 55.000 0.00 0.00 37.24 4.20
1599 1611 1.809271 CGGATGACTGCTCATTCCCTG 60.809 57.143 0.00 0.00 37.24 4.45
1600 1612 1.211457 GGATGACTGCTCATTCCCTGT 59.789 52.381 0.00 0.00 37.24 4.00
1601 1613 2.356535 GGATGACTGCTCATTCCCTGTT 60.357 50.000 0.00 0.00 37.24 3.16
1602 1614 2.957402 TGACTGCTCATTCCCTGTTT 57.043 45.000 0.00 0.00 0.00 2.83
1603 1615 3.228188 TGACTGCTCATTCCCTGTTTT 57.772 42.857 0.00 0.00 0.00 2.43
1604 1616 4.365514 TGACTGCTCATTCCCTGTTTTA 57.634 40.909 0.00 0.00 0.00 1.52
1605 1617 4.922206 TGACTGCTCATTCCCTGTTTTAT 58.078 39.130 0.00 0.00 0.00 1.40
1606 1618 6.061022 TGACTGCTCATTCCCTGTTTTATA 57.939 37.500 0.00 0.00 0.00 0.98
1607 1619 5.880332 TGACTGCTCATTCCCTGTTTTATAC 59.120 40.000 0.00 0.00 0.00 1.47
1608 1620 6.067217 ACTGCTCATTCCCTGTTTTATACT 57.933 37.500 0.00 0.00 0.00 2.12
1609 1621 7.093068 TGACTGCTCATTCCCTGTTTTATACTA 60.093 37.037 0.00 0.00 0.00 1.82
1610 1622 7.806180 ACTGCTCATTCCCTGTTTTATACTAT 58.194 34.615 0.00 0.00 0.00 2.12
1611 1623 8.275040 ACTGCTCATTCCCTGTTTTATACTATT 58.725 33.333 0.00 0.00 0.00 1.73
1612 1624 9.125026 CTGCTCATTCCCTGTTTTATACTATTT 57.875 33.333 0.00 0.00 0.00 1.40
1613 1625 8.902806 TGCTCATTCCCTGTTTTATACTATTTG 58.097 33.333 0.00 0.00 0.00 2.32
1614 1626 7.862873 GCTCATTCCCTGTTTTATACTATTTGC 59.137 37.037 0.00 0.00 0.00 3.68
1615 1627 8.815565 TCATTCCCTGTTTTATACTATTTGCA 57.184 30.769 0.00 0.00 0.00 4.08
1616 1628 9.420118 TCATTCCCTGTTTTATACTATTTGCAT 57.580 29.630 0.00 0.00 0.00 3.96
1617 1629 9.467258 CATTCCCTGTTTTATACTATTTGCATG 57.533 33.333 0.00 0.00 0.00 4.06
1618 1630 7.038154 TCCCTGTTTTATACTATTTGCATGC 57.962 36.000 11.82 11.82 0.00 4.06
1619 1631 6.605194 TCCCTGTTTTATACTATTTGCATGCA 59.395 34.615 18.46 18.46 0.00 3.96
1620 1632 7.123397 TCCCTGTTTTATACTATTTGCATGCAA 59.877 33.333 28.80 28.80 0.00 4.08
1621 1633 7.436080 CCCTGTTTTATACTATTTGCATGCAAG 59.564 37.037 30.25 22.39 37.24 4.01
1622 1634 7.043192 CCTGTTTTATACTATTTGCATGCAAGC 60.043 37.037 30.25 7.04 37.24 4.01
1623 1635 6.756074 TGTTTTATACTATTTGCATGCAAGCC 59.244 34.615 30.25 10.60 37.24 4.35
1624 1636 5.452078 TTATACTATTTGCATGCAAGCCC 57.548 39.130 30.25 0.00 37.24 5.19
1625 1637 1.856629 ACTATTTGCATGCAAGCCCT 58.143 45.000 30.25 19.10 37.24 5.19
1626 1638 3.017048 ACTATTTGCATGCAAGCCCTA 57.983 42.857 30.25 17.72 37.24 3.53
1627 1639 2.954318 ACTATTTGCATGCAAGCCCTAG 59.046 45.455 30.25 26.73 37.24 3.02
1628 1640 1.856629 ATTTGCATGCAAGCCCTAGT 58.143 45.000 30.25 5.10 37.24 2.57
1629 1641 1.631405 TTTGCATGCAAGCCCTAGTT 58.369 45.000 30.25 0.00 37.24 2.24
1630 1642 2.505650 TTGCATGCAAGCCCTAGTTA 57.494 45.000 28.80 2.84 0.00 2.24
1631 1643 2.042686 TGCATGCAAGCCCTAGTTAG 57.957 50.000 20.30 0.00 0.00 2.34
1632 1644 1.281867 TGCATGCAAGCCCTAGTTAGT 59.718 47.619 20.30 0.00 0.00 2.24
1633 1645 2.290896 TGCATGCAAGCCCTAGTTAGTT 60.291 45.455 20.30 0.00 0.00 2.24
1634 1646 2.356069 GCATGCAAGCCCTAGTTAGTTC 59.644 50.000 14.21 0.00 0.00 3.01
1635 1647 3.878778 CATGCAAGCCCTAGTTAGTTCT 58.121 45.455 0.00 0.00 0.00 3.01
1636 1648 4.265073 CATGCAAGCCCTAGTTAGTTCTT 58.735 43.478 0.00 0.00 0.00 2.52
1637 1649 3.939066 TGCAAGCCCTAGTTAGTTCTTC 58.061 45.455 0.00 0.00 0.00 2.87
1638 1650 3.326588 TGCAAGCCCTAGTTAGTTCTTCA 59.673 43.478 0.00 0.00 0.00 3.02
1639 1651 4.019321 TGCAAGCCCTAGTTAGTTCTTCAT 60.019 41.667 0.00 0.00 0.00 2.57
1640 1652 4.572795 GCAAGCCCTAGTTAGTTCTTCATC 59.427 45.833 0.00 0.00 0.00 2.92
1641 1653 4.657436 AGCCCTAGTTAGTTCTTCATCG 57.343 45.455 0.00 0.00 0.00 3.84
1642 1654 3.385111 AGCCCTAGTTAGTTCTTCATCGG 59.615 47.826 0.00 0.00 0.00 4.18
1643 1655 3.718815 CCCTAGTTAGTTCTTCATCGGC 58.281 50.000 0.00 0.00 0.00 5.54
1644 1656 3.492829 CCCTAGTTAGTTCTTCATCGGCC 60.493 52.174 0.00 0.00 0.00 6.13
1645 1657 3.132289 CCTAGTTAGTTCTTCATCGGCCA 59.868 47.826 2.24 0.00 0.00 5.36
1646 1658 2.973945 AGTTAGTTCTTCATCGGCCAC 58.026 47.619 2.24 0.00 0.00 5.01
1647 1659 2.007608 GTTAGTTCTTCATCGGCCACC 58.992 52.381 2.24 0.00 0.00 4.61
1648 1660 1.271856 TAGTTCTTCATCGGCCACCA 58.728 50.000 2.24 0.00 0.00 4.17
1649 1661 0.400213 AGTTCTTCATCGGCCACCAA 59.600 50.000 2.24 0.00 0.00 3.67
1650 1662 0.804989 GTTCTTCATCGGCCACCAAG 59.195 55.000 2.24 0.00 0.00 3.61
1651 1663 0.690192 TTCTTCATCGGCCACCAAGA 59.310 50.000 2.24 1.08 0.00 3.02
1652 1664 0.036388 TCTTCATCGGCCACCAAGAC 60.036 55.000 2.24 0.00 0.00 3.01
1653 1665 0.321564 CTTCATCGGCCACCAAGACA 60.322 55.000 2.24 0.00 0.00 3.41
1654 1666 0.321564 TTCATCGGCCACCAAGACAG 60.322 55.000 2.24 0.00 0.00 3.51
1655 1667 1.746615 CATCGGCCACCAAGACAGG 60.747 63.158 2.24 0.00 0.00 4.00
1656 1668 2.224159 ATCGGCCACCAAGACAGGT 61.224 57.895 2.24 0.00 44.48 4.00
1657 1669 2.185310 ATCGGCCACCAAGACAGGTC 62.185 60.000 2.24 0.00 40.77 3.85
1658 1670 2.883828 CGGCCACCAAGACAGGTCT 61.884 63.158 2.24 0.00 40.77 3.85
1659 1671 1.541310 CGGCCACCAAGACAGGTCTA 61.541 60.000 2.24 0.00 40.77 2.59
1660 1672 0.690762 GGCCACCAAGACAGGTCTAA 59.309 55.000 0.00 0.00 40.77 2.10
1661 1673 1.339151 GGCCACCAAGACAGGTCTAAG 60.339 57.143 0.00 0.10 40.77 2.18
1662 1674 1.348036 GCCACCAAGACAGGTCTAAGT 59.652 52.381 1.78 0.73 40.77 2.24
1663 1675 2.872038 GCCACCAAGACAGGTCTAAGTG 60.872 54.545 18.03 18.03 40.77 3.16
1664 1676 2.632996 CCACCAAGACAGGTCTAAGTGA 59.367 50.000 23.06 0.00 41.55 3.41
1665 1677 3.071023 CCACCAAGACAGGTCTAAGTGAA 59.929 47.826 23.06 0.00 41.55 3.18
1666 1678 4.310769 CACCAAGACAGGTCTAAGTGAAG 58.689 47.826 19.33 2.99 41.55 3.02
1667 1679 4.039245 CACCAAGACAGGTCTAAGTGAAGA 59.961 45.833 19.33 0.00 41.55 2.87
1668 1680 4.039366 ACCAAGACAGGTCTAAGTGAAGAC 59.961 45.833 1.78 0.00 44.31 3.01
1675 1687 2.956913 GTCTAAGTGAAGACCGGGTTC 58.043 52.381 6.32 9.27 40.06 3.62
1676 1688 2.298163 GTCTAAGTGAAGACCGGGTTCA 59.702 50.000 15.52 15.52 40.06 3.18
1677 1689 3.056035 GTCTAAGTGAAGACCGGGTTCAT 60.056 47.826 20.68 11.05 40.06 2.57
1678 1690 2.185004 AAGTGAAGACCGGGTTCATG 57.815 50.000 20.68 0.00 36.35 3.07
1679 1691 1.056660 AGTGAAGACCGGGTTCATGT 58.943 50.000 20.68 11.19 36.35 3.21
1680 1692 2.253610 AGTGAAGACCGGGTTCATGTA 58.746 47.619 20.68 0.00 36.35 2.29
1681 1693 2.635915 AGTGAAGACCGGGTTCATGTAA 59.364 45.455 20.68 0.00 36.35 2.41
1682 1694 3.263425 AGTGAAGACCGGGTTCATGTAAT 59.737 43.478 20.68 6.32 36.35 1.89
1702 1714 8.621532 TGTAATGAGATATTCCTTTGTATGGC 57.378 34.615 0.00 0.00 0.00 4.40
1703 1715 6.808008 AATGAGATATTCCTTTGTATGGCG 57.192 37.500 0.00 0.00 0.00 5.69
1704 1716 4.641396 TGAGATATTCCTTTGTATGGCGG 58.359 43.478 0.00 0.00 0.00 6.13
1705 1717 4.003648 GAGATATTCCTTTGTATGGCGGG 58.996 47.826 0.00 0.00 0.00 6.13
1706 1718 3.650942 AGATATTCCTTTGTATGGCGGGA 59.349 43.478 0.00 0.00 0.00 5.14
1707 1719 4.289672 AGATATTCCTTTGTATGGCGGGAT 59.710 41.667 0.00 0.00 0.00 3.85
1708 1720 5.487488 AGATATTCCTTTGTATGGCGGGATA 59.513 40.000 0.00 0.00 0.00 2.59
1709 1721 4.657814 ATTCCTTTGTATGGCGGGATAT 57.342 40.909 0.00 0.00 0.00 1.63
1710 1722 3.417069 TCCTTTGTATGGCGGGATATG 57.583 47.619 0.00 0.00 0.00 1.78
1711 1723 2.708861 TCCTTTGTATGGCGGGATATGT 59.291 45.455 0.00 0.00 0.00 2.29
1712 1724 2.813754 CCTTTGTATGGCGGGATATGTG 59.186 50.000 0.00 0.00 0.00 3.21
1713 1725 2.559698 TTGTATGGCGGGATATGTGG 57.440 50.000 0.00 0.00 0.00 4.17
1714 1726 1.723288 TGTATGGCGGGATATGTGGA 58.277 50.000 0.00 0.00 0.00 4.02
1715 1727 2.050918 TGTATGGCGGGATATGTGGAA 58.949 47.619 0.00 0.00 0.00 3.53
1716 1728 2.038426 TGTATGGCGGGATATGTGGAAG 59.962 50.000 0.00 0.00 0.00 3.46
1717 1729 1.434188 ATGGCGGGATATGTGGAAGA 58.566 50.000 0.00 0.00 0.00 2.87
1718 1730 1.434188 TGGCGGGATATGTGGAAGAT 58.566 50.000 0.00 0.00 0.00 2.40
1719 1731 1.072173 TGGCGGGATATGTGGAAGATG 59.928 52.381 0.00 0.00 0.00 2.90
1720 1732 1.611673 GGCGGGATATGTGGAAGATGG 60.612 57.143 0.00 0.00 0.00 3.51
1721 1733 1.072331 GCGGGATATGTGGAAGATGGT 59.928 52.381 0.00 0.00 0.00 3.55
1722 1734 2.487265 GCGGGATATGTGGAAGATGGTT 60.487 50.000 0.00 0.00 0.00 3.67
1723 1735 3.141398 CGGGATATGTGGAAGATGGTTG 58.859 50.000 0.00 0.00 0.00 3.77
1724 1736 3.181455 CGGGATATGTGGAAGATGGTTGA 60.181 47.826 0.00 0.00 0.00 3.18
1725 1737 4.685848 CGGGATATGTGGAAGATGGTTGAA 60.686 45.833 0.00 0.00 0.00 2.69
1726 1738 5.200483 GGGATATGTGGAAGATGGTTGAAA 58.800 41.667 0.00 0.00 0.00 2.69
1727 1739 5.835280 GGGATATGTGGAAGATGGTTGAAAT 59.165 40.000 0.00 0.00 0.00 2.17
1728 1740 6.239120 GGGATATGTGGAAGATGGTTGAAATG 60.239 42.308 0.00 0.00 0.00 2.32
1729 1741 6.239120 GGATATGTGGAAGATGGTTGAAATGG 60.239 42.308 0.00 0.00 0.00 3.16
1730 1742 4.111255 TGTGGAAGATGGTTGAAATGGA 57.889 40.909 0.00 0.00 0.00 3.41
1731 1743 4.478203 TGTGGAAGATGGTTGAAATGGAA 58.522 39.130 0.00 0.00 0.00 3.53
1732 1744 4.280677 TGTGGAAGATGGTTGAAATGGAAC 59.719 41.667 0.00 0.00 0.00 3.62
1733 1745 4.524328 GTGGAAGATGGTTGAAATGGAACT 59.476 41.667 0.00 0.00 0.00 3.01
1734 1746 4.766891 TGGAAGATGGTTGAAATGGAACTC 59.233 41.667 0.00 0.00 0.00 3.01
1735 1747 4.142600 GGAAGATGGTTGAAATGGAACTCG 60.143 45.833 0.00 0.00 0.00 4.18
1736 1748 2.749621 AGATGGTTGAAATGGAACTCGC 59.250 45.455 0.00 0.00 0.00 5.03
1737 1749 0.871722 TGGTTGAAATGGAACTCGCG 59.128 50.000 0.00 0.00 0.00 5.87
1738 1750 0.454452 GGTTGAAATGGAACTCGCGC 60.454 55.000 0.00 0.00 0.00 6.86
1739 1751 0.517316 GTTGAAATGGAACTCGCGCT 59.483 50.000 5.56 0.00 0.00 5.92
1740 1752 0.516877 TTGAAATGGAACTCGCGCTG 59.483 50.000 5.56 0.00 0.00 5.18
1741 1753 0.320334 TGAAATGGAACTCGCGCTGA 60.320 50.000 5.56 3.55 0.00 4.26
1742 1754 1.009829 GAAATGGAACTCGCGCTGAT 58.990 50.000 5.56 0.00 0.00 2.90
1743 1755 0.729116 AAATGGAACTCGCGCTGATG 59.271 50.000 5.56 2.00 0.00 3.07
1744 1756 0.391661 AATGGAACTCGCGCTGATGT 60.392 50.000 5.56 2.60 0.00 3.06
1745 1757 0.459899 ATGGAACTCGCGCTGATGTA 59.540 50.000 5.56 0.00 0.00 2.29
1746 1758 0.459899 TGGAACTCGCGCTGATGTAT 59.540 50.000 5.56 0.00 0.00 2.29
1747 1759 0.855349 GGAACTCGCGCTGATGTATG 59.145 55.000 5.56 0.00 0.00 2.39
1748 1760 1.536072 GGAACTCGCGCTGATGTATGA 60.536 52.381 5.56 0.00 0.00 2.15
1749 1761 1.518929 GAACTCGCGCTGATGTATGAC 59.481 52.381 5.56 0.00 0.00 3.06
1750 1762 0.455815 ACTCGCGCTGATGTATGACA 59.544 50.000 5.56 0.00 0.00 3.58
1751 1763 1.067669 ACTCGCGCTGATGTATGACAT 59.932 47.619 5.56 0.00 42.43 3.06
1752 1764 2.293399 ACTCGCGCTGATGTATGACATA 59.707 45.455 5.56 0.00 39.27 2.29
1753 1765 2.658802 CTCGCGCTGATGTATGACATAC 59.341 50.000 17.19 17.19 39.27 2.39
1754 1766 2.293399 TCGCGCTGATGTATGACATACT 59.707 45.455 22.85 11.03 39.27 2.12
1755 1767 2.406357 CGCGCTGATGTATGACATACTG 59.594 50.000 22.85 12.98 39.27 2.74
1756 1768 3.384668 GCGCTGATGTATGACATACTGT 58.615 45.455 22.85 13.51 39.27 3.55
1757 1769 4.546570 GCGCTGATGTATGACATACTGTA 58.453 43.478 22.85 6.83 39.27 2.74
1758 1770 4.383052 GCGCTGATGTATGACATACTGTAC 59.617 45.833 22.85 13.17 39.27 2.90
1759 1771 5.519722 CGCTGATGTATGACATACTGTACA 58.480 41.667 22.85 16.02 39.27 2.90
1760 1772 5.399596 CGCTGATGTATGACATACTGTACAC 59.600 44.000 22.85 9.88 39.27 2.90
1761 1773 5.692204 GCTGATGTATGACATACTGTACACC 59.308 44.000 22.85 0.41 39.27 4.16
1762 1774 6.682861 GCTGATGTATGACATACTGTACACCA 60.683 42.308 22.85 4.91 39.27 4.17
1763 1775 7.176589 TGATGTATGACATACTGTACACCAA 57.823 36.000 22.85 3.58 39.27 3.67
1764 1776 7.264947 TGATGTATGACATACTGTACACCAAG 58.735 38.462 22.85 0.00 39.27 3.61
1765 1777 5.972935 TGTATGACATACTGTACACCAAGG 58.027 41.667 22.85 0.00 36.70 3.61
1766 1778 3.328382 TGACATACTGTACACCAAGGC 57.672 47.619 0.00 0.00 0.00 4.35
1767 1779 2.903784 TGACATACTGTACACCAAGGCT 59.096 45.455 0.00 0.00 0.00 4.58
1768 1780 3.262420 GACATACTGTACACCAAGGCTG 58.738 50.000 0.00 0.00 0.00 4.85
1769 1781 2.009774 CATACTGTACACCAAGGCTGC 58.990 52.381 0.00 0.00 0.00 5.25
1770 1782 1.052617 TACTGTACACCAAGGCTGCA 58.947 50.000 0.50 0.00 0.00 4.41
1771 1783 0.250467 ACTGTACACCAAGGCTGCAG 60.250 55.000 10.11 10.11 0.00 4.41
1772 1784 0.250467 CTGTACACCAAGGCTGCAGT 60.250 55.000 16.64 0.00 0.00 4.40
1773 1785 0.534877 TGTACACCAAGGCTGCAGTG 60.535 55.000 16.64 7.80 36.30 3.66
1774 1786 0.250295 GTACACCAAGGCTGCAGTGA 60.250 55.000 16.64 0.00 34.33 3.41
1775 1787 0.692476 TACACCAAGGCTGCAGTGAT 59.308 50.000 16.64 0.00 34.33 3.06
1776 1788 0.607489 ACACCAAGGCTGCAGTGATC 60.607 55.000 16.64 3.08 34.33 2.92
1777 1789 1.001641 ACCAAGGCTGCAGTGATCC 60.002 57.895 16.64 7.84 0.00 3.36
1778 1790 1.001764 CCAAGGCTGCAGTGATCCA 60.002 57.895 16.64 0.00 0.00 3.41
1779 1791 1.310933 CCAAGGCTGCAGTGATCCAC 61.311 60.000 16.64 0.00 34.10 4.02
1780 1792 0.607217 CAAGGCTGCAGTGATCCACA 60.607 55.000 16.64 0.00 36.74 4.17
1794 1806 3.159298 CCACACATGGTCTGGCTAC 57.841 57.895 0.00 0.00 41.64 3.58
1795 1807 0.615331 CCACACATGGTCTGGCTACT 59.385 55.000 0.00 0.00 41.64 2.57
1796 1808 1.676916 CCACACATGGTCTGGCTACTG 60.677 57.143 0.00 0.00 41.64 2.74
1797 1809 0.036010 ACACATGGTCTGGCTACTGC 60.036 55.000 0.00 0.00 38.76 4.40
1798 1810 0.036105 CACATGGTCTGGCTACTGCA 60.036 55.000 0.00 0.00 41.91 4.41
1799 1811 0.914644 ACATGGTCTGGCTACTGCAT 59.085 50.000 0.00 0.00 41.91 3.96
1800 1812 1.134280 ACATGGTCTGGCTACTGCATC 60.134 52.381 0.00 0.00 41.91 3.91
1801 1813 0.471617 ATGGTCTGGCTACTGCATCC 59.528 55.000 0.00 0.00 41.91 3.51
1802 1814 1.227380 GGTCTGGCTACTGCATCCG 60.227 63.158 0.00 0.00 41.91 4.18
1803 1815 1.227380 GTCTGGCTACTGCATCCGG 60.227 63.158 0.00 0.00 41.91 5.14
1804 1816 2.109799 CTGGCTACTGCATCCGGG 59.890 66.667 0.00 0.00 41.91 5.73
1805 1817 3.466791 CTGGCTACTGCATCCGGGG 62.467 68.421 0.00 0.00 41.91 5.73
1806 1818 4.937431 GGCTACTGCATCCGGGGC 62.937 72.222 11.51 11.51 41.91 5.80
1807 1819 4.937431 GCTACTGCATCCGGGGCC 62.937 72.222 15.05 0.00 39.41 5.80
1808 1820 3.164269 CTACTGCATCCGGGGCCT 61.164 66.667 15.05 4.53 0.00 5.19
1809 1821 2.690881 TACTGCATCCGGGGCCTT 60.691 61.111 15.05 5.82 0.00 4.35
1810 1822 2.270874 CTACTGCATCCGGGGCCTTT 62.271 60.000 15.05 3.68 0.00 3.11
1811 1823 2.265467 TACTGCATCCGGGGCCTTTC 62.265 60.000 15.05 0.00 0.00 2.62
1812 1824 3.643595 CTGCATCCGGGGCCTTTCA 62.644 63.158 15.05 0.00 0.00 2.69
1813 1825 3.140814 GCATCCGGGGCCTTTCAC 61.141 66.667 0.84 0.00 0.00 3.18
1814 1826 2.440247 CATCCGGGGCCTTTCACC 60.440 66.667 0.84 0.00 0.00 4.02
1815 1827 2.938798 ATCCGGGGCCTTTCACCA 60.939 61.111 0.84 0.00 0.00 4.17
1816 1828 3.282374 ATCCGGGGCCTTTCACCAC 62.282 63.158 0.84 0.00 0.00 4.16
1817 1829 3.966543 CCGGGGCCTTTCACCACT 61.967 66.667 0.84 0.00 0.00 4.00
1818 1830 2.359975 CGGGGCCTTTCACCACTC 60.360 66.667 0.84 0.00 0.00 3.51
1819 1831 2.843545 GGGGCCTTTCACCACTCA 59.156 61.111 0.84 0.00 0.00 3.41
1820 1832 1.384191 GGGGCCTTTCACCACTCAT 59.616 57.895 0.84 0.00 0.00 2.90
1821 1833 0.681243 GGGGCCTTTCACCACTCATC 60.681 60.000 0.84 0.00 0.00 2.92
1822 1834 0.038166 GGGCCTTTCACCACTCATCA 59.962 55.000 0.84 0.00 0.00 3.07
1823 1835 1.341383 GGGCCTTTCACCACTCATCAT 60.341 52.381 0.84 0.00 0.00 2.45
1824 1836 2.019984 GGCCTTTCACCACTCATCATC 58.980 52.381 0.00 0.00 0.00 2.92
1825 1837 2.618816 GGCCTTTCACCACTCATCATCA 60.619 50.000 0.00 0.00 0.00 3.07
1826 1838 2.421424 GCCTTTCACCACTCATCATCAC 59.579 50.000 0.00 0.00 0.00 3.06
1827 1839 3.678289 CCTTTCACCACTCATCATCACA 58.322 45.455 0.00 0.00 0.00 3.58
1828 1840 4.074259 CCTTTCACCACTCATCATCACAA 58.926 43.478 0.00 0.00 0.00 3.33
1829 1841 4.083110 CCTTTCACCACTCATCATCACAAC 60.083 45.833 0.00 0.00 0.00 3.32
1830 1842 4.356405 TTCACCACTCATCATCACAACT 57.644 40.909 0.00 0.00 0.00 3.16
1831 1843 3.667360 TCACCACTCATCATCACAACTG 58.333 45.455 0.00 0.00 0.00 3.16
1832 1844 2.161012 CACCACTCATCATCACAACTGC 59.839 50.000 0.00 0.00 0.00 4.40
1833 1845 1.395954 CCACTCATCATCACAACTGCG 59.604 52.381 0.00 0.00 0.00 5.18
1834 1846 2.071540 CACTCATCATCACAACTGCGT 58.928 47.619 0.00 0.00 0.00 5.24
1835 1847 2.481568 CACTCATCATCACAACTGCGTT 59.518 45.455 0.00 0.00 0.00 4.84
1836 1848 3.058708 CACTCATCATCACAACTGCGTTT 60.059 43.478 0.00 0.00 0.00 3.60
1837 1849 3.565482 ACTCATCATCACAACTGCGTTTT 59.435 39.130 0.00 0.00 0.00 2.43
1838 1850 4.036734 ACTCATCATCACAACTGCGTTTTT 59.963 37.500 0.00 0.00 0.00 1.94
1839 1851 4.289342 TCATCATCACAACTGCGTTTTTG 58.711 39.130 0.00 0.00 0.00 2.44
1840 1852 2.458951 TCATCACAACTGCGTTTTTGC 58.541 42.857 0.00 0.00 0.00 3.68
1841 1853 2.098934 TCATCACAACTGCGTTTTTGCT 59.901 40.909 0.00 0.00 35.36 3.91
1842 1854 2.187351 TCACAACTGCGTTTTTGCTC 57.813 45.000 0.00 0.00 35.36 4.26
1843 1855 1.742831 TCACAACTGCGTTTTTGCTCT 59.257 42.857 0.00 0.00 35.36 4.09
1844 1856 2.163412 TCACAACTGCGTTTTTGCTCTT 59.837 40.909 0.00 0.00 35.36 2.85
1845 1857 2.923020 CACAACTGCGTTTTTGCTCTTT 59.077 40.909 0.00 0.00 35.36 2.52
1846 1858 3.000773 CACAACTGCGTTTTTGCTCTTTC 60.001 43.478 0.00 0.00 35.36 2.62
1847 1859 3.178267 CAACTGCGTTTTTGCTCTTTCA 58.822 40.909 0.00 0.00 35.36 2.69
1848 1860 3.070429 ACTGCGTTTTTGCTCTTTCAG 57.930 42.857 0.00 0.00 35.36 3.02
1849 1861 2.423538 ACTGCGTTTTTGCTCTTTCAGT 59.576 40.909 0.00 0.00 35.36 3.41
1850 1862 3.119495 ACTGCGTTTTTGCTCTTTCAGTT 60.119 39.130 0.00 0.00 35.36 3.16
1851 1863 3.434637 TGCGTTTTTGCTCTTTCAGTTC 58.565 40.909 0.00 0.00 35.36 3.01
1852 1864 3.119673 TGCGTTTTTGCTCTTTCAGTTCA 60.120 39.130 0.00 0.00 35.36 3.18
1853 1865 3.483558 GCGTTTTTGCTCTTTCAGTTCAG 59.516 43.478 0.00 0.00 0.00 3.02
1854 1866 4.662145 CGTTTTTGCTCTTTCAGTTCAGT 58.338 39.130 0.00 0.00 0.00 3.41
1855 1867 4.496895 CGTTTTTGCTCTTTCAGTTCAGTG 59.503 41.667 0.00 0.00 0.00 3.66
1856 1868 4.637483 TTTTGCTCTTTCAGTTCAGTGG 57.363 40.909 0.00 0.00 0.00 4.00
1857 1869 3.558931 TTGCTCTTTCAGTTCAGTGGA 57.441 42.857 0.00 0.00 0.00 4.02
1858 1870 3.117491 TGCTCTTTCAGTTCAGTGGAG 57.883 47.619 0.00 0.00 0.00 3.86
1859 1871 2.700371 TGCTCTTTCAGTTCAGTGGAGA 59.300 45.455 0.00 0.00 0.00 3.71
1860 1872 3.134623 TGCTCTTTCAGTTCAGTGGAGAA 59.865 43.478 0.00 0.00 0.00 2.87
1861 1873 3.745458 GCTCTTTCAGTTCAGTGGAGAAG 59.255 47.826 0.00 0.00 0.00 2.85
1862 1874 4.502259 GCTCTTTCAGTTCAGTGGAGAAGA 60.502 45.833 0.00 0.00 0.00 2.87
1863 1875 5.792741 CTCTTTCAGTTCAGTGGAGAAGAT 58.207 41.667 0.00 0.00 0.00 2.40
1864 1876 5.545588 TCTTTCAGTTCAGTGGAGAAGATG 58.454 41.667 0.00 0.00 0.00 2.90
1865 1877 3.969287 TCAGTTCAGTGGAGAAGATGG 57.031 47.619 0.00 0.00 0.00 3.51
1866 1878 3.242867 TCAGTTCAGTGGAGAAGATGGT 58.757 45.455 0.00 0.00 0.00 3.55
1867 1879 3.648067 TCAGTTCAGTGGAGAAGATGGTT 59.352 43.478 0.00 0.00 0.00 3.67
1868 1880 4.838423 TCAGTTCAGTGGAGAAGATGGTTA 59.162 41.667 0.00 0.00 0.00 2.85
1869 1881 4.932200 CAGTTCAGTGGAGAAGATGGTTAC 59.068 45.833 0.00 0.00 0.00 2.50
1870 1882 4.593206 AGTTCAGTGGAGAAGATGGTTACA 59.407 41.667 0.00 0.00 0.00 2.41
1871 1883 5.071788 AGTTCAGTGGAGAAGATGGTTACAA 59.928 40.000 0.00 0.00 0.00 2.41
1872 1884 4.894784 TCAGTGGAGAAGATGGTTACAAC 58.105 43.478 0.00 0.00 0.00 3.32
1873 1885 4.346709 TCAGTGGAGAAGATGGTTACAACA 59.653 41.667 0.00 0.00 0.00 3.33
1874 1886 5.063204 CAGTGGAGAAGATGGTTACAACAA 58.937 41.667 0.00 0.00 0.00 2.83
1875 1887 5.180117 CAGTGGAGAAGATGGTTACAACAAG 59.820 44.000 0.00 0.00 0.00 3.16
1876 1888 5.071788 AGTGGAGAAGATGGTTACAACAAGA 59.928 40.000 0.00 0.00 0.00 3.02
1877 1889 5.940470 GTGGAGAAGATGGTTACAACAAGAT 59.060 40.000 0.00 0.00 0.00 2.40
1878 1890 5.939883 TGGAGAAGATGGTTACAACAAGATG 59.060 40.000 0.00 0.00 0.00 2.90
1879 1891 5.355350 GGAGAAGATGGTTACAACAAGATGG 59.645 44.000 0.00 0.00 0.00 3.51
1880 1892 6.126863 AGAAGATGGTTACAACAAGATGGA 57.873 37.500 0.00 0.00 0.00 3.41
1881 1893 5.940470 AGAAGATGGTTACAACAAGATGGAC 59.060 40.000 0.00 0.00 0.00 4.02
1882 1894 4.253685 AGATGGTTACAACAAGATGGACG 58.746 43.478 0.00 0.00 0.00 4.79
1883 1895 3.478857 TGGTTACAACAAGATGGACGT 57.521 42.857 0.00 0.00 0.00 4.34
1884 1896 3.395639 TGGTTACAACAAGATGGACGTC 58.604 45.455 7.13 7.13 0.00 4.34
1885 1897 2.410730 GGTTACAACAAGATGGACGTCG 59.589 50.000 9.92 0.00 0.00 5.12
1886 1898 3.054878 GTTACAACAAGATGGACGTCGT 58.945 45.455 9.92 0.00 0.00 4.34
1887 1899 2.234300 ACAACAAGATGGACGTCGTT 57.766 45.000 9.92 3.93 0.00 3.85
1888 1900 1.864711 ACAACAAGATGGACGTCGTTG 59.135 47.619 22.15 22.15 39.61 4.10
1889 1901 1.864711 CAACAAGATGGACGTCGTTGT 59.135 47.619 18.05 16.41 32.75 3.32
1890 1902 1.779569 ACAAGATGGACGTCGTTGTC 58.220 50.000 9.92 4.85 38.17 3.18
1891 1903 1.067974 ACAAGATGGACGTCGTTGTCA 59.932 47.619 9.92 1.29 40.72 3.58
1892 1904 1.455786 CAAGATGGACGTCGTTGTCAC 59.544 52.381 9.92 0.00 40.72 3.67
1893 1905 0.959553 AGATGGACGTCGTTGTCACT 59.040 50.000 9.92 0.00 40.72 3.41
1894 1906 1.340248 AGATGGACGTCGTTGTCACTT 59.660 47.619 9.92 0.00 40.72 3.16
1895 1907 2.555325 AGATGGACGTCGTTGTCACTTA 59.445 45.455 9.92 0.00 40.72 2.24
1896 1908 3.192844 AGATGGACGTCGTTGTCACTTAT 59.807 43.478 9.92 0.00 40.72 1.73
1897 1909 2.668250 TGGACGTCGTTGTCACTTATG 58.332 47.619 9.92 0.00 40.72 1.90
1898 1910 2.034939 TGGACGTCGTTGTCACTTATGT 59.965 45.455 9.92 0.00 40.72 2.29
1899 1911 3.054878 GGACGTCGTTGTCACTTATGTT 58.945 45.455 9.92 0.00 40.72 2.71
1900 1912 3.492011 GGACGTCGTTGTCACTTATGTTT 59.508 43.478 9.92 0.00 40.72 2.83
1901 1913 4.375706 GGACGTCGTTGTCACTTATGTTTC 60.376 45.833 9.92 0.00 40.72 2.78
1902 1914 4.114073 ACGTCGTTGTCACTTATGTTTCA 58.886 39.130 0.00 0.00 0.00 2.69
1903 1915 4.748102 ACGTCGTTGTCACTTATGTTTCAT 59.252 37.500 0.00 0.00 0.00 2.57
1904 1916 5.235616 ACGTCGTTGTCACTTATGTTTCATT 59.764 36.000 0.00 0.00 0.00 2.57
1905 1917 6.133392 CGTCGTTGTCACTTATGTTTCATTT 58.867 36.000 0.00 0.00 0.00 2.32
1906 1918 6.631238 CGTCGTTGTCACTTATGTTTCATTTT 59.369 34.615 0.00 0.00 0.00 1.82
1907 1919 7.356396 CGTCGTTGTCACTTATGTTTCATTTTG 60.356 37.037 0.00 0.00 0.00 2.44
1908 1920 7.431084 GTCGTTGTCACTTATGTTTCATTTTGT 59.569 33.333 0.00 0.00 0.00 2.83
1909 1921 7.430793 TCGTTGTCACTTATGTTTCATTTTGTG 59.569 33.333 0.00 0.00 0.00 3.33
1910 1922 7.305935 CGTTGTCACTTATGTTTCATTTTGTGG 60.306 37.037 0.00 0.00 0.00 4.17
1911 1923 7.106439 TGTCACTTATGTTTCATTTTGTGGT 57.894 32.000 0.00 0.00 0.00 4.16
1912 1924 6.977502 TGTCACTTATGTTTCATTTTGTGGTG 59.022 34.615 0.00 0.00 0.00 4.17
1913 1925 5.982516 TCACTTATGTTTCATTTTGTGGTGC 59.017 36.000 0.00 0.00 0.00 5.01
1914 1926 5.177327 CACTTATGTTTCATTTTGTGGTGCC 59.823 40.000 0.00 0.00 0.00 5.01
1915 1927 5.070313 ACTTATGTTTCATTTTGTGGTGCCT 59.930 36.000 0.00 0.00 0.00 4.75
1916 1928 3.902881 TGTTTCATTTTGTGGTGCCTT 57.097 38.095 0.00 0.00 0.00 4.35
1917 1929 3.791245 TGTTTCATTTTGTGGTGCCTTC 58.209 40.909 0.00 0.00 0.00 3.46
1918 1930 3.196469 TGTTTCATTTTGTGGTGCCTTCA 59.804 39.130 0.00 0.00 0.00 3.02
1919 1931 4.141756 TGTTTCATTTTGTGGTGCCTTCAT 60.142 37.500 0.00 0.00 0.00 2.57
1920 1932 4.686191 TTCATTTTGTGGTGCCTTCATT 57.314 36.364 0.00 0.00 0.00 2.57
1921 1933 4.255833 TCATTTTGTGGTGCCTTCATTC 57.744 40.909 0.00 0.00 0.00 2.67
1922 1934 3.896888 TCATTTTGTGGTGCCTTCATTCT 59.103 39.130 0.00 0.00 0.00 2.40
1923 1935 3.731652 TTTTGTGGTGCCTTCATTCTG 57.268 42.857 0.00 0.00 0.00 3.02
1924 1936 1.619654 TTGTGGTGCCTTCATTCTGG 58.380 50.000 0.00 0.00 0.00 3.86
1925 1937 0.770499 TGTGGTGCCTTCATTCTGGA 59.230 50.000 0.00 0.00 0.00 3.86
1926 1938 1.271543 TGTGGTGCCTTCATTCTGGAG 60.272 52.381 0.00 0.00 0.00 3.86
1927 1939 0.322816 TGGTGCCTTCATTCTGGAGC 60.323 55.000 0.00 0.00 0.00 4.70
1928 1940 0.034670 GGTGCCTTCATTCTGGAGCT 60.035 55.000 0.00 0.00 0.00 4.09
1929 1941 1.210478 GGTGCCTTCATTCTGGAGCTA 59.790 52.381 0.00 0.00 0.00 3.32
1930 1942 2.158696 GGTGCCTTCATTCTGGAGCTAT 60.159 50.000 0.00 0.00 0.00 2.97
1931 1943 3.137533 GTGCCTTCATTCTGGAGCTATC 58.862 50.000 0.00 0.00 0.00 2.08
1932 1944 2.224137 TGCCTTCATTCTGGAGCTATCG 60.224 50.000 0.00 0.00 0.00 2.92
1933 1945 2.224161 GCCTTCATTCTGGAGCTATCGT 60.224 50.000 0.00 0.00 0.00 3.73
1934 1946 3.648009 CCTTCATTCTGGAGCTATCGTC 58.352 50.000 0.00 0.00 0.00 4.20
1935 1947 3.304257 CTTCATTCTGGAGCTATCGTCG 58.696 50.000 0.00 0.00 0.00 5.12
1936 1948 1.001268 TCATTCTGGAGCTATCGTCGC 60.001 52.381 0.00 0.00 0.00 5.19
1937 1949 1.000827 CATTCTGGAGCTATCGTCGCT 60.001 52.381 0.00 0.00 41.15 4.93
1938 1950 1.963172 TTCTGGAGCTATCGTCGCTA 58.037 50.000 0.00 0.00 37.96 4.26
1939 1951 1.227639 TCTGGAGCTATCGTCGCTAC 58.772 55.000 0.00 0.00 37.96 3.58
1940 1952 1.202663 TCTGGAGCTATCGTCGCTACT 60.203 52.381 7.01 0.00 39.14 2.57
1941 1953 1.195900 CTGGAGCTATCGTCGCTACTC 59.804 57.143 7.01 0.00 39.14 2.59
1942 1954 0.164217 GGAGCTATCGTCGCTACTCG 59.836 60.000 0.00 0.00 37.96 4.18
1943 1955 0.164217 GAGCTATCGTCGCTACTCGG 59.836 60.000 0.00 0.00 37.96 4.63
1944 1956 0.249784 AGCTATCGTCGCTACTCGGA 60.250 55.000 0.00 0.00 39.05 4.55
1945 1957 0.164217 GCTATCGTCGCTACTCGGAG 59.836 60.000 2.83 2.83 39.05 4.63
1946 1958 0.164217 CTATCGTCGCTACTCGGAGC 59.836 60.000 4.58 0.00 39.05 4.70
1947 1959 0.249784 TATCGTCGCTACTCGGAGCT 60.250 55.000 4.58 0.00 40.51 4.09
1948 1960 0.249784 ATCGTCGCTACTCGGAGCTA 60.250 55.000 4.58 0.00 40.51 3.32
1949 1961 0.249784 TCGTCGCTACTCGGAGCTAT 60.250 55.000 4.58 0.00 40.51 2.97
1950 1962 0.110599 CGTCGCTACTCGGAGCTATG 60.111 60.000 4.58 0.00 40.51 2.23
1951 1963 0.238817 GTCGCTACTCGGAGCTATGG 59.761 60.000 4.58 0.00 40.51 2.74
1952 1964 0.889638 TCGCTACTCGGAGCTATGGG 60.890 60.000 4.58 1.93 40.51 4.00
1953 1965 0.889638 CGCTACTCGGAGCTATGGGA 60.890 60.000 4.58 0.00 40.51 4.37
1954 1966 1.551452 GCTACTCGGAGCTATGGGAT 58.449 55.000 4.58 0.00 39.50 3.85
1955 1967 1.474879 GCTACTCGGAGCTATGGGATC 59.525 57.143 4.58 0.00 39.50 3.36
1956 1968 2.796557 CTACTCGGAGCTATGGGATCA 58.203 52.381 4.58 0.00 30.93 2.92
1957 1969 2.088104 ACTCGGAGCTATGGGATCAA 57.912 50.000 4.58 0.00 30.93 2.57
1958 1970 1.967066 ACTCGGAGCTATGGGATCAAG 59.033 52.381 4.58 0.00 30.93 3.02
1959 1971 0.681733 TCGGAGCTATGGGATCAAGC 59.318 55.000 0.00 0.00 36.48 4.01
1961 1973 1.607509 CGGAGCTATGGGATCAAGCTG 60.608 57.143 13.71 0.61 46.29 4.24
1962 1974 1.271271 GGAGCTATGGGATCAAGCTGG 60.271 57.143 13.71 0.00 46.29 4.85
1963 1975 1.696336 GAGCTATGGGATCAAGCTGGA 59.304 52.381 13.71 0.00 46.29 3.86
1964 1976 1.419387 AGCTATGGGATCAAGCTGGAC 59.581 52.381 0.00 0.00 44.67 4.02
1965 1977 1.141657 GCTATGGGATCAAGCTGGACA 59.858 52.381 0.00 0.00 33.40 4.02
1966 1978 2.421952 GCTATGGGATCAAGCTGGACAA 60.422 50.000 0.00 0.00 33.40 3.18
1967 1979 2.431954 ATGGGATCAAGCTGGACAAG 57.568 50.000 0.00 0.00 0.00 3.16
1968 1980 0.329261 TGGGATCAAGCTGGACAAGG 59.671 55.000 0.00 0.00 0.00 3.61
1969 1981 0.394899 GGGATCAAGCTGGACAAGGG 60.395 60.000 0.00 0.00 0.00 3.95
1970 1982 1.034292 GGATCAAGCTGGACAAGGGC 61.034 60.000 0.00 0.00 0.00 5.19
1971 1983 0.322816 GATCAAGCTGGACAAGGGCA 60.323 55.000 0.00 0.00 0.00 5.36
1972 1984 0.112995 ATCAAGCTGGACAAGGGCAA 59.887 50.000 0.00 0.00 0.00 4.52
1973 1985 0.538057 TCAAGCTGGACAAGGGCAAG 60.538 55.000 0.00 0.00 0.00 4.01
1974 1986 1.228675 AAGCTGGACAAGGGCAAGG 60.229 57.895 0.00 0.00 0.00 3.61
1975 1987 2.677875 GCTGGACAAGGGCAAGGG 60.678 66.667 0.00 0.00 0.00 3.95
1976 1988 2.677875 CTGGACAAGGGCAAGGGC 60.678 66.667 0.00 0.00 40.13 5.19
1977 1989 3.506743 TGGACAAGGGCAAGGGCA 61.507 61.111 0.00 0.00 43.71 5.36
1978 1990 2.677875 GGACAAGGGCAAGGGCAG 60.678 66.667 0.00 0.00 43.71 4.85
1979 1991 2.677875 GACAAGGGCAAGGGCAGG 60.678 66.667 0.00 0.00 43.71 4.85
1987 1999 2.597217 CAAGGGCAGGCCAACGAA 60.597 61.111 16.94 0.00 37.98 3.85
1988 2000 2.597510 AAGGGCAGGCCAACGAAC 60.598 61.111 16.94 0.00 37.98 3.95
1989 2001 4.660938 AGGGCAGGCCAACGAACC 62.661 66.667 16.94 0.00 37.98 3.62
1990 2002 4.660938 GGGCAGGCCAACGAACCT 62.661 66.667 13.10 0.00 37.98 3.50
1997 2009 4.800554 CCAACGAACCTGGCTTCT 57.199 55.556 0.00 0.00 0.00 2.85
1998 2010 3.021451 CCAACGAACCTGGCTTCTT 57.979 52.632 0.00 0.00 0.00 2.52
1999 2011 1.318576 CCAACGAACCTGGCTTCTTT 58.681 50.000 0.00 0.00 0.00 2.52
2000 2012 1.001378 CCAACGAACCTGGCTTCTTTG 60.001 52.381 15.06 15.06 32.05 2.77
2001 2013 1.676006 CAACGAACCTGGCTTCTTTGT 59.324 47.619 14.36 2.49 29.21 2.83
2002 2014 1.594331 ACGAACCTGGCTTCTTTGTC 58.406 50.000 0.00 0.00 0.00 3.18
2003 2015 1.141053 ACGAACCTGGCTTCTTTGTCT 59.859 47.619 0.00 0.00 0.00 3.41
2004 2016 1.801178 CGAACCTGGCTTCTTTGTCTC 59.199 52.381 0.00 0.00 0.00 3.36
2005 2017 2.155279 GAACCTGGCTTCTTTGTCTCC 58.845 52.381 0.00 0.00 0.00 3.71
2006 2018 1.140312 ACCTGGCTTCTTTGTCTCCA 58.860 50.000 0.00 0.00 0.00 3.86
2007 2019 1.202818 ACCTGGCTTCTTTGTCTCCAC 60.203 52.381 0.00 0.00 0.00 4.02
2008 2020 1.528129 CTGGCTTCTTTGTCTCCACC 58.472 55.000 0.00 0.00 0.00 4.61
2009 2021 0.250295 TGGCTTCTTTGTCTCCACCG 60.250 55.000 0.00 0.00 0.00 4.94
2010 2022 0.955919 GGCTTCTTTGTCTCCACCGG 60.956 60.000 0.00 0.00 0.00 5.28
2011 2023 0.250338 GCTTCTTTGTCTCCACCGGT 60.250 55.000 0.00 0.00 0.00 5.28
2012 2024 1.512926 CTTCTTTGTCTCCACCGGTG 58.487 55.000 28.26 28.26 0.00 4.94
2013 2025 0.834612 TTCTTTGTCTCCACCGGTGT 59.165 50.000 31.80 0.00 0.00 4.16
2014 2026 0.105964 TCTTTGTCTCCACCGGTGTG 59.894 55.000 31.80 23.28 42.39 3.82
2015 2027 0.179056 CTTTGTCTCCACCGGTGTGT 60.179 55.000 31.80 0.00 41.09 3.72
2016 2028 0.179067 TTTGTCTCCACCGGTGTGTC 60.179 55.000 31.80 20.80 41.09 3.67
2017 2029 1.331399 TTGTCTCCACCGGTGTGTCA 61.331 55.000 31.80 22.85 41.09 3.58
2018 2030 1.331399 TGTCTCCACCGGTGTGTCAA 61.331 55.000 31.80 12.70 41.09 3.18
2019 2031 0.034896 GTCTCCACCGGTGTGTCAAT 59.965 55.000 31.80 0.00 41.09 2.57
2020 2032 0.762418 TCTCCACCGGTGTGTCAATT 59.238 50.000 31.80 0.00 41.09 2.32
2021 2033 1.972075 TCTCCACCGGTGTGTCAATTA 59.028 47.619 31.80 6.67 41.09 1.40
2022 2034 2.569853 TCTCCACCGGTGTGTCAATTAT 59.430 45.455 31.80 0.00 41.09 1.28
2023 2035 3.770388 TCTCCACCGGTGTGTCAATTATA 59.230 43.478 31.80 4.44 41.09 0.98
2024 2036 4.407621 TCTCCACCGGTGTGTCAATTATAT 59.592 41.667 31.80 0.00 41.09 0.86
2025 2037 4.699637 TCCACCGGTGTGTCAATTATATC 58.300 43.478 31.80 0.00 41.09 1.63
2026 2038 4.162509 TCCACCGGTGTGTCAATTATATCA 59.837 41.667 31.80 1.78 41.09 2.15
2027 2039 4.878971 CCACCGGTGTGTCAATTATATCAA 59.121 41.667 31.80 0.00 41.09 2.57
2028 2040 5.007626 CCACCGGTGTGTCAATTATATCAAG 59.992 44.000 31.80 7.45 41.09 3.02
2029 2041 5.584649 CACCGGTGTGTCAATTATATCAAGT 59.415 40.000 26.95 0.00 37.72 3.16
2030 2042 6.093495 CACCGGTGTGTCAATTATATCAAGTT 59.907 38.462 26.95 0.00 37.72 2.66
2031 2043 7.279090 CACCGGTGTGTCAATTATATCAAGTTA 59.721 37.037 26.95 0.00 37.72 2.24
2032 2044 7.494625 ACCGGTGTGTCAATTATATCAAGTTAG 59.505 37.037 6.12 0.00 0.00 2.34
2033 2045 7.042051 CCGGTGTGTCAATTATATCAAGTTAGG 60.042 40.741 0.00 0.00 0.00 2.69
2034 2046 7.042051 CGGTGTGTCAATTATATCAAGTTAGGG 60.042 40.741 0.00 0.00 0.00 3.53
2035 2047 7.990886 GGTGTGTCAATTATATCAAGTTAGGGA 59.009 37.037 0.00 0.00 0.00 4.20
2036 2048 9.391006 GTGTGTCAATTATATCAAGTTAGGGAA 57.609 33.333 0.00 0.00 0.00 3.97
2037 2049 9.391006 TGTGTCAATTATATCAAGTTAGGGAAC 57.609 33.333 0.00 0.00 35.64 3.62
2055 2067 3.359002 CACAAGAGGTGGCCAAGC 58.641 61.111 7.24 0.78 44.04 4.01
2056 2068 1.529010 CACAAGAGGTGGCCAAGCA 60.529 57.895 7.24 0.00 44.04 3.91
2057 2069 1.529244 ACAAGAGGTGGCCAAGCAC 60.529 57.895 7.24 0.00 0.00 4.40
2058 2070 2.116125 AAGAGGTGGCCAAGCACC 59.884 61.111 7.24 3.96 41.59 5.01
2059 2071 2.766925 AAGAGGTGGCCAAGCACCA 61.767 57.895 7.24 0.00 43.61 4.17
2060 2072 2.036256 GAGGTGGCCAAGCACCAT 59.964 61.111 7.24 0.00 43.61 3.55
2061 2073 1.607467 GAGGTGGCCAAGCACCATT 60.607 57.895 7.24 0.00 43.61 3.16
2062 2074 1.880819 GAGGTGGCCAAGCACCATTG 61.881 60.000 7.24 0.00 43.61 2.82
2067 2079 2.975536 CCAAGCACCATTGGGCAG 59.024 61.111 15.64 9.15 45.07 4.85
2068 2080 1.909781 CCAAGCACCATTGGGCAGT 60.910 57.895 15.64 3.72 45.07 4.40
2069 2081 0.611618 CCAAGCACCATTGGGCAGTA 60.612 55.000 15.64 0.00 45.07 2.74
2070 2082 1.477553 CAAGCACCATTGGGCAGTAT 58.522 50.000 15.64 0.65 37.90 2.12
2071 2083 2.653726 CAAGCACCATTGGGCAGTATA 58.346 47.619 15.64 0.00 37.90 1.47
2072 2084 3.023119 CAAGCACCATTGGGCAGTATAA 58.977 45.455 15.64 0.00 37.90 0.98
2073 2085 2.654863 AGCACCATTGGGCAGTATAAC 58.345 47.619 15.64 0.00 37.90 1.89
2074 2086 2.242196 AGCACCATTGGGCAGTATAACT 59.758 45.455 15.64 0.00 37.90 2.24
2075 2087 3.023832 GCACCATTGGGCAGTATAACTT 58.976 45.455 7.78 0.00 37.90 2.66
2076 2088 3.181487 GCACCATTGGGCAGTATAACTTG 60.181 47.826 7.78 0.00 37.90 3.16
2077 2089 3.023832 ACCATTGGGCAGTATAACTTGC 58.976 45.455 7.78 0.00 37.90 4.01
2078 2090 3.290710 CCATTGGGCAGTATAACTTGCT 58.709 45.455 0.00 0.00 0.00 3.91
2079 2091 3.067180 CCATTGGGCAGTATAACTTGCTG 59.933 47.826 0.00 0.00 40.70 4.41
2087 2099 4.962693 CAGTATAACTTGCTGCACTTGTC 58.037 43.478 0.00 0.00 31.00 3.18
2088 2100 4.003648 AGTATAACTTGCTGCACTTGTCC 58.996 43.478 0.00 0.00 0.00 4.02
2089 2101 2.340210 TAACTTGCTGCACTTGTCCA 57.660 45.000 0.00 0.00 0.00 4.02
2090 2102 0.740737 AACTTGCTGCACTTGTCCAC 59.259 50.000 0.00 0.00 0.00 4.02
2091 2103 0.107017 ACTTGCTGCACTTGTCCACT 60.107 50.000 0.00 0.00 0.00 4.00
2092 2104 0.590195 CTTGCTGCACTTGTCCACTC 59.410 55.000 0.00 0.00 0.00 3.51
2093 2105 1.159713 TTGCTGCACTTGTCCACTCG 61.160 55.000 0.00 0.00 0.00 4.18
2094 2106 1.595382 GCTGCACTTGTCCACTCGT 60.595 57.895 0.00 0.00 0.00 4.18
2095 2107 1.835483 GCTGCACTTGTCCACTCGTG 61.835 60.000 0.00 0.00 0.00 4.35
2096 2108 0.249447 CTGCACTTGTCCACTCGTGA 60.249 55.000 0.00 0.00 0.00 4.35
2097 2109 0.392706 TGCACTTGTCCACTCGTGAT 59.607 50.000 0.00 0.00 0.00 3.06
2098 2110 1.616374 TGCACTTGTCCACTCGTGATA 59.384 47.619 0.00 0.00 0.00 2.15
2099 2111 1.993370 GCACTTGTCCACTCGTGATAC 59.007 52.381 0.00 0.00 0.00 2.24
2100 2112 2.352814 GCACTTGTCCACTCGTGATACT 60.353 50.000 0.00 0.00 0.00 2.12
2101 2113 3.119602 GCACTTGTCCACTCGTGATACTA 60.120 47.826 0.00 0.00 0.00 1.82
2102 2114 4.617530 GCACTTGTCCACTCGTGATACTAA 60.618 45.833 0.00 0.00 0.00 2.24
2103 2115 5.651530 CACTTGTCCACTCGTGATACTAAT 58.348 41.667 0.00 0.00 0.00 1.73
2104 2116 5.516696 CACTTGTCCACTCGTGATACTAATG 59.483 44.000 0.00 0.00 0.00 1.90
2105 2117 5.417894 ACTTGTCCACTCGTGATACTAATGA 59.582 40.000 0.00 0.00 0.00 2.57
2106 2118 5.500645 TGTCCACTCGTGATACTAATGAG 57.499 43.478 0.00 0.00 36.84 2.90
2107 2119 4.202020 TGTCCACTCGTGATACTAATGAGC 60.202 45.833 0.00 0.00 34.59 4.26
2108 2120 4.036971 GTCCACTCGTGATACTAATGAGCT 59.963 45.833 0.00 0.00 34.59 4.09
2109 2121 4.645136 TCCACTCGTGATACTAATGAGCTT 59.355 41.667 0.00 0.00 34.59 3.74
2110 2122 4.742167 CCACTCGTGATACTAATGAGCTTG 59.258 45.833 0.00 0.00 34.59 4.01
2111 2123 4.742167 CACTCGTGATACTAATGAGCTTGG 59.258 45.833 0.00 0.00 34.59 3.61
2112 2124 3.717707 TCGTGATACTAATGAGCTTGGC 58.282 45.455 0.00 0.00 0.00 4.52
2113 2125 3.132111 TCGTGATACTAATGAGCTTGGCA 59.868 43.478 0.00 0.00 0.00 4.92
2114 2126 3.492383 CGTGATACTAATGAGCTTGGCAG 59.508 47.826 0.00 0.00 0.00 4.85
2134 2146 2.539346 CGGAGCAGCAAAGAAGATTG 57.461 50.000 0.00 0.00 0.00 2.67
2135 2147 1.131883 CGGAGCAGCAAAGAAGATTGG 59.868 52.381 0.00 0.00 0.00 3.16
2136 2148 2.440409 GGAGCAGCAAAGAAGATTGGA 58.560 47.619 0.00 0.00 0.00 3.53
2137 2149 2.163211 GGAGCAGCAAAGAAGATTGGAC 59.837 50.000 0.00 0.00 0.00 4.02
2138 2150 3.080319 GAGCAGCAAAGAAGATTGGACT 58.920 45.455 0.00 0.00 0.00 3.85
2139 2151 3.080319 AGCAGCAAAGAAGATTGGACTC 58.920 45.455 0.00 0.00 0.00 3.36
2140 2152 2.159599 GCAGCAAAGAAGATTGGACTCG 60.160 50.000 0.00 0.00 0.00 4.18
2141 2153 3.329386 CAGCAAAGAAGATTGGACTCGA 58.671 45.455 0.00 0.00 0.00 4.04
2142 2154 3.370366 CAGCAAAGAAGATTGGACTCGAG 59.630 47.826 11.84 11.84 0.00 4.04
2143 2155 2.675348 GCAAAGAAGATTGGACTCGAGG 59.325 50.000 18.41 0.00 0.00 4.63
2144 2156 3.617531 GCAAAGAAGATTGGACTCGAGGA 60.618 47.826 18.41 0.00 0.00 3.71
2145 2157 3.878160 AAGAAGATTGGACTCGAGGAC 57.122 47.619 18.41 9.53 0.00 3.85
2146 2158 3.094484 AGAAGATTGGACTCGAGGACT 57.906 47.619 18.41 0.00 0.00 3.85
2147 2159 2.757868 AGAAGATTGGACTCGAGGACTG 59.242 50.000 18.41 0.00 0.00 3.51
2148 2160 1.479709 AGATTGGACTCGAGGACTGG 58.520 55.000 18.41 0.00 0.00 4.00
2149 2161 1.187087 GATTGGACTCGAGGACTGGT 58.813 55.000 18.41 0.00 0.00 4.00
2150 2162 0.898320 ATTGGACTCGAGGACTGGTG 59.102 55.000 18.41 0.00 0.00 4.17
2151 2163 1.185618 TTGGACTCGAGGACTGGTGG 61.186 60.000 18.41 0.00 0.00 4.61
2152 2164 1.304217 GGACTCGAGGACTGGTGGA 60.304 63.158 18.41 0.00 0.00 4.02
2153 2165 0.898789 GGACTCGAGGACTGGTGGAA 60.899 60.000 18.41 0.00 0.00 3.53
2154 2166 0.244178 GACTCGAGGACTGGTGGAAC 59.756 60.000 18.41 0.00 0.00 3.62
2155 2167 0.469331 ACTCGAGGACTGGTGGAACA 60.469 55.000 18.41 0.00 39.98 3.18
2156 2168 0.679505 CTCGAGGACTGGTGGAACAA 59.320 55.000 3.91 0.00 44.16 2.83
2157 2169 1.070134 CTCGAGGACTGGTGGAACAAA 59.930 52.381 3.91 0.00 44.16 2.83
2158 2170 1.202604 TCGAGGACTGGTGGAACAAAC 60.203 52.381 0.00 0.00 44.16 2.93
2159 2171 1.474320 CGAGGACTGGTGGAACAAACA 60.474 52.381 0.00 0.00 44.16 2.83
2160 2172 2.222027 GAGGACTGGTGGAACAAACAG 58.778 52.381 0.00 0.00 46.58 3.16
2161 2173 0.668535 GGACTGGTGGAACAAACAGC 59.331 55.000 0.00 0.00 45.57 4.40
2162 2174 1.388547 GACTGGTGGAACAAACAGCA 58.611 50.000 0.00 0.00 45.57 4.41
2163 2175 1.065551 GACTGGTGGAACAAACAGCAC 59.934 52.381 0.00 0.00 45.57 4.40
2164 2176 1.102154 CTGGTGGAACAAACAGCACA 58.898 50.000 0.00 0.00 44.16 4.57
2165 2177 1.476085 CTGGTGGAACAAACAGCACAA 59.524 47.619 0.00 0.00 44.16 3.33
2166 2178 1.203523 TGGTGGAACAAACAGCACAAC 59.796 47.619 0.00 0.00 44.16 3.32
2167 2179 1.203523 GGTGGAACAAACAGCACAACA 59.796 47.619 0.00 0.00 44.16 3.33
2168 2180 2.258755 GTGGAACAAACAGCACAACAC 58.741 47.619 0.00 0.00 44.16 3.32
2169 2181 1.889170 TGGAACAAACAGCACAACACA 59.111 42.857 0.00 0.00 31.92 3.72
2170 2182 2.094803 TGGAACAAACAGCACAACACAG 60.095 45.455 0.00 0.00 31.92 3.66
2171 2183 2.529151 GAACAAACAGCACAACACAGG 58.471 47.619 0.00 0.00 0.00 4.00
2172 2184 0.817013 ACAAACAGCACAACACAGGG 59.183 50.000 0.00 0.00 0.00 4.45
2173 2185 1.102154 CAAACAGCACAACACAGGGA 58.898 50.000 0.00 0.00 0.00 4.20
2174 2186 1.476085 CAAACAGCACAACACAGGGAA 59.524 47.619 0.00 0.00 0.00 3.97
2175 2187 1.846007 AACAGCACAACACAGGGAAA 58.154 45.000 0.00 0.00 0.00 3.13
2176 2188 1.102978 ACAGCACAACACAGGGAAAC 58.897 50.000 0.00 0.00 0.00 2.78
2177 2189 1.340991 ACAGCACAACACAGGGAAACT 60.341 47.619 0.00 0.00 0.00 2.66
2178 2190 1.750778 CAGCACAACACAGGGAAACTT 59.249 47.619 0.00 0.00 0.00 2.66
2179 2191 2.948979 CAGCACAACACAGGGAAACTTA 59.051 45.455 0.00 0.00 0.00 2.24
2180 2192 2.949644 AGCACAACACAGGGAAACTTAC 59.050 45.455 0.00 0.00 0.00 2.34
2181 2193 2.685897 GCACAACACAGGGAAACTTACA 59.314 45.455 0.00 0.00 0.00 2.41
2182 2194 3.129638 GCACAACACAGGGAAACTTACAA 59.870 43.478 0.00 0.00 0.00 2.41
2183 2195 4.733523 GCACAACACAGGGAAACTTACAAG 60.734 45.833 0.00 0.00 0.00 3.16
2184 2196 4.398044 CACAACACAGGGAAACTTACAAGT 59.602 41.667 0.00 0.00 42.04 3.16
2185 2197 5.587043 CACAACACAGGGAAACTTACAAGTA 59.413 40.000 0.00 0.00 38.57 2.24
2186 2198 5.587443 ACAACACAGGGAAACTTACAAGTAC 59.413 40.000 0.00 0.00 38.57 2.73
2187 2199 5.625568 ACACAGGGAAACTTACAAGTACT 57.374 39.130 0.00 0.00 38.57 2.73
2188 2200 5.365619 ACACAGGGAAACTTACAAGTACTG 58.634 41.667 0.00 5.14 38.57 2.74
2189 2201 4.213482 CACAGGGAAACTTACAAGTACTGC 59.787 45.833 0.00 3.11 38.57 4.40
2190 2202 3.432252 CAGGGAAACTTACAAGTACTGCG 59.568 47.826 0.00 0.00 38.57 5.18
2191 2203 2.740447 GGGAAACTTACAAGTACTGCGG 59.260 50.000 0.00 0.00 38.57 5.69
2192 2204 3.555586 GGGAAACTTACAAGTACTGCGGA 60.556 47.826 0.00 0.00 38.57 5.54
2193 2205 4.251268 GGAAACTTACAAGTACTGCGGAT 58.749 43.478 0.00 0.00 38.57 4.18
2194 2206 4.092968 GGAAACTTACAAGTACTGCGGATG 59.907 45.833 0.00 0.00 38.57 3.51
2195 2207 3.955650 ACTTACAAGTACTGCGGATGT 57.044 42.857 0.00 0.00 37.52 3.06
2196 2208 3.846360 ACTTACAAGTACTGCGGATGTC 58.154 45.455 0.00 0.00 37.52 3.06
2197 2209 3.257375 ACTTACAAGTACTGCGGATGTCA 59.743 43.478 0.00 0.00 37.52 3.58
2198 2210 2.831685 ACAAGTACTGCGGATGTCAA 57.168 45.000 0.00 0.00 0.00 3.18
2199 2211 2.413837 ACAAGTACTGCGGATGTCAAC 58.586 47.619 0.00 0.00 0.00 3.18
2200 2212 2.224185 ACAAGTACTGCGGATGTCAACA 60.224 45.455 0.00 0.00 0.00 3.33
2201 2213 2.805671 CAAGTACTGCGGATGTCAACAA 59.194 45.455 0.00 0.00 0.00 2.83
2202 2214 2.688507 AGTACTGCGGATGTCAACAAG 58.311 47.619 0.00 0.00 0.00 3.16
2203 2215 2.037251 AGTACTGCGGATGTCAACAAGT 59.963 45.455 0.00 0.00 0.00 3.16
2204 2216 1.967319 ACTGCGGATGTCAACAAGTT 58.033 45.000 0.00 0.00 0.00 2.66
2205 2217 1.603802 ACTGCGGATGTCAACAAGTTG 59.396 47.619 0.00 6.60 41.71 3.16
2206 2218 0.950836 TGCGGATGTCAACAAGTTGG 59.049 50.000 12.54 0.00 40.78 3.77
2207 2219 0.951558 GCGGATGTCAACAAGTTGGT 59.048 50.000 12.54 0.00 40.78 3.67
2208 2220 1.336755 GCGGATGTCAACAAGTTGGTT 59.663 47.619 12.54 0.00 40.78 3.67
2209 2221 2.223711 GCGGATGTCAACAAGTTGGTTT 60.224 45.455 12.54 0.00 40.78 3.27
2210 2222 3.736740 GCGGATGTCAACAAGTTGGTTTT 60.737 43.478 12.54 0.00 40.78 2.43
2211 2223 4.041723 CGGATGTCAACAAGTTGGTTTTC 58.958 43.478 12.54 5.63 40.78 2.29
2212 2224 4.439426 CGGATGTCAACAAGTTGGTTTTCA 60.439 41.667 12.54 0.05 40.78 2.69
2213 2225 5.415221 GGATGTCAACAAGTTGGTTTTCAA 58.585 37.500 12.54 0.00 40.78 2.69
2214 2226 5.519927 GGATGTCAACAAGTTGGTTTTCAAG 59.480 40.000 12.54 0.00 40.78 3.02
2215 2227 4.241681 TGTCAACAAGTTGGTTTTCAAGC 58.758 39.130 12.54 0.00 40.78 4.01
2216 2228 4.241681 GTCAACAAGTTGGTTTTCAAGCA 58.758 39.130 12.54 0.00 40.78 3.91
2217 2229 4.869861 GTCAACAAGTTGGTTTTCAAGCAT 59.130 37.500 12.54 0.00 40.78 3.79
2218 2230 6.039616 GTCAACAAGTTGGTTTTCAAGCATA 58.960 36.000 12.54 0.00 40.78 3.14
2219 2231 6.701400 GTCAACAAGTTGGTTTTCAAGCATAT 59.299 34.615 12.54 0.00 40.78 1.78
2220 2232 7.865385 GTCAACAAGTTGGTTTTCAAGCATATA 59.135 33.333 12.54 0.00 40.78 0.86
2221 2233 8.584157 TCAACAAGTTGGTTTTCAAGCATATAT 58.416 29.630 12.54 0.00 40.78 0.86
2222 2234 8.863049 CAACAAGTTGGTTTTCAAGCATATATC 58.137 33.333 7.96 0.00 38.87 1.63
2223 2235 8.121305 ACAAGTTGGTTTTCAAGCATATATCA 57.879 30.769 7.96 0.00 38.87 2.15
2224 2236 8.584157 ACAAGTTGGTTTTCAAGCATATATCAA 58.416 29.630 7.96 0.00 38.87 2.57
2225 2237 9.079833 CAAGTTGGTTTTCAAGCATATATCAAG 57.920 33.333 0.00 0.00 38.87 3.02
2226 2238 8.579850 AGTTGGTTTTCAAGCATATATCAAGA 57.420 30.769 0.00 0.00 38.87 3.02
2227 2239 9.023962 AGTTGGTTTTCAAGCATATATCAAGAA 57.976 29.630 0.00 0.00 38.87 2.52
2228 2240 9.076596 GTTGGTTTTCAAGCATATATCAAGAAC 57.923 33.333 0.00 0.00 38.87 3.01
2229 2241 8.347004 TGGTTTTCAAGCATATATCAAGAACA 57.653 30.769 0.00 0.00 33.29 3.18
2230 2242 8.970020 TGGTTTTCAAGCATATATCAAGAACAT 58.030 29.630 0.00 0.00 33.29 2.71
2231 2243 9.807649 GGTTTTCAAGCATATATCAAGAACATT 57.192 29.630 0.00 0.00 0.00 2.71
2233 2245 9.806203 TTTTCAAGCATATATCAAGAACATTGG 57.194 29.630 0.00 0.00 0.00 3.16
2234 2246 8.750515 TTCAAGCATATATCAAGAACATTGGA 57.249 30.769 0.00 0.00 0.00 3.53
2235 2247 8.387190 TCAAGCATATATCAAGAACATTGGAG 57.613 34.615 0.00 0.00 0.00 3.86
2236 2248 8.212995 TCAAGCATATATCAAGAACATTGGAGA 58.787 33.333 0.00 0.00 0.00 3.71
2237 2249 8.843262 CAAGCATATATCAAGAACATTGGAGAA 58.157 33.333 0.00 0.00 0.00 2.87
2238 2250 9.584008 AAGCATATATCAAGAACATTGGAGAAT 57.416 29.630 0.00 0.00 0.00 2.40
2239 2251 9.011095 AGCATATATCAAGAACATTGGAGAATG 57.989 33.333 0.00 0.00 44.11 2.67
2240 2252 9.006839 GCATATATCAAGAACATTGGAGAATGA 57.993 33.333 0.00 0.00 41.49 2.57
2244 2256 6.808008 TCAAGAACATTGGAGAATGAAGAC 57.192 37.500 0.00 0.00 41.49 3.01
2245 2257 6.537355 TCAAGAACATTGGAGAATGAAGACT 58.463 36.000 0.00 0.00 41.49 3.24
2246 2258 6.652481 TCAAGAACATTGGAGAATGAAGACTC 59.348 38.462 0.00 0.00 41.49 3.36
2253 2265 3.867857 GGAGAATGAAGACTCCTTGGAC 58.132 50.000 0.00 0.00 46.28 4.02
2254 2266 3.516615 GAGAATGAAGACTCCTTGGACG 58.483 50.000 0.00 0.00 31.62 4.79
2255 2267 2.900546 AGAATGAAGACTCCTTGGACGT 59.099 45.455 0.00 0.00 31.62 4.34
2256 2268 2.751166 ATGAAGACTCCTTGGACGTG 57.249 50.000 0.00 0.00 31.62 4.49
2257 2269 0.033504 TGAAGACTCCTTGGACGTGC 59.966 55.000 0.00 0.00 31.62 5.34
2258 2270 0.318762 GAAGACTCCTTGGACGTGCT 59.681 55.000 8.99 0.00 31.62 4.40
2259 2271 0.318762 AAGACTCCTTGGACGTGCTC 59.681 55.000 8.99 0.00 0.00 4.26
2260 2272 0.827925 AGACTCCTTGGACGTGCTCA 60.828 55.000 8.99 0.00 0.00 4.26
2261 2273 0.389166 GACTCCTTGGACGTGCTCAG 60.389 60.000 8.99 4.23 0.00 3.35
2262 2274 1.079543 CTCCTTGGACGTGCTCAGG 60.080 63.158 16.52 16.52 0.00 3.86
2263 2275 1.533033 TCCTTGGACGTGCTCAGGA 60.533 57.895 19.87 19.87 0.00 3.86
2264 2276 1.118965 TCCTTGGACGTGCTCAGGAA 61.119 55.000 20.98 9.03 0.00 3.36
2265 2277 0.250295 CCTTGGACGTGCTCAGGAAA 60.250 55.000 17.39 0.00 0.00 3.13
2266 2278 1.151668 CTTGGACGTGCTCAGGAAAG 58.848 55.000 8.99 0.00 0.00 2.62
2267 2279 0.756294 TTGGACGTGCTCAGGAAAGA 59.244 50.000 8.99 0.00 0.00 2.52
2268 2280 0.318441 TGGACGTGCTCAGGAAAGAG 59.682 55.000 8.99 0.00 38.68 2.85
2269 2281 0.603569 GGACGTGCTCAGGAAAGAGA 59.396 55.000 0.00 0.00 37.87 3.10
2270 2282 1.403514 GGACGTGCTCAGGAAAGAGAG 60.404 57.143 0.00 0.00 37.87 3.20
2271 2283 0.605589 ACGTGCTCAGGAAAGAGAGG 59.394 55.000 0.00 0.00 37.87 3.69
2272 2284 0.108424 CGTGCTCAGGAAAGAGAGGG 60.108 60.000 0.00 0.00 37.87 4.30
2273 2285 0.251634 GTGCTCAGGAAAGAGAGGGG 59.748 60.000 0.00 0.00 37.87 4.79
2274 2286 1.223211 GCTCAGGAAAGAGAGGGGC 59.777 63.158 0.00 0.00 37.87 5.80
2275 2287 1.911471 CTCAGGAAAGAGAGGGGCC 59.089 63.158 0.00 0.00 37.87 5.80
2276 2288 1.965754 CTCAGGAAAGAGAGGGGCCG 61.966 65.000 0.00 0.00 37.87 6.13
2277 2289 2.689034 AGGAAAGAGAGGGGCCGG 60.689 66.667 0.00 0.00 0.00 6.13
2278 2290 3.798511 GGAAAGAGAGGGGCCGGG 61.799 72.222 2.18 0.00 0.00 5.73
2279 2291 3.009714 GAAAGAGAGGGGCCGGGT 61.010 66.667 2.18 0.00 0.00 5.28
2280 2292 3.330720 AAAGAGAGGGGCCGGGTG 61.331 66.667 2.18 0.00 0.00 4.61
2281 2293 3.864983 AAAGAGAGGGGCCGGGTGA 62.865 63.158 2.18 0.00 0.00 4.02
2289 2301 4.436998 GGCCGGGTGACACTCGAG 62.437 72.222 29.03 18.88 46.98 4.04
2290 2302 3.371063 GCCGGGTGACACTCGAGA 61.371 66.667 29.03 0.00 46.98 4.04
2291 2303 2.878429 CCGGGTGACACTCGAGAG 59.122 66.667 29.03 14.72 46.98 3.20
2292 2304 1.674651 CCGGGTGACACTCGAGAGA 60.675 63.158 29.03 0.00 46.98 3.10
2293 2305 1.241990 CCGGGTGACACTCGAGAGAA 61.242 60.000 29.03 2.53 46.98 2.87
2294 2306 0.596577 CGGGTGACACTCGAGAGAAA 59.403 55.000 23.52 2.14 46.98 2.52
2295 2307 1.202582 CGGGTGACACTCGAGAGAAAT 59.797 52.381 23.52 0.00 46.98 2.17
2296 2308 2.611518 GGGTGACACTCGAGAGAAATG 58.388 52.381 21.68 9.05 41.32 2.32
2297 2309 2.611518 GGTGACACTCGAGAGAAATGG 58.388 52.381 21.68 1.83 41.32 3.16
2298 2310 2.231478 GGTGACACTCGAGAGAAATGGA 59.769 50.000 21.68 0.00 41.32 3.41
2299 2311 3.118956 GGTGACACTCGAGAGAAATGGAT 60.119 47.826 21.68 0.00 41.32 3.41
2300 2312 4.499183 GTGACACTCGAGAGAAATGGATT 58.501 43.478 21.68 0.00 41.32 3.01
2301 2313 4.328440 GTGACACTCGAGAGAAATGGATTG 59.672 45.833 21.68 5.06 41.32 2.67
2302 2314 4.021104 TGACACTCGAGAGAAATGGATTGT 60.021 41.667 21.68 8.63 41.32 2.71
2303 2315 5.185056 TGACACTCGAGAGAAATGGATTGTA 59.815 40.000 21.68 0.00 41.32 2.41
2304 2316 6.127338 TGACACTCGAGAGAAATGGATTGTAT 60.127 38.462 21.68 0.00 41.32 2.29
2305 2317 6.045318 ACACTCGAGAGAAATGGATTGTATG 58.955 40.000 21.68 3.11 41.32 2.39
2306 2318 6.127338 ACACTCGAGAGAAATGGATTGTATGA 60.127 38.462 21.68 0.00 41.32 2.15
2307 2319 6.927936 CACTCGAGAGAAATGGATTGTATGAT 59.072 38.462 21.68 0.00 41.32 2.45
2308 2320 6.927936 ACTCGAGAGAAATGGATTGTATGATG 59.072 38.462 21.68 0.00 41.32 3.07
2309 2321 7.054491 TCGAGAGAAATGGATTGTATGATGA 57.946 36.000 0.00 0.00 37.03 2.92
2310 2322 7.674120 TCGAGAGAAATGGATTGTATGATGAT 58.326 34.615 0.00 0.00 37.03 2.45
2311 2323 7.816513 TCGAGAGAAATGGATTGTATGATGATC 59.183 37.037 0.00 0.00 37.03 2.92
2312 2324 7.818446 CGAGAGAAATGGATTGTATGATGATCT 59.182 37.037 0.00 0.00 0.00 2.75
2313 2325 9.504708 GAGAGAAATGGATTGTATGATGATCTT 57.495 33.333 0.00 0.00 0.00 2.40
2314 2326 9.504708 AGAGAAATGGATTGTATGATGATCTTC 57.495 33.333 1.67 1.67 0.00 2.87
2315 2327 9.281371 GAGAAATGGATTGTATGATGATCTTCA 57.719 33.333 13.17 13.17 0.00 3.02
2316 2328 9.064706 AGAAATGGATTGTATGATGATCTTCAC 57.935 33.333 13.08 3.32 0.00 3.18
2317 2329 7.756395 AATGGATTGTATGATGATCTTCACC 57.244 36.000 13.08 9.42 0.00 4.02
2318 2330 5.299949 TGGATTGTATGATGATCTTCACCG 58.700 41.667 13.08 0.00 0.00 4.94
2319 2331 5.163311 TGGATTGTATGATGATCTTCACCGT 60.163 40.000 13.08 1.51 0.00 4.83
2320 2332 6.041523 TGGATTGTATGATGATCTTCACCGTA 59.958 38.462 13.08 0.60 0.00 4.02
2321 2333 6.366332 GGATTGTATGATGATCTTCACCGTAC 59.634 42.308 13.08 12.02 33.83 3.67
2322 2334 6.465439 TTGTATGATGATCTTCACCGTACT 57.535 37.500 13.08 0.16 34.25 2.73
2323 2335 7.576861 TTGTATGATGATCTTCACCGTACTA 57.423 36.000 13.08 7.04 34.25 1.82
2324 2336 7.761038 TGTATGATGATCTTCACCGTACTAT 57.239 36.000 13.08 0.00 34.25 2.12
2325 2337 7.817641 TGTATGATGATCTTCACCGTACTATC 58.182 38.462 13.08 0.00 34.25 2.08
2326 2338 5.358298 TGATGATCTTCACCGTACTATCG 57.642 43.478 7.19 0.00 0.00 2.92
2327 2339 5.061179 TGATGATCTTCACCGTACTATCGA 58.939 41.667 7.19 0.00 0.00 3.59
2328 2340 5.179555 TGATGATCTTCACCGTACTATCGAG 59.820 44.000 7.19 0.00 0.00 4.04
2329 2341 3.813724 TGATCTTCACCGTACTATCGAGG 59.186 47.826 0.00 0.00 0.00 4.63
2330 2342 2.569059 TCTTCACCGTACTATCGAGGG 58.431 52.381 0.00 0.00 0.00 4.30
2331 2343 2.171237 TCTTCACCGTACTATCGAGGGA 59.829 50.000 0.00 0.00 0.00 4.20
2332 2344 2.251409 TCACCGTACTATCGAGGGAG 57.749 55.000 0.00 0.00 0.00 4.30
2333 2345 1.764723 TCACCGTACTATCGAGGGAGA 59.235 52.381 0.00 0.00 0.00 3.71
2334 2346 2.171237 TCACCGTACTATCGAGGGAGAA 59.829 50.000 0.00 0.00 0.00 2.87
2335 2347 3.147629 CACCGTACTATCGAGGGAGAAT 58.852 50.000 0.00 0.00 0.00 2.40
2336 2348 3.568853 CACCGTACTATCGAGGGAGAATT 59.431 47.826 0.00 0.00 0.00 2.17
2337 2349 4.037684 CACCGTACTATCGAGGGAGAATTT 59.962 45.833 0.00 0.00 0.00 1.82
2338 2350 4.277921 ACCGTACTATCGAGGGAGAATTTC 59.722 45.833 0.00 0.00 0.00 2.17
2339 2351 4.277672 CCGTACTATCGAGGGAGAATTTCA 59.722 45.833 0.00 0.00 0.00 2.69
2340 2352 5.047943 CCGTACTATCGAGGGAGAATTTCAT 60.048 44.000 0.00 0.00 0.00 2.57
2341 2353 5.859114 CGTACTATCGAGGGAGAATTTCATG 59.141 44.000 0.00 0.00 0.00 3.07
2342 2354 5.220710 ACTATCGAGGGAGAATTTCATGG 57.779 43.478 0.00 0.00 0.00 3.66
2343 2355 3.498774 ATCGAGGGAGAATTTCATGGG 57.501 47.619 0.00 0.00 0.00 4.00
2344 2356 1.490490 TCGAGGGAGAATTTCATGGGG 59.510 52.381 0.00 0.00 0.00 4.96
2345 2357 1.477558 CGAGGGAGAATTTCATGGGGG 60.478 57.143 0.00 0.00 0.00 5.40
2346 2358 0.262876 AGGGAGAATTTCATGGGGGC 59.737 55.000 0.00 0.00 0.00 5.80
2347 2359 0.032217 GGGAGAATTTCATGGGGGCA 60.032 55.000 0.00 0.00 0.00 5.36
2348 2360 1.413517 GGGAGAATTTCATGGGGGCAT 60.414 52.381 0.00 0.00 0.00 4.40
2349 2361 2.401568 GGAGAATTTCATGGGGGCATT 58.598 47.619 0.00 0.00 0.00 3.56
2350 2362 3.575805 GGAGAATTTCATGGGGGCATTA 58.424 45.455 0.00 0.00 0.00 1.90
2351 2363 4.162651 GGAGAATTTCATGGGGGCATTAT 58.837 43.478 0.00 0.00 0.00 1.28
2352 2364 4.221482 GGAGAATTTCATGGGGGCATTATC 59.779 45.833 0.00 0.00 0.00 1.75
2353 2365 4.818447 AGAATTTCATGGGGGCATTATCA 58.182 39.130 0.00 0.00 0.00 2.15
2354 2366 4.590222 AGAATTTCATGGGGGCATTATCAC 59.410 41.667 0.00 0.00 0.00 3.06
2355 2367 2.380064 TTCATGGGGGCATTATCACC 57.620 50.000 0.00 0.00 0.00 4.02
2356 2368 1.533187 TCATGGGGGCATTATCACCT 58.467 50.000 0.00 0.00 0.00 4.00
2357 2369 1.145531 TCATGGGGGCATTATCACCTG 59.854 52.381 0.00 0.00 0.00 4.00
2358 2370 0.484212 ATGGGGGCATTATCACCTGG 59.516 55.000 0.00 0.00 0.00 4.45
2359 2371 1.531602 GGGGGCATTATCACCTGGC 60.532 63.158 0.00 0.00 37.22 4.85
2360 2372 1.229927 GGGGCATTATCACCTGGCA 59.770 57.895 0.00 0.00 39.53 4.92
2361 2373 1.109323 GGGGCATTATCACCTGGCAC 61.109 60.000 0.00 0.00 39.53 5.01
2362 2374 0.395586 GGGCATTATCACCTGGCACA 60.396 55.000 0.00 0.00 39.53 4.57
2363 2375 1.696063 GGCATTATCACCTGGCACAT 58.304 50.000 0.00 0.00 38.20 3.21
2364 2376 1.610522 GGCATTATCACCTGGCACATC 59.389 52.381 0.00 0.00 38.20 3.06
2365 2377 1.265095 GCATTATCACCTGGCACATCG 59.735 52.381 0.00 0.00 38.20 3.84
2366 2378 1.265095 CATTATCACCTGGCACATCGC 59.735 52.381 0.00 0.00 38.20 4.58
2380 2392 1.293924 CATCGCCACTGATGTCTTCC 58.706 55.000 0.00 0.00 40.67 3.46
2381 2393 1.134580 CATCGCCACTGATGTCTTCCT 60.135 52.381 0.00 0.00 40.67 3.36
2382 2394 0.532573 TCGCCACTGATGTCTTCCTC 59.467 55.000 0.00 0.00 0.00 3.71
2383 2395 0.534412 CGCCACTGATGTCTTCCTCT 59.466 55.000 0.00 0.00 0.00 3.69
2384 2396 1.738365 CGCCACTGATGTCTTCCTCTG 60.738 57.143 0.00 0.00 0.00 3.35
2385 2397 2.011046 GCCACTGATGTCTTCCTCTGC 61.011 57.143 0.00 0.00 0.00 4.26
2386 2398 1.277273 CCACTGATGTCTTCCTCTGCA 59.723 52.381 0.00 0.00 0.00 4.41
2387 2399 2.289882 CCACTGATGTCTTCCTCTGCAA 60.290 50.000 0.00 0.00 0.00 4.08
2388 2400 3.001414 CACTGATGTCTTCCTCTGCAAG 58.999 50.000 0.00 0.00 0.00 4.01
2389 2401 2.902486 ACTGATGTCTTCCTCTGCAAGA 59.098 45.455 0.00 0.00 43.69 3.02
2401 2413 3.045142 GCAAGAGCAAGCAAGCCA 58.955 55.556 0.00 0.00 41.58 4.75
2402 2414 1.364901 GCAAGAGCAAGCAAGCCAA 59.635 52.632 0.00 0.00 41.58 4.52
2403 2415 0.666577 GCAAGAGCAAGCAAGCCAAG 60.667 55.000 0.00 0.00 41.58 3.61
2404 2416 0.038526 CAAGAGCAAGCAAGCCAAGG 60.039 55.000 0.00 0.00 34.23 3.61
2405 2417 1.183676 AAGAGCAAGCAAGCCAAGGG 61.184 55.000 0.00 0.00 34.23 3.95
2406 2418 1.604593 GAGCAAGCAAGCCAAGGGA 60.605 57.895 0.00 0.00 34.23 4.20
2407 2419 1.871126 GAGCAAGCAAGCCAAGGGAC 61.871 60.000 0.00 0.00 34.23 4.46
2408 2420 2.202395 GCAAGCAAGCCAAGGGACA 61.202 57.895 0.00 0.00 0.00 4.02
2409 2421 1.747325 GCAAGCAAGCCAAGGGACAA 61.747 55.000 0.00 0.00 0.00 3.18
2410 2422 0.316204 CAAGCAAGCCAAGGGACAAG 59.684 55.000 0.00 0.00 0.00 3.16
2411 2423 0.185901 AAGCAAGCCAAGGGACAAGA 59.814 50.000 0.00 0.00 0.00 3.02
2412 2424 0.407139 AGCAAGCCAAGGGACAAGAT 59.593 50.000 0.00 0.00 0.00 2.40
2413 2425 0.529378 GCAAGCCAAGGGACAAGATG 59.471 55.000 0.00 0.00 0.00 2.90
2414 2426 0.529378 CAAGCCAAGGGACAAGATGC 59.471 55.000 0.00 0.00 0.00 3.91
2415 2427 0.112995 AAGCCAAGGGACAAGATGCA 59.887 50.000 0.00 0.00 0.00 3.96
2416 2428 0.112995 AGCCAAGGGACAAGATGCAA 59.887 50.000 0.00 0.00 0.00 4.08
2417 2429 0.244721 GCCAAGGGACAAGATGCAAC 59.755 55.000 0.00 0.00 0.00 4.17
2418 2430 1.619654 CCAAGGGACAAGATGCAACA 58.380 50.000 0.00 0.00 0.00 3.33
2419 2431 1.270550 CCAAGGGACAAGATGCAACAC 59.729 52.381 0.00 0.00 0.00 3.32
2420 2432 2.233271 CAAGGGACAAGATGCAACACT 58.767 47.619 0.00 0.00 0.00 3.55
2421 2433 3.411446 CAAGGGACAAGATGCAACACTA 58.589 45.455 0.00 0.00 0.00 2.74
2422 2434 3.788227 AGGGACAAGATGCAACACTAA 57.212 42.857 0.00 0.00 0.00 2.24
2423 2435 4.307032 AGGGACAAGATGCAACACTAAT 57.693 40.909 0.00 0.00 0.00 1.73
2424 2436 4.666512 AGGGACAAGATGCAACACTAATT 58.333 39.130 0.00 0.00 0.00 1.40
2425 2437 4.460382 AGGGACAAGATGCAACACTAATTG 59.540 41.667 0.00 0.00 0.00 2.32
2426 2438 4.218417 GGGACAAGATGCAACACTAATTGT 59.782 41.667 0.00 0.00 41.74 2.71
2427 2439 5.393962 GGACAAGATGCAACACTAATTGTC 58.606 41.667 14.03 14.03 42.56 3.18
2428 2440 5.048782 GGACAAGATGCAACACTAATTGTCA 60.049 40.000 20.16 0.00 44.18 3.58
2429 2441 6.389830 ACAAGATGCAACACTAATTGTCAA 57.610 33.333 0.00 0.00 37.51 3.18
2430 2442 6.208644 ACAAGATGCAACACTAATTGTCAAC 58.791 36.000 0.00 0.00 37.51 3.18
2431 2443 5.034554 AGATGCAACACTAATTGTCAACG 57.965 39.130 0.00 0.00 37.51 4.10
2432 2444 2.993545 TGCAACACTAATTGTCAACGC 58.006 42.857 0.00 0.00 37.51 4.84
2433 2445 1.969256 GCAACACTAATTGTCAACGCG 59.031 47.619 3.53 3.53 37.51 6.01
2434 2446 2.570169 CAACACTAATTGTCAACGCGG 58.430 47.619 12.47 0.00 37.51 6.46
2435 2447 1.873698 ACACTAATTGTCAACGCGGT 58.126 45.000 12.47 0.00 29.79 5.68
2436 2448 2.215196 ACACTAATTGTCAACGCGGTT 58.785 42.857 12.47 0.00 29.79 4.44
2437 2449 2.222445 ACACTAATTGTCAACGCGGTTC 59.778 45.455 12.47 0.00 29.79 3.62
2438 2450 2.222213 CACTAATTGTCAACGCGGTTCA 59.778 45.455 12.47 2.24 0.00 3.18
2439 2451 2.478894 ACTAATTGTCAACGCGGTTCAG 59.521 45.455 12.47 0.00 0.00 3.02
2440 2452 1.588674 AATTGTCAACGCGGTTCAGA 58.411 45.000 12.47 0.00 0.00 3.27
2441 2453 0.865769 ATTGTCAACGCGGTTCAGAC 59.134 50.000 12.47 8.81 0.00 3.51
2442 2454 1.155424 TTGTCAACGCGGTTCAGACC 61.155 55.000 12.47 0.00 42.87 3.85
2443 2455 2.029964 TCAACGCGGTTCAGACCC 59.970 61.111 12.47 0.00 43.42 4.46
2444 2456 2.030562 CAACGCGGTTCAGACCCT 59.969 61.111 12.47 0.00 43.42 4.34
2445 2457 2.027625 CAACGCGGTTCAGACCCTC 61.028 63.158 12.47 0.00 43.42 4.30
2446 2458 2.207924 AACGCGGTTCAGACCCTCT 61.208 57.895 12.47 0.00 43.42 3.69
2447 2459 2.156051 AACGCGGTTCAGACCCTCTC 62.156 60.000 12.47 0.00 43.42 3.20
2448 2460 2.579738 GCGGTTCAGACCCTCTCC 59.420 66.667 0.00 0.00 43.42 3.71
2449 2461 2.283529 GCGGTTCAGACCCTCTCCA 61.284 63.158 0.00 0.00 43.42 3.86
2450 2462 1.827399 GCGGTTCAGACCCTCTCCAA 61.827 60.000 0.00 0.00 43.42 3.53
2451 2463 0.037232 CGGTTCAGACCCTCTCCAAC 60.037 60.000 0.00 0.00 43.42 3.77
2452 2464 1.353091 GGTTCAGACCCTCTCCAACT 58.647 55.000 0.00 0.00 40.25 3.16
2453 2465 2.537143 GGTTCAGACCCTCTCCAACTA 58.463 52.381 0.00 0.00 40.25 2.24
2454 2466 2.234168 GGTTCAGACCCTCTCCAACTAC 59.766 54.545 0.00 0.00 40.25 2.73
2455 2467 2.897969 GTTCAGACCCTCTCCAACTACA 59.102 50.000 0.00 0.00 0.00 2.74
2456 2468 3.474798 TCAGACCCTCTCCAACTACAT 57.525 47.619 0.00 0.00 0.00 2.29
2457 2469 3.099905 TCAGACCCTCTCCAACTACATG 58.900 50.000 0.00 0.00 0.00 3.21
2458 2470 3.099905 CAGACCCTCTCCAACTACATGA 58.900 50.000 0.00 0.00 0.00 3.07
2459 2471 3.708631 CAGACCCTCTCCAACTACATGAT 59.291 47.826 0.00 0.00 0.00 2.45
2460 2472 3.708631 AGACCCTCTCCAACTACATGATG 59.291 47.826 0.00 0.00 0.00 3.07
2461 2473 3.452627 GACCCTCTCCAACTACATGATGT 59.547 47.826 2.65 2.65 0.00 3.06
2462 2474 3.846588 ACCCTCTCCAACTACATGATGTT 59.153 43.478 2.29 0.62 0.00 2.71
2463 2475 4.080863 ACCCTCTCCAACTACATGATGTTC 60.081 45.833 2.29 0.00 0.00 3.18
2464 2476 4.446371 CCTCTCCAACTACATGATGTTCC 58.554 47.826 2.29 0.00 0.00 3.62
2465 2477 4.163078 CCTCTCCAACTACATGATGTTCCT 59.837 45.833 2.29 0.00 0.00 3.36
2466 2478 5.344743 TCTCCAACTACATGATGTTCCTC 57.655 43.478 2.29 0.00 0.00 3.71
2467 2479 4.162320 TCTCCAACTACATGATGTTCCTCC 59.838 45.833 2.29 0.00 0.00 4.30
2468 2480 4.104086 TCCAACTACATGATGTTCCTCCT 58.896 43.478 2.29 0.00 0.00 3.69
2469 2481 5.277250 TCCAACTACATGATGTTCCTCCTA 58.723 41.667 2.29 0.00 0.00 2.94
2470 2482 5.363868 TCCAACTACATGATGTTCCTCCTAG 59.636 44.000 2.29 0.00 0.00 3.02
2471 2483 5.129485 CCAACTACATGATGTTCCTCCTAGT 59.871 44.000 2.29 0.00 0.00 2.57
2472 2484 5.860941 ACTACATGATGTTCCTCCTAGTG 57.139 43.478 2.29 0.00 0.00 2.74
2473 2485 4.651503 ACTACATGATGTTCCTCCTAGTGG 59.348 45.833 2.29 0.00 0.00 4.00
2474 2486 2.171448 ACATGATGTTCCTCCTAGTGGC 59.829 50.000 0.00 0.00 0.00 5.01
2475 2487 1.951209 TGATGTTCCTCCTAGTGGCA 58.049 50.000 0.00 0.00 0.00 4.92
2476 2488 1.555075 TGATGTTCCTCCTAGTGGCAC 59.445 52.381 10.29 10.29 0.00 5.01
2477 2489 0.537188 ATGTTCCTCCTAGTGGCACG 59.463 55.000 12.71 0.00 0.00 5.34
2478 2490 1.448013 GTTCCTCCTAGTGGCACGC 60.448 63.158 12.71 0.00 40.45 5.34
2479 2491 2.656069 TTCCTCCTAGTGGCACGCC 61.656 63.158 12.71 0.00 41.54 5.68
2480 2492 4.162690 CCTCCTAGTGGCACGCCC 62.163 72.222 12.71 0.00 41.54 6.13
2481 2493 4.162690 CTCCTAGTGGCACGCCCC 62.163 72.222 12.71 0.00 41.54 5.80
2482 2494 4.715130 TCCTAGTGGCACGCCCCT 62.715 66.667 12.71 1.23 41.54 4.79
2483 2495 2.762459 CCTAGTGGCACGCCCCTA 60.762 66.667 12.71 2.57 41.54 3.53
2484 2496 2.140792 CCTAGTGGCACGCCCCTAT 61.141 63.158 12.71 0.00 41.54 2.57
2485 2497 0.830444 CCTAGTGGCACGCCCCTATA 60.830 60.000 12.71 0.00 41.54 1.31
2486 2498 1.267121 CTAGTGGCACGCCCCTATAT 58.733 55.000 12.71 0.00 41.54 0.86
2487 2499 0.973632 TAGTGGCACGCCCCTATATG 59.026 55.000 12.71 0.00 41.54 1.78
2488 2500 1.966451 GTGGCACGCCCCTATATGC 60.966 63.158 0.00 0.00 37.35 3.14
2489 2501 2.146724 TGGCACGCCCCTATATGCT 61.147 57.895 5.42 0.00 38.18 3.79
2490 2502 1.672356 GGCACGCCCCTATATGCTG 60.672 63.158 0.00 0.00 38.18 4.41
2491 2503 2.328099 GCACGCCCCTATATGCTGC 61.328 63.158 0.00 0.00 35.16 5.25
2492 2504 1.672356 CACGCCCCTATATGCTGCC 60.672 63.158 0.00 0.00 0.00 4.85
2493 2505 2.146724 ACGCCCCTATATGCTGCCA 61.147 57.895 0.00 0.00 0.00 4.92
2494 2506 1.376424 CGCCCCTATATGCTGCCAG 60.376 63.158 0.00 0.00 0.00 4.85
2495 2507 1.001641 GCCCCTATATGCTGCCAGG 60.002 63.158 0.00 0.00 0.00 4.45
2496 2508 1.001641 CCCCTATATGCTGCCAGGC 60.002 63.158 3.66 3.66 0.00 4.85
2497 2509 1.001641 CCCTATATGCTGCCAGGCC 60.002 63.158 9.64 0.00 0.00 5.19
2498 2510 1.495579 CCCTATATGCTGCCAGGCCT 61.496 60.000 9.64 0.00 0.00 5.19
2499 2511 0.403271 CCTATATGCTGCCAGGCCTT 59.597 55.000 9.64 0.00 0.00 4.35
2500 2512 1.531423 CTATATGCTGCCAGGCCTTG 58.469 55.000 9.64 0.00 0.00 3.61
2501 2513 0.846015 TATATGCTGCCAGGCCTTGT 59.154 50.000 9.64 0.00 0.00 3.16
2502 2514 0.466922 ATATGCTGCCAGGCCTTGTC 60.467 55.000 9.64 0.00 0.00 3.18
2503 2515 2.556840 TATGCTGCCAGGCCTTGTCC 62.557 60.000 9.64 0.00 0.00 4.02
2504 2516 4.357279 GCTGCCAGGCCTTGTCCT 62.357 66.667 9.64 0.00 36.78 3.85
2505 2517 2.045536 CTGCCAGGCCTTGTCCTC 60.046 66.667 9.64 0.00 33.25 3.71
2506 2518 3.635268 CTGCCAGGCCTTGTCCTCC 62.635 68.421 9.64 0.00 33.25 4.30
2507 2519 3.650950 GCCAGGCCTTGTCCTCCA 61.651 66.667 0.00 0.00 33.25 3.86
2508 2520 3.170362 CCAGGCCTTGTCCTCCAA 58.830 61.111 0.00 0.00 33.25 3.53
2509 2521 1.460255 CCAGGCCTTGTCCTCCAAA 59.540 57.895 0.00 0.00 33.25 3.28
2510 2522 0.610232 CCAGGCCTTGTCCTCCAAAG 60.610 60.000 0.00 0.00 33.25 2.77
2511 2523 1.075659 AGGCCTTGTCCTCCAAAGC 59.924 57.895 0.00 0.00 39.36 3.51
2512 2524 3.686760 GCCTTGTCCTCCAAAGCC 58.313 61.111 0.00 0.00 34.94 4.35
2513 2525 1.075659 GCCTTGTCCTCCAAAGCCT 59.924 57.895 0.00 0.00 34.94 4.58
2514 2526 1.246737 GCCTTGTCCTCCAAAGCCTG 61.247 60.000 0.00 0.00 34.94 4.85
2515 2527 0.111253 CCTTGTCCTCCAAAGCCTGT 59.889 55.000 0.00 0.00 31.20 4.00
2516 2528 1.351017 CCTTGTCCTCCAAAGCCTGTA 59.649 52.381 0.00 0.00 31.20 2.74
2517 2529 2.025887 CCTTGTCCTCCAAAGCCTGTAT 60.026 50.000 0.00 0.00 31.20 2.29
2518 2530 2.787473 TGTCCTCCAAAGCCTGTATG 57.213 50.000 0.00 0.00 0.00 2.39
2519 2531 2.265367 TGTCCTCCAAAGCCTGTATGA 58.735 47.619 0.00 0.00 0.00 2.15
2520 2532 2.237143 TGTCCTCCAAAGCCTGTATGAG 59.763 50.000 0.00 0.00 0.00 2.90
2521 2533 1.210478 TCCTCCAAAGCCTGTATGAGC 59.790 52.381 0.00 0.00 0.00 4.26
2522 2534 1.065199 CCTCCAAAGCCTGTATGAGCA 60.065 52.381 0.00 0.00 0.00 4.26
2523 2535 2.618816 CCTCCAAAGCCTGTATGAGCAA 60.619 50.000 0.00 0.00 0.00 3.91
2524 2536 3.084039 CTCCAAAGCCTGTATGAGCAAA 58.916 45.455 0.00 0.00 0.00 3.68
2525 2537 2.819608 TCCAAAGCCTGTATGAGCAAAC 59.180 45.455 0.00 0.00 0.00 2.93
2526 2538 2.094545 CCAAAGCCTGTATGAGCAAACC 60.095 50.000 0.00 0.00 0.00 3.27
2527 2539 2.821969 CAAAGCCTGTATGAGCAAACCT 59.178 45.455 0.00 0.00 0.00 3.50
2528 2540 2.119801 AGCCTGTATGAGCAAACCTG 57.880 50.000 0.00 0.00 0.00 4.00
2549 2561 3.127081 CAATGGTTTGCTCGATCTGTG 57.873 47.619 0.00 0.00 0.00 3.66
2550 2562 1.742761 ATGGTTTGCTCGATCTGTGG 58.257 50.000 0.00 0.00 0.00 4.17
2551 2563 0.955428 TGGTTTGCTCGATCTGTGGC 60.955 55.000 0.00 0.00 0.00 5.01
2552 2564 0.955428 GGTTTGCTCGATCTGTGGCA 60.955 55.000 0.00 0.00 0.00 4.92
2553 2565 1.089920 GTTTGCTCGATCTGTGGCAT 58.910 50.000 0.00 0.00 34.59 4.40
2554 2566 1.063174 GTTTGCTCGATCTGTGGCATC 59.937 52.381 0.00 0.00 34.59 3.91
2555 2567 0.249955 TTGCTCGATCTGTGGCATCA 59.750 50.000 0.00 0.00 34.59 3.07
2556 2568 0.179092 TGCTCGATCTGTGGCATCAG 60.179 55.000 9.81 9.81 36.85 2.90
2557 2569 0.879400 GCTCGATCTGTGGCATCAGG 60.879 60.000 14.28 2.82 36.25 3.86
2558 2570 0.749049 CTCGATCTGTGGCATCAGGA 59.251 55.000 14.28 6.05 36.25 3.86
2559 2571 1.343789 CTCGATCTGTGGCATCAGGAT 59.656 52.381 14.28 5.91 36.25 3.24
2560 2572 1.069668 TCGATCTGTGGCATCAGGATG 59.930 52.381 14.28 4.91 41.60 3.51
2561 2573 1.876837 CGATCTGTGGCATCAGGATGG 60.877 57.143 10.99 4.28 39.16 3.51
2568 2580 3.491208 GCATCAGGATGGCTCAACT 57.509 52.632 10.99 0.00 39.16 3.16
2569 2581 1.022735 GCATCAGGATGGCTCAACTG 58.977 55.000 10.99 0.00 39.16 3.16
2570 2582 1.407851 GCATCAGGATGGCTCAACTGA 60.408 52.381 10.99 12.08 43.33 3.41
2571 2583 2.286872 CATCAGGATGGCTCAACTGAC 58.713 52.381 11.99 0.00 42.14 3.51
2572 2584 1.351076 TCAGGATGGCTCAACTGACA 58.649 50.000 0.00 0.00 35.24 3.58
2573 2585 1.002430 TCAGGATGGCTCAACTGACAC 59.998 52.381 0.00 0.00 35.24 3.67
2574 2586 0.326264 AGGATGGCTCAACTGACACC 59.674 55.000 0.00 0.00 0.00 4.16
2575 2587 1.021390 GGATGGCTCAACTGACACCG 61.021 60.000 0.00 0.00 0.00 4.94
2576 2588 0.037326 GATGGCTCAACTGACACCGA 60.037 55.000 0.00 0.00 0.00 4.69
2577 2589 0.615331 ATGGCTCAACTGACACCGAT 59.385 50.000 0.00 0.00 0.00 4.18
2578 2590 0.396435 TGGCTCAACTGACACCGATT 59.604 50.000 0.00 0.00 0.00 3.34
2579 2591 0.798776 GGCTCAACTGACACCGATTG 59.201 55.000 0.00 0.00 0.00 2.67
2580 2592 1.512926 GCTCAACTGACACCGATTGT 58.487 50.000 0.00 0.00 43.10 2.71
2589 2601 2.479566 ACACCGATTGTCAAGCATCT 57.520 45.000 1.19 0.00 29.79 2.90
2590 2602 2.783135 ACACCGATTGTCAAGCATCTT 58.217 42.857 1.19 0.00 29.79 2.40
2591 2603 2.744202 ACACCGATTGTCAAGCATCTTC 59.256 45.455 1.19 0.00 29.79 2.87
2592 2604 3.005554 CACCGATTGTCAAGCATCTTCT 58.994 45.455 1.19 0.00 0.00 2.85
2593 2605 3.063180 CACCGATTGTCAAGCATCTTCTC 59.937 47.826 1.19 0.00 0.00 2.87
2594 2606 3.264947 CCGATTGTCAAGCATCTTCTCA 58.735 45.455 1.19 0.00 0.00 3.27
2595 2607 3.063180 CCGATTGTCAAGCATCTTCTCAC 59.937 47.826 1.19 0.00 0.00 3.51
2596 2608 3.931468 CGATTGTCAAGCATCTTCTCACT 59.069 43.478 1.19 0.00 0.00 3.41
2597 2609 4.032672 CGATTGTCAAGCATCTTCTCACTC 59.967 45.833 1.19 0.00 0.00 3.51
2598 2610 4.341366 TTGTCAAGCATCTTCTCACTCA 57.659 40.909 0.00 0.00 0.00 3.41
2599 2611 4.341366 TGTCAAGCATCTTCTCACTCAA 57.659 40.909 0.00 0.00 0.00 3.02
2600 2612 4.313282 TGTCAAGCATCTTCTCACTCAAG 58.687 43.478 0.00 0.00 0.00 3.02
2601 2613 3.124976 GTCAAGCATCTTCTCACTCAAGC 59.875 47.826 0.00 0.00 0.00 4.01
2602 2614 2.399916 AGCATCTTCTCACTCAAGCC 57.600 50.000 0.00 0.00 0.00 4.35
2603 2615 1.627329 AGCATCTTCTCACTCAAGCCA 59.373 47.619 0.00 0.00 0.00 4.75
2604 2616 1.736681 GCATCTTCTCACTCAAGCCAC 59.263 52.381 0.00 0.00 0.00 5.01
2605 2617 2.354259 CATCTTCTCACTCAAGCCACC 58.646 52.381 0.00 0.00 0.00 4.61
2606 2618 0.687354 TCTTCTCACTCAAGCCACCC 59.313 55.000 0.00 0.00 0.00 4.61
2607 2619 0.322008 CTTCTCACTCAAGCCACCCC 60.322 60.000 0.00 0.00 0.00 4.95
2608 2620 1.059584 TTCTCACTCAAGCCACCCCA 61.060 55.000 0.00 0.00 0.00 4.96
2609 2621 1.059584 TCTCACTCAAGCCACCCCAA 61.060 55.000 0.00 0.00 0.00 4.12
2610 2622 0.890996 CTCACTCAAGCCACCCCAAC 60.891 60.000 0.00 0.00 0.00 3.77
2611 2623 1.152777 CACTCAAGCCACCCCAACA 60.153 57.895 0.00 0.00 0.00 3.33
2612 2624 1.151450 ACTCAAGCCACCCCAACAG 59.849 57.895 0.00 0.00 0.00 3.16
2613 2625 2.203480 TCAAGCCACCCCAACAGC 60.203 61.111 0.00 0.00 0.00 4.40
2614 2626 2.203538 CAAGCCACCCCAACAGCT 60.204 61.111 0.00 0.00 37.10 4.24
2615 2627 2.203538 AAGCCACCCCAACAGCTG 60.204 61.111 13.48 13.48 35.30 4.24
2616 2628 3.815407 AAGCCACCCCAACAGCTGG 62.815 63.158 19.93 1.37 45.97 4.85
2632 2644 3.699779 GCTGGAGCTTAATTTACCTGC 57.300 47.619 0.00 0.00 38.10 4.85
2633 2645 2.359214 GCTGGAGCTTAATTTACCTGCC 59.641 50.000 0.00 0.00 38.82 4.85
2634 2646 3.891049 CTGGAGCTTAATTTACCTGCCT 58.109 45.455 0.00 0.00 0.00 4.75
2635 2647 4.686122 GCTGGAGCTTAATTTACCTGCCTA 60.686 45.833 0.00 0.00 38.82 3.93
2636 2648 5.437060 CTGGAGCTTAATTTACCTGCCTAA 58.563 41.667 0.00 0.00 0.00 2.69
2637 2649 5.437060 TGGAGCTTAATTTACCTGCCTAAG 58.563 41.667 0.00 0.00 0.00 2.18
2638 2650 5.190925 TGGAGCTTAATTTACCTGCCTAAGA 59.809 40.000 0.00 0.00 0.00 2.10
2639 2651 6.120220 GGAGCTTAATTTACCTGCCTAAGAA 58.880 40.000 0.00 0.00 0.00 2.52
2640 2652 6.602009 GGAGCTTAATTTACCTGCCTAAGAAA 59.398 38.462 0.00 0.00 0.00 2.52
2641 2653 7.122204 GGAGCTTAATTTACCTGCCTAAGAAAA 59.878 37.037 0.00 0.00 0.00 2.29
2642 2654 8.595362 AGCTTAATTTACCTGCCTAAGAAAAT 57.405 30.769 0.00 0.00 0.00 1.82
2643 2655 9.035890 AGCTTAATTTACCTGCCTAAGAAAATT 57.964 29.630 0.00 0.00 36.29 1.82
2644 2656 9.653287 GCTTAATTTACCTGCCTAAGAAAATTT 57.347 29.630 0.00 0.00 35.10 1.82
2649 2661 9.710900 ATTTACCTGCCTAAGAAAATTTTCAAG 57.289 29.630 28.00 23.07 39.61 3.02
2650 2662 6.101650 ACCTGCCTAAGAAAATTTTCAAGG 57.898 37.500 30.07 30.07 41.65 3.61
2656 2668 5.858581 CCTAAGAAAATTTTCAAGGCTGACG 59.141 40.000 28.00 10.51 39.61 4.35
2657 2669 5.514274 AAGAAAATTTTCAAGGCTGACGA 57.486 34.783 28.00 0.00 39.61 4.20
2658 2670 5.712152 AGAAAATTTTCAAGGCTGACGAT 57.288 34.783 28.00 4.69 39.61 3.73
2659 2671 5.703876 AGAAAATTTTCAAGGCTGACGATC 58.296 37.500 28.00 1.69 39.61 3.69
2660 2672 4.440839 AAATTTTCAAGGCTGACGATCC 57.559 40.909 0.00 0.00 0.00 3.36
2661 2673 2.559698 TTTTCAAGGCTGACGATCCA 57.440 45.000 0.00 0.00 0.00 3.41
2662 2674 2.559698 TTTCAAGGCTGACGATCCAA 57.440 45.000 0.00 0.00 0.00 3.53
2663 2675 2.559698 TTCAAGGCTGACGATCCAAA 57.440 45.000 0.00 0.00 0.00 3.28
2664 2676 2.787473 TCAAGGCTGACGATCCAAAT 57.213 45.000 0.00 0.00 0.00 2.32
2665 2677 3.071874 TCAAGGCTGACGATCCAAATT 57.928 42.857 0.00 0.00 0.00 1.82
2666 2678 3.009723 TCAAGGCTGACGATCCAAATTC 58.990 45.455 0.00 0.00 0.00 2.17
2667 2679 3.012518 CAAGGCTGACGATCCAAATTCT 58.987 45.455 0.00 0.00 0.00 2.40
2668 2680 3.356529 AGGCTGACGATCCAAATTCTT 57.643 42.857 0.00 0.00 0.00 2.52
2669 2681 3.274288 AGGCTGACGATCCAAATTCTTC 58.726 45.455 0.00 0.00 0.00 2.87
2670 2682 2.356069 GGCTGACGATCCAAATTCTTCC 59.644 50.000 0.00 0.00 0.00 3.46
2671 2683 3.009723 GCTGACGATCCAAATTCTTCCA 58.990 45.455 0.00 0.00 0.00 3.53
2672 2684 3.064545 GCTGACGATCCAAATTCTTCCAG 59.935 47.826 0.00 0.00 0.00 3.86
2673 2685 3.609853 TGACGATCCAAATTCTTCCAGG 58.390 45.455 0.00 0.00 0.00 4.45
2674 2686 2.356069 GACGATCCAAATTCTTCCAGGC 59.644 50.000 0.00 0.00 0.00 4.85
2675 2687 2.025887 ACGATCCAAATTCTTCCAGGCT 60.026 45.455 0.00 0.00 0.00 4.58
2676 2688 2.615912 CGATCCAAATTCTTCCAGGCTC 59.384 50.000 0.00 0.00 0.00 4.70
2677 2689 2.514458 TCCAAATTCTTCCAGGCTCC 57.486 50.000 0.00 0.00 0.00 4.70
2678 2690 1.005924 TCCAAATTCTTCCAGGCTCCC 59.994 52.381 0.00 0.00 0.00 4.30
2679 2691 1.478631 CAAATTCTTCCAGGCTCCCC 58.521 55.000 0.00 0.00 0.00 4.81
2680 2692 0.034089 AAATTCTTCCAGGCTCCCCG 60.034 55.000 0.00 0.00 35.76 5.73
2681 2693 0.914417 AATTCTTCCAGGCTCCCCGA 60.914 55.000 0.00 0.00 35.76 5.14
2682 2694 1.341156 ATTCTTCCAGGCTCCCCGAG 61.341 60.000 0.00 0.00 35.76 4.63
2683 2695 2.364317 CTTCCAGGCTCCCCGAGA 60.364 66.667 0.00 0.00 35.76 4.04
2684 2696 2.364317 TTCCAGGCTCCCCGAGAG 60.364 66.667 0.00 0.00 46.29 3.20
2685 2697 2.863019 CTTCCAGGCTCCCCGAGAGA 62.863 65.000 6.61 0.00 46.50 3.10
2686 2698 2.837291 CCAGGCTCCCCGAGAGAG 60.837 72.222 6.61 0.00 46.50 3.20
2687 2699 2.277072 CAGGCTCCCCGAGAGAGA 59.723 66.667 6.61 0.00 46.50 3.10
2688 2700 1.827789 CAGGCTCCCCGAGAGAGAG 60.828 68.421 6.61 0.00 46.50 3.20
2689 2701 2.004120 AGGCTCCCCGAGAGAGAGA 61.004 63.158 6.61 0.00 46.50 3.10
2690 2702 1.076632 GGCTCCCCGAGAGAGAGAA 60.077 63.158 6.61 0.00 46.50 2.87
2691 2703 1.106944 GGCTCCCCGAGAGAGAGAAG 61.107 65.000 6.61 0.00 46.50 2.85
2692 2704 1.734388 GCTCCCCGAGAGAGAGAAGC 61.734 65.000 6.61 0.00 46.50 3.86
2693 2705 0.106719 CTCCCCGAGAGAGAGAAGCT 60.107 60.000 0.00 0.00 46.50 3.74
2694 2706 0.333312 TCCCCGAGAGAGAGAAGCTT 59.667 55.000 0.00 0.00 0.00 3.74
2695 2707 0.459489 CCCCGAGAGAGAGAAGCTTG 59.541 60.000 2.10 0.00 0.00 4.01
2696 2708 0.179113 CCCGAGAGAGAGAAGCTTGC 60.179 60.000 2.10 0.00 0.00 4.01
2697 2709 0.179113 CCGAGAGAGAGAAGCTTGCC 60.179 60.000 2.10 0.00 0.00 4.52
2698 2710 0.179113 CGAGAGAGAGAAGCTTGCCC 60.179 60.000 2.10 0.00 0.00 5.36
2699 2711 0.901124 GAGAGAGAGAAGCTTGCCCA 59.099 55.000 2.10 0.00 0.00 5.36
2700 2712 0.903942 AGAGAGAGAAGCTTGCCCAG 59.096 55.000 2.10 0.00 0.00 4.45
2701 2713 0.901124 GAGAGAGAAGCTTGCCCAGA 59.099 55.000 2.10 0.00 0.00 3.86
2702 2714 1.485895 GAGAGAGAAGCTTGCCCAGAT 59.514 52.381 2.10 0.00 0.00 2.90
2703 2715 1.485895 AGAGAGAAGCTTGCCCAGATC 59.514 52.381 2.10 0.00 0.00 2.75
2704 2716 0.545646 AGAGAAGCTTGCCCAGATCC 59.454 55.000 2.10 0.00 0.00 3.36
2705 2717 0.545646 GAGAAGCTTGCCCAGATCCT 59.454 55.000 2.10 0.00 0.00 3.24
2706 2718 0.255318 AGAAGCTTGCCCAGATCCTG 59.745 55.000 2.10 0.00 0.00 3.86
2707 2719 1.379576 AAGCTTGCCCAGATCCTGC 60.380 57.895 0.00 0.00 0.00 4.85
2708 2720 1.860944 AAGCTTGCCCAGATCCTGCT 61.861 55.000 0.00 0.00 0.00 4.24
2709 2721 1.823041 GCTTGCCCAGATCCTGCTC 60.823 63.158 0.00 0.00 0.00 4.26
2710 2722 1.605992 CTTGCCCAGATCCTGCTCA 59.394 57.895 0.00 0.00 0.00 4.26
2711 2723 0.034767 CTTGCCCAGATCCTGCTCAA 60.035 55.000 0.00 0.00 0.00 3.02
2712 2724 0.322816 TTGCCCAGATCCTGCTCAAC 60.323 55.000 0.00 0.00 0.00 3.18
2713 2725 1.300963 GCCCAGATCCTGCTCAACA 59.699 57.895 0.00 0.00 0.00 3.33
2714 2726 0.747283 GCCCAGATCCTGCTCAACAG 60.747 60.000 0.00 0.00 46.77 3.16
2729 2741 2.740055 CAGAAACGCTGGCTCGCT 60.740 61.111 0.00 0.00 41.07 4.93
2730 2742 2.740055 AGAAACGCTGGCTCGCTG 60.740 61.111 0.00 0.00 0.00 5.18
2731 2743 2.738521 GAAACGCTGGCTCGCTGA 60.739 61.111 0.00 0.00 0.00 4.26
2732 2744 2.280797 AAACGCTGGCTCGCTGAA 60.281 55.556 0.00 0.00 0.00 3.02
2733 2745 1.639298 GAAACGCTGGCTCGCTGAAT 61.639 55.000 0.00 0.00 0.00 2.57
2734 2746 1.915614 AAACGCTGGCTCGCTGAATG 61.916 55.000 0.00 0.00 0.00 2.67
2735 2747 2.510012 CGCTGGCTCGCTGAATGA 60.510 61.111 0.00 0.00 0.00 2.57
2736 2748 2.806856 CGCTGGCTCGCTGAATGAC 61.807 63.158 0.00 0.00 0.00 3.06
2737 2749 2.806856 GCTGGCTCGCTGAATGACG 61.807 63.158 0.00 0.00 0.00 4.35
2738 2750 1.153765 CTGGCTCGCTGAATGACGA 60.154 57.895 0.00 0.00 36.73 4.20
2739 2751 1.416813 CTGGCTCGCTGAATGACGAC 61.417 60.000 0.00 0.00 34.08 4.34
2740 2752 1.446099 GGCTCGCTGAATGACGACA 60.446 57.895 0.00 0.00 34.08 4.35
2741 2753 1.687494 GGCTCGCTGAATGACGACAC 61.687 60.000 0.00 0.00 34.08 3.67
2742 2754 1.687494 GCTCGCTGAATGACGACACC 61.687 60.000 0.00 0.00 34.08 4.16
2743 2755 1.406219 CTCGCTGAATGACGACACCG 61.406 60.000 0.00 0.00 42.50 4.94
2744 2756 2.778679 GCTGAATGACGACACCGC 59.221 61.111 0.00 0.00 39.95 5.68
2745 2757 1.738099 GCTGAATGACGACACCGCT 60.738 57.895 0.00 0.00 39.95 5.52
2746 2758 0.457853 GCTGAATGACGACACCGCTA 60.458 55.000 0.00 0.00 39.95 4.26
2747 2759 1.550065 CTGAATGACGACACCGCTAG 58.450 55.000 0.00 0.00 39.95 3.42
2748 2760 1.132453 CTGAATGACGACACCGCTAGA 59.868 52.381 0.00 0.00 39.95 2.43
2749 2761 1.542472 TGAATGACGACACCGCTAGAA 59.458 47.619 0.00 0.00 39.95 2.10
2750 2762 2.029739 TGAATGACGACACCGCTAGAAA 60.030 45.455 0.00 0.00 39.95 2.52
2751 2763 2.736144 ATGACGACACCGCTAGAAAA 57.264 45.000 0.00 0.00 39.95 2.29
2752 2764 1.774639 TGACGACACCGCTAGAAAAC 58.225 50.000 0.00 0.00 39.95 2.43
2753 2765 1.066136 GACGACACCGCTAGAAAACC 58.934 55.000 0.00 0.00 39.95 3.27
2754 2766 0.677842 ACGACACCGCTAGAAAACCT 59.322 50.000 0.00 0.00 39.95 3.50
2755 2767 1.068474 CGACACCGCTAGAAAACCTG 58.932 55.000 0.00 0.00 0.00 4.00
2756 2768 1.439679 GACACCGCTAGAAAACCTGG 58.560 55.000 0.00 0.00 0.00 4.45
2757 2769 0.605589 ACACCGCTAGAAAACCTGGC 60.606 55.000 0.00 0.00 44.84 4.85
2758 2770 1.002502 ACCGCTAGAAAACCTGGCC 60.003 57.895 0.00 0.00 45.42 5.36
2759 2771 1.299976 CCGCTAGAAAACCTGGCCT 59.700 57.895 3.32 0.00 45.42 5.19
2760 2772 0.322546 CCGCTAGAAAACCTGGCCTT 60.323 55.000 3.32 0.00 45.42 4.35
2761 2773 0.804989 CGCTAGAAAACCTGGCCTTG 59.195 55.000 3.32 0.00 45.42 3.61
2762 2774 1.882352 CGCTAGAAAACCTGGCCTTGT 60.882 52.381 3.32 0.00 45.42 3.16
2763 2775 2.239400 GCTAGAAAACCTGGCCTTGTT 58.761 47.619 3.32 4.24 42.80 2.83
2764 2776 2.229062 GCTAGAAAACCTGGCCTTGTTC 59.771 50.000 3.32 0.00 42.80 3.18
2765 2777 2.755952 AGAAAACCTGGCCTTGTTCT 57.244 45.000 3.32 1.52 0.00 3.01
2766 2778 3.876309 AGAAAACCTGGCCTTGTTCTA 57.124 42.857 3.32 0.00 0.00 2.10
2767 2779 3.756117 AGAAAACCTGGCCTTGTTCTAG 58.244 45.455 3.32 0.00 0.00 2.43
2768 2780 1.911057 AAACCTGGCCTTGTTCTAGC 58.089 50.000 3.32 0.00 0.00 3.42
2769 2781 1.068121 AACCTGGCCTTGTTCTAGCT 58.932 50.000 3.32 0.00 0.00 3.32
2770 2782 0.326264 ACCTGGCCTTGTTCTAGCTG 59.674 55.000 3.32 0.00 0.00 4.24
2771 2783 1.028868 CCTGGCCTTGTTCTAGCTGC 61.029 60.000 3.32 0.00 0.00 5.25
2772 2784 0.035630 CTGGCCTTGTTCTAGCTGCT 60.036 55.000 7.57 7.57 0.00 4.24
2773 2785 0.036010 TGGCCTTGTTCTAGCTGCTC 60.036 55.000 4.91 0.00 0.00 4.26
2774 2786 0.036010 GGCCTTGTTCTAGCTGCTCA 60.036 55.000 4.91 0.00 0.00 4.26
2775 2787 1.367659 GCCTTGTTCTAGCTGCTCAG 58.632 55.000 4.91 2.57 0.00 3.35
2785 2797 2.817424 CTGCTCAGCTGGCGGATA 59.183 61.111 23.84 7.26 38.23 2.59
2786 2798 1.144716 CTGCTCAGCTGGCGGATAA 59.855 57.895 23.84 6.96 38.23 1.75
2787 2799 0.879400 CTGCTCAGCTGGCGGATAAG 60.879 60.000 23.84 10.35 38.23 1.73
2788 2800 1.144936 GCTCAGCTGGCGGATAAGT 59.855 57.895 15.13 0.00 0.00 2.24
2789 2801 0.462759 GCTCAGCTGGCGGATAAGTT 60.463 55.000 15.13 0.00 0.00 2.66
2790 2802 1.293924 CTCAGCTGGCGGATAAGTTG 58.706 55.000 15.13 0.00 0.00 3.16
2791 2803 0.744414 TCAGCTGGCGGATAAGTTGC 60.744 55.000 15.13 0.00 0.00 4.17
2792 2804 0.745845 CAGCTGGCGGATAAGTTGCT 60.746 55.000 5.57 0.00 0.00 3.91
2793 2805 0.830648 AGCTGGCGGATAAGTTGCTA 59.169 50.000 0.00 0.00 0.00 3.49
2794 2806 1.202580 AGCTGGCGGATAAGTTGCTAG 60.203 52.381 0.00 0.00 39.84 3.42
2795 2807 1.221414 CTGGCGGATAAGTTGCTAGC 58.779 55.000 8.10 8.10 30.45 3.42
2796 2808 0.179056 TGGCGGATAAGTTGCTAGCC 60.179 55.000 13.29 0.00 43.05 3.93
2797 2809 0.179056 GGCGGATAAGTTGCTAGCCA 60.179 55.000 13.29 0.00 42.37 4.75
2798 2810 1.663695 GCGGATAAGTTGCTAGCCAA 58.336 50.000 13.29 3.82 0.00 4.52
2799 2811 1.599542 GCGGATAAGTTGCTAGCCAAG 59.400 52.381 13.29 0.00 33.21 3.61
2800 2812 2.213499 CGGATAAGTTGCTAGCCAAGG 58.787 52.381 13.29 0.00 33.21 3.61
2801 2813 2.158957 CGGATAAGTTGCTAGCCAAGGA 60.159 50.000 13.29 0.00 33.21 3.36
2802 2814 3.471680 GGATAAGTTGCTAGCCAAGGAG 58.528 50.000 13.29 0.00 33.21 3.69
2803 2815 3.134804 GGATAAGTTGCTAGCCAAGGAGA 59.865 47.826 13.29 0.00 33.21 3.71
2804 2816 4.202409 GGATAAGTTGCTAGCCAAGGAGAT 60.202 45.833 13.29 0.00 33.21 2.75
2805 2817 2.706339 AGTTGCTAGCCAAGGAGATG 57.294 50.000 13.29 0.00 33.21 2.90
2806 2818 1.211457 AGTTGCTAGCCAAGGAGATGG 59.789 52.381 13.29 0.00 43.70 3.51
2807 2819 1.210478 GTTGCTAGCCAAGGAGATGGA 59.790 52.381 13.29 0.00 43.54 3.41
2808 2820 1.126488 TGCTAGCCAAGGAGATGGAG 58.874 55.000 13.29 0.00 43.54 3.86
2809 2821 1.343377 TGCTAGCCAAGGAGATGGAGA 60.343 52.381 13.29 0.00 43.54 3.71
2810 2822 1.977129 GCTAGCCAAGGAGATGGAGAT 59.023 52.381 2.29 0.00 43.54 2.75
2811 2823 2.289569 GCTAGCCAAGGAGATGGAGATG 60.290 54.545 2.29 0.00 43.54 2.90
2812 2824 1.138568 AGCCAAGGAGATGGAGATGG 58.861 55.000 0.00 0.00 43.54 3.51
2813 2825 1.135094 GCCAAGGAGATGGAGATGGA 58.865 55.000 0.00 0.00 43.54 3.41
2814 2826 1.704070 GCCAAGGAGATGGAGATGGAT 59.296 52.381 0.00 0.00 43.54 3.41
2815 2827 2.552591 GCCAAGGAGATGGAGATGGATG 60.553 54.545 0.00 0.00 43.54 3.51
2816 2828 2.709934 CCAAGGAGATGGAGATGGATGT 59.290 50.000 0.00 0.00 43.54 3.06
2817 2829 3.496337 CCAAGGAGATGGAGATGGATGTG 60.496 52.174 0.00 0.00 43.54 3.21
2818 2830 1.698532 AGGAGATGGAGATGGATGTGC 59.301 52.381 0.00 0.00 0.00 4.57
2819 2831 1.271271 GGAGATGGAGATGGATGTGCC 60.271 57.143 0.00 0.00 37.10 5.01
2830 2842 2.934887 TGGATGTGCCAGATATGTTGG 58.065 47.619 0.00 0.00 43.33 3.77
2831 2843 2.509131 TGGATGTGCCAGATATGTTGGA 59.491 45.455 6.97 0.00 43.33 3.53
2832 2844 2.880890 GGATGTGCCAGATATGTTGGAC 59.119 50.000 6.97 0.00 37.96 4.02
2833 2845 2.022764 TGTGCCAGATATGTTGGACG 57.977 50.000 6.97 0.00 37.96 4.79
2834 2846 1.277842 TGTGCCAGATATGTTGGACGT 59.722 47.619 6.97 0.00 37.96 4.34
2835 2847 1.933853 GTGCCAGATATGTTGGACGTC 59.066 52.381 7.13 7.13 37.96 4.34
2836 2848 1.552792 TGCCAGATATGTTGGACGTCA 59.447 47.619 18.91 0.27 37.96 4.35
2837 2849 2.170397 TGCCAGATATGTTGGACGTCAT 59.830 45.455 18.91 5.25 37.96 3.06
2838 2850 2.802816 GCCAGATATGTTGGACGTCATC 59.197 50.000 18.91 10.35 37.96 2.92
2847 2859 3.442996 GGACGTCATCCTTGGAGTG 57.557 57.895 18.91 0.00 45.22 3.51
2848 2860 0.608640 GGACGTCATCCTTGGAGTGT 59.391 55.000 18.91 0.00 45.22 3.55
2849 2861 1.673033 GGACGTCATCCTTGGAGTGTG 60.673 57.143 18.91 0.00 45.22 3.82
2850 2862 0.321671 ACGTCATCCTTGGAGTGTGG 59.678 55.000 0.00 0.00 0.00 4.17
2851 2863 0.391661 CGTCATCCTTGGAGTGTGGG 60.392 60.000 0.00 0.00 0.00 4.61
2852 2864 0.693049 GTCATCCTTGGAGTGTGGGT 59.307 55.000 0.00 0.00 0.00 4.51
2853 2865 0.692476 TCATCCTTGGAGTGTGGGTG 59.308 55.000 0.00 0.00 33.51 4.61
2854 2866 0.322816 CATCCTTGGAGTGTGGGTGG 60.323 60.000 0.00 0.00 0.00 4.61
2855 2867 0.475632 ATCCTTGGAGTGTGGGTGGA 60.476 55.000 0.00 0.00 0.00 4.02
2856 2868 1.127567 TCCTTGGAGTGTGGGTGGAG 61.128 60.000 0.00 0.00 0.00 3.86
2857 2869 1.127567 CCTTGGAGTGTGGGTGGAGA 61.128 60.000 0.00 0.00 0.00 3.71
2858 2870 0.987294 CTTGGAGTGTGGGTGGAGAT 59.013 55.000 0.00 0.00 0.00 2.75
2859 2871 0.692476 TTGGAGTGTGGGTGGAGATG 59.308 55.000 0.00 0.00 0.00 2.90
2860 2872 1.078143 GGAGTGTGGGTGGAGATGC 60.078 63.158 0.00 0.00 0.00 3.91
2861 2873 1.557269 GGAGTGTGGGTGGAGATGCT 61.557 60.000 0.00 0.00 0.00 3.79
2862 2874 1.195115 GAGTGTGGGTGGAGATGCTA 58.805 55.000 0.00 0.00 0.00 3.49
2863 2875 1.765314 GAGTGTGGGTGGAGATGCTAT 59.235 52.381 0.00 0.00 0.00 2.97
2864 2876 1.487976 AGTGTGGGTGGAGATGCTATG 59.512 52.381 0.00 0.00 0.00 2.23
2865 2877 0.181114 TGTGGGTGGAGATGCTATGC 59.819 55.000 0.00 0.00 0.00 3.14
2866 2878 0.471617 GTGGGTGGAGATGCTATGCT 59.528 55.000 0.00 0.00 0.00 3.79
2867 2879 1.694150 GTGGGTGGAGATGCTATGCTA 59.306 52.381 0.00 0.00 0.00 3.49
2868 2880 1.694150 TGGGTGGAGATGCTATGCTAC 59.306 52.381 0.00 0.00 0.00 3.58
2869 2881 1.337260 GGGTGGAGATGCTATGCTACG 60.337 57.143 0.00 0.00 0.00 3.51
2870 2882 1.423395 GTGGAGATGCTATGCTACGC 58.577 55.000 0.00 0.00 0.00 4.42
2871 2883 1.039856 TGGAGATGCTATGCTACGCA 58.960 50.000 0.00 0.00 44.86 5.24
2872 2884 1.000171 TGGAGATGCTATGCTACGCAG 60.000 52.381 0.00 0.00 43.65 5.18
2881 2893 2.511600 GCTACGCAGCCAACCGAT 60.512 61.111 0.00 0.00 42.37 4.18
2882 2894 2.813179 GCTACGCAGCCAACCGATG 61.813 63.158 0.00 0.00 42.37 3.84
2883 2895 1.447838 CTACGCAGCCAACCGATGT 60.448 57.895 0.00 0.00 0.00 3.06
2884 2896 0.179121 CTACGCAGCCAACCGATGTA 60.179 55.000 0.00 0.00 0.00 2.29
2885 2897 0.179121 TACGCAGCCAACCGATGTAG 60.179 55.000 0.00 0.00 0.00 2.74
2886 2898 2.813179 CGCAGCCAACCGATGTAGC 61.813 63.158 0.00 0.00 0.00 3.58
2887 2899 1.745115 GCAGCCAACCGATGTAGCA 60.745 57.895 0.00 0.00 0.00 3.49
2888 2900 1.305219 GCAGCCAACCGATGTAGCAA 61.305 55.000 0.00 0.00 0.00 3.91
2889 2901 0.729116 CAGCCAACCGATGTAGCAAG 59.271 55.000 0.00 0.00 0.00 4.01
2890 2902 0.392998 AGCCAACCGATGTAGCAAGG 60.393 55.000 0.00 0.00 0.00 3.61
2891 2903 0.392461 GCCAACCGATGTAGCAAGGA 60.392 55.000 0.00 0.00 0.00 3.36
2892 2904 1.747206 GCCAACCGATGTAGCAAGGAT 60.747 52.381 0.00 0.00 0.00 3.24
2893 2905 1.942657 CCAACCGATGTAGCAAGGATG 59.057 52.381 0.00 0.00 0.00 3.51
2903 2915 3.136123 CAAGGATGCCCACGCCAG 61.136 66.667 0.00 0.00 33.88 4.85
2904 2916 4.431131 AAGGATGCCCACGCCAGG 62.431 66.667 0.00 0.00 33.88 4.45
2913 2925 3.730761 CACGCCAGGCAGCTCAAC 61.731 66.667 13.30 0.00 0.00 3.18
2914 2926 4.254709 ACGCCAGGCAGCTCAACA 62.255 61.111 13.30 0.00 0.00 3.33
2915 2927 3.429141 CGCCAGGCAGCTCAACAG 61.429 66.667 13.30 0.00 0.00 3.16
2937 2949 3.782042 GGCGAGTTGACGACCATC 58.218 61.111 0.00 0.00 35.00 3.51
2938 2950 2.158959 GGCGAGTTGACGACCATCG 61.159 63.158 0.00 0.00 46.93 3.84
2951 2963 3.056628 CCATCGTCTGGCTTCTCAC 57.943 57.895 0.00 0.00 38.47 3.51
2952 2964 0.247460 CCATCGTCTGGCTTCTCACA 59.753 55.000 0.00 0.00 38.47 3.58
2953 2965 1.638133 CATCGTCTGGCTTCTCACAG 58.362 55.000 0.00 0.00 36.07 3.66
2954 2966 1.203287 CATCGTCTGGCTTCTCACAGA 59.797 52.381 0.00 0.00 41.13 3.41
2955 2967 1.328279 TCGTCTGGCTTCTCACAGAA 58.672 50.000 0.00 0.00 44.53 3.02
2956 2968 1.000163 TCGTCTGGCTTCTCACAGAAC 60.000 52.381 0.00 0.00 44.53 3.01
2957 2969 1.269778 CGTCTGGCTTCTCACAGAACA 60.270 52.381 0.00 0.00 44.53 3.18
2958 2970 2.611473 CGTCTGGCTTCTCACAGAACAT 60.611 50.000 0.00 0.00 44.53 2.71
2959 2971 2.740981 GTCTGGCTTCTCACAGAACATG 59.259 50.000 0.00 0.00 44.53 3.21
2960 2972 1.467734 CTGGCTTCTCACAGAACATGC 59.532 52.381 0.00 0.00 36.86 4.06
2961 2973 1.072806 TGGCTTCTCACAGAACATGCT 59.927 47.619 0.00 0.00 29.89 3.79
2962 2974 1.467734 GGCTTCTCACAGAACATGCTG 59.532 52.381 0.00 0.00 41.63 4.41
2963 2975 1.135746 GCTTCTCACAGAACATGCTGC 60.136 52.381 0.00 0.00 39.51 5.25
2964 2976 1.467734 CTTCTCACAGAACATGCTGCC 59.532 52.381 0.00 0.00 39.51 4.85
2965 2977 0.321919 TCTCACAGAACATGCTGCCC 60.322 55.000 0.00 0.00 39.51 5.36
2966 2978 0.322277 CTCACAGAACATGCTGCCCT 60.322 55.000 0.00 0.00 39.51 5.19
2967 2979 0.111061 TCACAGAACATGCTGCCCTT 59.889 50.000 0.00 0.00 39.51 3.95
2968 2980 0.963962 CACAGAACATGCTGCCCTTT 59.036 50.000 0.00 0.00 39.51 3.11
2969 2981 1.342174 CACAGAACATGCTGCCCTTTT 59.658 47.619 0.00 0.00 39.51 2.27
2970 2982 1.615392 ACAGAACATGCTGCCCTTTTC 59.385 47.619 0.00 0.00 39.51 2.29
2971 2983 1.067354 CAGAACATGCTGCCCTTTTCC 60.067 52.381 0.00 0.00 0.00 3.13
2972 2984 0.247460 GAACATGCTGCCCTTTTCCC 59.753 55.000 0.00 0.00 0.00 3.97
2973 2985 0.178924 AACATGCTGCCCTTTTCCCT 60.179 50.000 0.00 0.00 0.00 4.20
2974 2986 0.901580 ACATGCTGCCCTTTTCCCTG 60.902 55.000 0.00 0.00 0.00 4.45
2975 2987 0.901580 CATGCTGCCCTTTTCCCTGT 60.902 55.000 0.00 0.00 0.00 4.00
2976 2988 0.613012 ATGCTGCCCTTTTCCCTGTC 60.613 55.000 0.00 0.00 0.00 3.51
2977 2989 2.335712 GCTGCCCTTTTCCCTGTCG 61.336 63.158 0.00 0.00 0.00 4.35
2978 2990 1.374947 CTGCCCTTTTCCCTGTCGA 59.625 57.895 0.00 0.00 0.00 4.20
2979 2991 0.955919 CTGCCCTTTTCCCTGTCGAC 60.956 60.000 9.11 9.11 0.00 4.20
2980 2992 2.033194 GCCCTTTTCCCTGTCGACG 61.033 63.158 11.62 5.76 0.00 5.12
2981 2993 1.669440 CCCTTTTCCCTGTCGACGA 59.331 57.895 11.62 0.00 0.00 4.20
2982 2994 0.034337 CCCTTTTCCCTGTCGACGAA 59.966 55.000 11.62 5.67 0.00 3.85
2983 2995 1.338769 CCCTTTTCCCTGTCGACGAAT 60.339 52.381 11.62 0.00 0.00 3.34
2984 2996 2.000447 CCTTTTCCCTGTCGACGAATC 59.000 52.381 11.62 0.00 0.00 2.52
2985 2997 2.353803 CCTTTTCCCTGTCGACGAATCT 60.354 50.000 11.62 0.00 0.00 2.40
2986 2998 2.649331 TTTCCCTGTCGACGAATCTC 57.351 50.000 11.62 0.00 0.00 2.75
2987 2999 0.450583 TTCCCTGTCGACGAATCTCG 59.549 55.000 11.62 0.00 46.93 4.04
2988 3000 1.586564 CCCTGTCGACGAATCTCGC 60.587 63.158 11.62 0.00 45.12 5.03
2989 3001 1.136774 CCTGTCGACGAATCTCGCA 59.863 57.895 11.62 0.00 45.12 5.10
2990 3002 0.456142 CCTGTCGACGAATCTCGCAA 60.456 55.000 11.62 0.00 45.12 4.85
2991 3003 1.550065 CTGTCGACGAATCTCGCAAT 58.450 50.000 11.62 0.00 45.12 3.56
2992 3004 1.920574 CTGTCGACGAATCTCGCAATT 59.079 47.619 11.62 0.00 45.12 2.32
2993 3005 1.653609 TGTCGACGAATCTCGCAATTG 59.346 47.619 11.62 0.00 45.12 2.32
2994 3006 1.654105 GTCGACGAATCTCGCAATTGT 59.346 47.619 7.40 0.00 45.12 2.71
2995 3007 1.653609 TCGACGAATCTCGCAATTGTG 59.346 47.619 12.92 12.92 45.12 3.33
2996 3008 1.802839 GACGAATCTCGCAATTGTGC 58.197 50.000 14.26 0.00 45.12 4.57
3009 3021 5.772825 GCAATTGTGCCCTGATAGAATAA 57.227 39.130 7.40 0.00 45.68 1.40
3010 3022 5.766222 GCAATTGTGCCCTGATAGAATAAG 58.234 41.667 7.40 0.00 45.68 1.73
3011 3023 5.766222 CAATTGTGCCCTGATAGAATAAGC 58.234 41.667 0.00 0.00 0.00 3.09
3012 3024 4.778213 TTGTGCCCTGATAGAATAAGCT 57.222 40.909 0.00 0.00 0.00 3.74
3013 3025 5.887214 TTGTGCCCTGATAGAATAAGCTA 57.113 39.130 0.00 0.00 0.00 3.32
3014 3026 5.887214 TGTGCCCTGATAGAATAAGCTAA 57.113 39.130 0.00 0.00 0.00 3.09
3015 3027 6.247229 TGTGCCCTGATAGAATAAGCTAAA 57.753 37.500 0.00 0.00 0.00 1.85
3016 3028 6.055588 TGTGCCCTGATAGAATAAGCTAAAC 58.944 40.000 0.00 0.00 0.00 2.01
3017 3029 6.055588 GTGCCCTGATAGAATAAGCTAAACA 58.944 40.000 0.00 0.00 0.00 2.83
3018 3030 6.712547 GTGCCCTGATAGAATAAGCTAAACAT 59.287 38.462 0.00 0.00 0.00 2.71
3019 3031 6.712095 TGCCCTGATAGAATAAGCTAAACATG 59.288 38.462 0.00 0.00 0.00 3.21
3020 3032 6.712547 GCCCTGATAGAATAAGCTAAACATGT 59.287 38.462 0.00 0.00 0.00 3.21
3021 3033 7.095017 GCCCTGATAGAATAAGCTAAACATGTC 60.095 40.741 0.00 0.00 0.00 3.06
3022 3034 8.153550 CCCTGATAGAATAAGCTAAACATGTCT 58.846 37.037 0.00 0.00 0.00 3.41
3025 3037 9.982651 TGATAGAATAAGCTAAACATGTCTACC 57.017 33.333 0.00 0.00 0.00 3.18
3026 3038 9.982651 GATAGAATAAGCTAAACATGTCTACCA 57.017 33.333 0.00 0.00 0.00 3.25
3028 3040 8.723942 AGAATAAGCTAAACATGTCTACCAAG 57.276 34.615 0.00 0.00 0.00 3.61
3029 3041 8.322091 AGAATAAGCTAAACATGTCTACCAAGT 58.678 33.333 0.00 0.00 0.00 3.16
3030 3042 8.863872 AATAAGCTAAACATGTCTACCAAGTT 57.136 30.769 0.00 0.00 36.59 2.66
3031 3043 8.863872 ATAAGCTAAACATGTCTACCAAGTTT 57.136 30.769 0.00 0.00 44.59 2.66
3032 3044 9.953565 ATAAGCTAAACATGTCTACCAAGTTTA 57.046 29.630 0.00 0.64 41.71 2.01
3033 3045 7.668525 AGCTAAACATGTCTACCAAGTTTAC 57.331 36.000 0.00 0.00 41.71 2.01
3034 3046 6.653740 AGCTAAACATGTCTACCAAGTTTACC 59.346 38.462 0.00 0.00 41.71 2.85
3035 3047 6.128090 GCTAAACATGTCTACCAAGTTTACCC 60.128 42.308 0.00 0.00 41.71 3.69
3036 3048 4.296621 ACATGTCTACCAAGTTTACCCC 57.703 45.455 0.00 0.00 0.00 4.95
3037 3049 3.914435 ACATGTCTACCAAGTTTACCCCT 59.086 43.478 0.00 0.00 0.00 4.79
3038 3050 5.095809 ACATGTCTACCAAGTTTACCCCTA 58.904 41.667 0.00 0.00 0.00 3.53
3039 3051 5.729718 ACATGTCTACCAAGTTTACCCCTAT 59.270 40.000 0.00 0.00 0.00 2.57
3040 3052 6.216868 ACATGTCTACCAAGTTTACCCCTATT 59.783 38.462 0.00 0.00 0.00 1.73
3041 3053 6.707273 TGTCTACCAAGTTTACCCCTATTT 57.293 37.500 0.00 0.00 0.00 1.40
3042 3054 7.811482 TGTCTACCAAGTTTACCCCTATTTA 57.189 36.000 0.00 0.00 0.00 1.40
3043 3055 8.217188 TGTCTACCAAGTTTACCCCTATTTAA 57.783 34.615 0.00 0.00 0.00 1.52
3044 3056 8.838741 TGTCTACCAAGTTTACCCCTATTTAAT 58.161 33.333 0.00 0.00 0.00 1.40
3045 3057 9.690913 GTCTACCAAGTTTACCCCTATTTAATT 57.309 33.333 0.00 0.00 0.00 1.40
3049 3061 9.825706 ACCAAGTTTACCCCTATTTAATTTACA 57.174 29.630 0.00 0.00 0.00 2.41
3051 3063 9.777575 CAAGTTTACCCCTATTTAATTTACACG 57.222 33.333 0.00 0.00 0.00 4.49
3052 3064 7.988737 AGTTTACCCCTATTTAATTTACACGC 58.011 34.615 0.00 0.00 0.00 5.34
3053 3065 7.830697 AGTTTACCCCTATTTAATTTACACGCT 59.169 33.333 0.00 0.00 0.00 5.07
3054 3066 9.108284 GTTTACCCCTATTTAATTTACACGCTA 57.892 33.333 0.00 0.00 0.00 4.26
3055 3067 9.678260 TTTACCCCTATTTAATTTACACGCTAA 57.322 29.630 0.00 0.00 0.00 3.09
3056 3068 9.850198 TTACCCCTATTTAATTTACACGCTAAT 57.150 29.630 0.00 0.00 0.00 1.73
3058 3070 9.498176 ACCCCTATTTAATTTACACGCTAATAG 57.502 33.333 0.00 0.00 0.00 1.73
3059 3071 8.448615 CCCCTATTTAATTTACACGCTAATAGC 58.551 37.037 1.41 1.41 38.02 2.97
3060 3072 8.995220 CCCTATTTAATTTACACGCTAATAGCA 58.005 33.333 13.15 0.00 42.58 3.49
3064 3076 7.612668 TTAATTTACACGCTAATAGCAACCA 57.387 32.000 13.15 0.00 42.58 3.67
3065 3077 5.734855 ATTTACACGCTAATAGCAACCAG 57.265 39.130 13.15 0.00 42.58 4.00
3066 3078 2.762535 ACACGCTAATAGCAACCAGT 57.237 45.000 13.15 0.00 42.58 4.00
3067 3079 3.053831 ACACGCTAATAGCAACCAGTT 57.946 42.857 13.15 0.00 42.58 3.16
3068 3080 2.742053 ACACGCTAATAGCAACCAGTTG 59.258 45.455 13.15 6.15 42.58 3.16
3069 3081 2.742053 CACGCTAATAGCAACCAGTTGT 59.258 45.455 13.15 0.00 42.58 3.32
3070 3082 3.930229 CACGCTAATAGCAACCAGTTGTA 59.070 43.478 13.15 4.36 42.58 2.41
3071 3083 3.930848 ACGCTAATAGCAACCAGTTGTAC 59.069 43.478 13.15 0.00 42.58 2.90
3072 3084 4.181578 CGCTAATAGCAACCAGTTGTACT 58.818 43.478 13.15 4.50 42.58 2.73
3073 3085 4.630069 CGCTAATAGCAACCAGTTGTACTT 59.370 41.667 13.15 5.84 42.58 2.24
3074 3086 5.121768 CGCTAATAGCAACCAGTTGTACTTT 59.878 40.000 13.15 4.51 42.58 2.66
3075 3087 6.311935 CGCTAATAGCAACCAGTTGTACTTTA 59.688 38.462 13.15 5.27 42.58 1.85
3076 3088 7.011109 CGCTAATAGCAACCAGTTGTACTTTAT 59.989 37.037 13.15 1.68 42.58 1.40
3077 3089 8.122952 GCTAATAGCAACCAGTTGTACTTTATG 58.877 37.037 7.49 0.00 41.89 1.90
3078 3090 7.996098 AATAGCAACCAGTTGTACTTTATGT 57.004 32.000 11.88 0.00 42.31 2.29
3080 3092 9.681062 AATAGCAACCAGTTGTACTTTATGTAT 57.319 29.630 11.88 0.00 42.31 2.29
3082 3094 8.718102 AGCAACCAGTTGTACTTTATGTATAG 57.282 34.615 11.88 0.00 42.31 1.31
3083 3095 8.319146 AGCAACCAGTTGTACTTTATGTATAGT 58.681 33.333 11.88 0.00 42.31 2.12
3084 3096 8.943002 GCAACCAGTTGTACTTTATGTATAGTT 58.057 33.333 11.88 0.00 42.31 2.24
3087 3099 9.871238 ACCAGTTGTACTTTATGTATAGTTCTG 57.129 33.333 0.00 0.00 33.23 3.02
3088 3100 9.871238 CCAGTTGTACTTTATGTATAGTTCTGT 57.129 33.333 0.00 0.00 33.23 3.41
3105 3117 7.440523 AGTTCTGTTTTTGATGAGTATCCAC 57.559 36.000 0.00 0.00 32.09 4.02
3106 3118 6.998074 AGTTCTGTTTTTGATGAGTATCCACA 59.002 34.615 0.00 0.00 32.09 4.17
3107 3119 6.801539 TCTGTTTTTGATGAGTATCCACAC 57.198 37.500 0.00 0.00 32.09 3.82
3108 3120 6.533730 TCTGTTTTTGATGAGTATCCACACT 58.466 36.000 0.00 0.00 32.09 3.55
3109 3121 6.427853 TCTGTTTTTGATGAGTATCCACACTG 59.572 38.462 0.00 0.00 32.09 3.66
3110 3122 5.473162 TGTTTTTGATGAGTATCCACACTGG 59.527 40.000 0.00 0.00 39.43 4.00
3111 3123 4.908601 TTTGATGAGTATCCACACTGGT 57.091 40.909 0.00 0.00 39.03 4.00
3112 3124 4.908601 TTGATGAGTATCCACACTGGTT 57.091 40.909 0.00 0.00 39.03 3.67
3113 3125 4.908601 TGATGAGTATCCACACTGGTTT 57.091 40.909 0.00 0.00 39.03 3.27
3114 3126 6.367374 TTGATGAGTATCCACACTGGTTTA 57.633 37.500 0.00 0.00 39.03 2.01
3115 3127 6.560003 TGATGAGTATCCACACTGGTTTAT 57.440 37.500 0.00 0.00 39.03 1.40
3116 3128 6.348498 TGATGAGTATCCACACTGGTTTATG 58.652 40.000 0.00 0.00 39.03 1.90
3117 3129 5.755409 TGAGTATCCACACTGGTTTATGT 57.245 39.130 0.00 0.00 39.03 2.29
3118 3130 5.487433 TGAGTATCCACACTGGTTTATGTG 58.513 41.667 0.00 0.00 44.79 3.21
3128 3140 6.913170 ACACTGGTTTATGTGAATAAGCTTG 58.087 36.000 9.86 0.00 37.59 4.01
3129 3141 6.714810 ACACTGGTTTATGTGAATAAGCTTGA 59.285 34.615 9.86 0.00 37.59 3.02
3130 3142 7.094634 ACACTGGTTTATGTGAATAAGCTTGAG 60.095 37.037 9.86 0.00 37.59 3.02
3131 3143 7.119699 CACTGGTTTATGTGAATAAGCTTGAGA 59.880 37.037 9.86 0.00 36.38 3.27
3132 3144 7.665559 ACTGGTTTATGTGAATAAGCTTGAGAA 59.334 33.333 9.86 0.00 0.00 2.87
3133 3145 8.579850 TGGTTTATGTGAATAAGCTTGAGAAT 57.420 30.769 9.86 0.00 0.00 2.40
3134 3146 9.023962 TGGTTTATGTGAATAAGCTTGAGAATT 57.976 29.630 9.86 0.00 0.00 2.17
3158 3170 9.984190 ATTACTTTATTAAGTCTGGTAGCTAGC 57.016 33.333 16.08 16.08 43.45 3.42
3159 3171 7.663043 ACTTTATTAAGTCTGGTAGCTAGCT 57.337 36.000 23.12 23.12 40.60 3.32
3160 3172 8.763984 ACTTTATTAAGTCTGGTAGCTAGCTA 57.236 34.615 20.67 20.67 40.60 3.32
3161 3173 8.852135 ACTTTATTAAGTCTGGTAGCTAGCTAG 58.148 37.037 24.78 16.84 40.60 3.42
3176 3188 1.446907 GCTAGCAGCTGTGTGAATGT 58.553 50.000 16.64 0.00 38.45 2.71
3177 3189 1.129998 GCTAGCAGCTGTGTGAATGTG 59.870 52.381 16.64 0.00 38.45 3.21
3178 3190 2.691927 CTAGCAGCTGTGTGAATGTGA 58.308 47.619 16.64 0.00 0.00 3.58
3179 3191 1.520494 AGCAGCTGTGTGAATGTGAG 58.480 50.000 16.64 0.00 0.00 3.51
3180 3192 0.520404 GCAGCTGTGTGAATGTGAGG 59.480 55.000 16.64 0.00 0.00 3.86
3181 3193 1.162698 CAGCTGTGTGAATGTGAGGG 58.837 55.000 5.25 0.00 0.00 4.30
3182 3194 1.059098 AGCTGTGTGAATGTGAGGGA 58.941 50.000 0.00 0.00 0.00 4.20
3183 3195 1.421268 AGCTGTGTGAATGTGAGGGAA 59.579 47.619 0.00 0.00 0.00 3.97
3184 3196 1.808945 GCTGTGTGAATGTGAGGGAAG 59.191 52.381 0.00 0.00 0.00 3.46
3185 3197 1.808945 CTGTGTGAATGTGAGGGAAGC 59.191 52.381 0.00 0.00 0.00 3.86
3186 3198 0.798776 GTGTGAATGTGAGGGAAGCG 59.201 55.000 0.00 0.00 0.00 4.68
3187 3199 0.684535 TGTGAATGTGAGGGAAGCGA 59.315 50.000 0.00 0.00 0.00 4.93
3188 3200 1.278985 TGTGAATGTGAGGGAAGCGAT 59.721 47.619 0.00 0.00 0.00 4.58
3189 3201 2.499693 TGTGAATGTGAGGGAAGCGATA 59.500 45.455 0.00 0.00 0.00 2.92
3190 3202 3.055458 TGTGAATGTGAGGGAAGCGATAA 60.055 43.478 0.00 0.00 0.00 1.75
3191 3203 3.557595 GTGAATGTGAGGGAAGCGATAAG 59.442 47.826 0.00 0.00 0.00 1.73
3207 3219 5.997732 CGATAAGCATGTGGAAAAAGTTG 57.002 39.130 0.00 0.00 0.00 3.16
3208 3220 5.698832 CGATAAGCATGTGGAAAAAGTTGA 58.301 37.500 0.00 0.00 0.00 3.18
3209 3221 5.796935 CGATAAGCATGTGGAAAAAGTTGAG 59.203 40.000 0.00 0.00 0.00 3.02
3210 3222 6.568462 CGATAAGCATGTGGAAAAAGTTGAGT 60.568 38.462 0.00 0.00 0.00 3.41
3211 3223 5.343307 AAGCATGTGGAAAAAGTTGAGTT 57.657 34.783 0.00 0.00 0.00 3.01
3212 3224 4.685924 AGCATGTGGAAAAAGTTGAGTTG 58.314 39.130 0.00 0.00 0.00 3.16
3213 3225 4.160252 AGCATGTGGAAAAAGTTGAGTTGT 59.840 37.500 0.00 0.00 0.00 3.32
3214 3226 4.268405 GCATGTGGAAAAAGTTGAGTTGTG 59.732 41.667 0.00 0.00 0.00 3.33
3215 3227 5.410067 CATGTGGAAAAAGTTGAGTTGTGT 58.590 37.500 0.00 0.00 0.00 3.72
3216 3228 4.804108 TGTGGAAAAAGTTGAGTTGTGTG 58.196 39.130 0.00 0.00 0.00 3.82
3217 3229 4.173256 GTGGAAAAAGTTGAGTTGTGTGG 58.827 43.478 0.00 0.00 0.00 4.17
3218 3230 4.082463 GTGGAAAAAGTTGAGTTGTGTGGA 60.082 41.667 0.00 0.00 0.00 4.02
3219 3231 4.524714 TGGAAAAAGTTGAGTTGTGTGGAA 59.475 37.500 0.00 0.00 0.00 3.53
3220 3232 5.011125 TGGAAAAAGTTGAGTTGTGTGGAAA 59.989 36.000 0.00 0.00 0.00 3.13
3221 3233 5.929415 GGAAAAAGTTGAGTTGTGTGGAAAA 59.071 36.000 0.00 0.00 0.00 2.29
3222 3234 6.425417 GGAAAAAGTTGAGTTGTGTGGAAAAA 59.575 34.615 0.00 0.00 0.00 1.94
3223 3235 6.779115 AAAAGTTGAGTTGTGTGGAAAAAC 57.221 33.333 0.00 0.00 0.00 2.43
3224 3236 5.722021 AAGTTGAGTTGTGTGGAAAAACT 57.278 34.783 0.00 0.00 0.00 2.66
3225 3237 5.059404 AGTTGAGTTGTGTGGAAAAACTG 57.941 39.130 0.00 0.00 0.00 3.16
3226 3238 4.082245 AGTTGAGTTGTGTGGAAAAACTGG 60.082 41.667 0.00 0.00 0.00 4.00
3227 3239 2.165437 TGAGTTGTGTGGAAAAACTGGC 59.835 45.455 0.00 0.00 0.00 4.85
3228 3240 2.427095 GAGTTGTGTGGAAAAACTGGCT 59.573 45.455 0.00 0.00 0.00 4.75
3229 3241 2.427095 AGTTGTGTGGAAAAACTGGCTC 59.573 45.455 0.00 0.00 0.00 4.70
3230 3242 2.136298 TGTGTGGAAAAACTGGCTCA 57.864 45.000 0.00 0.00 0.00 4.26
3231 3243 2.451490 TGTGTGGAAAAACTGGCTCAA 58.549 42.857 0.00 0.00 0.00 3.02
3232 3244 3.030291 TGTGTGGAAAAACTGGCTCAAT 58.970 40.909 0.00 0.00 0.00 2.57
3233 3245 3.068024 TGTGTGGAAAAACTGGCTCAATC 59.932 43.478 0.00 0.00 0.00 2.67
3234 3246 2.627699 TGTGGAAAAACTGGCTCAATCC 59.372 45.455 0.00 0.00 0.00 3.01
3235 3247 2.627699 GTGGAAAAACTGGCTCAATCCA 59.372 45.455 0.00 0.00 33.32 3.41
3236 3248 3.259123 GTGGAAAAACTGGCTCAATCCAT 59.741 43.478 0.00 0.00 37.76 3.41
3237 3249 3.511146 TGGAAAAACTGGCTCAATCCATC 59.489 43.478 0.00 0.00 35.22 3.51
3238 3250 3.766051 GGAAAAACTGGCTCAATCCATCT 59.234 43.478 0.00 0.00 35.22 2.90
3239 3251 4.381292 GGAAAAACTGGCTCAATCCATCTG 60.381 45.833 0.00 0.00 35.22 2.90
3240 3252 1.760192 AACTGGCTCAATCCATCTGC 58.240 50.000 0.00 0.00 35.22 4.26
3241 3253 0.622136 ACTGGCTCAATCCATCTGCA 59.378 50.000 0.00 0.00 35.22 4.41
3242 3254 1.022735 CTGGCTCAATCCATCTGCAC 58.977 55.000 0.00 0.00 35.22 4.57
3243 3255 0.394762 TGGCTCAATCCATCTGCACC 60.395 55.000 0.00 0.00 0.00 5.01
3244 3256 0.394762 GGCTCAATCCATCTGCACCA 60.395 55.000 0.00 0.00 0.00 4.17
3245 3257 0.737219 GCTCAATCCATCTGCACCAC 59.263 55.000 0.00 0.00 0.00 4.16
3246 3258 1.951895 GCTCAATCCATCTGCACCACA 60.952 52.381 0.00 0.00 0.00 4.17
3247 3259 2.439409 CTCAATCCATCTGCACCACAA 58.561 47.619 0.00 0.00 0.00 3.33
3248 3260 2.821378 CTCAATCCATCTGCACCACAAA 59.179 45.455 0.00 0.00 0.00 2.83
3249 3261 3.229293 TCAATCCATCTGCACCACAAAA 58.771 40.909 0.00 0.00 0.00 2.44
3250 3262 3.005684 TCAATCCATCTGCACCACAAAAC 59.994 43.478 0.00 0.00 0.00 2.43
3251 3263 2.064434 TCCATCTGCACCACAAAACA 57.936 45.000 0.00 0.00 0.00 2.83
3252 3264 2.596346 TCCATCTGCACCACAAAACAT 58.404 42.857 0.00 0.00 0.00 2.71
3253 3265 2.296752 TCCATCTGCACCACAAAACATG 59.703 45.455 0.00 0.00 0.00 3.21
3254 3266 2.063266 CATCTGCACCACAAAACATGC 58.937 47.619 0.00 0.00 38.59 4.06
3255 3267 1.109609 TCTGCACCACAAAACATGCA 58.890 45.000 0.00 0.00 45.45 3.96
3256 3268 1.687660 TCTGCACCACAAAACATGCAT 59.312 42.857 0.00 0.00 46.35 3.96
3257 3269 2.102757 TCTGCACCACAAAACATGCATT 59.897 40.909 0.00 0.00 46.35 3.56
3258 3270 2.477375 CTGCACCACAAAACATGCATTC 59.523 45.455 0.00 0.00 46.35 2.67
3259 3271 2.102757 TGCACCACAAAACATGCATTCT 59.897 40.909 0.00 0.00 42.92 2.40
3260 3272 3.132925 GCACCACAAAACATGCATTCTT 58.867 40.909 0.00 0.00 38.00 2.52
3261 3273 3.560896 GCACCACAAAACATGCATTCTTT 59.439 39.130 0.00 0.00 38.00 2.52
3262 3274 4.318974 GCACCACAAAACATGCATTCTTTC 60.319 41.667 0.00 0.00 38.00 2.62
3263 3275 5.051816 CACCACAAAACATGCATTCTTTCT 58.948 37.500 0.00 0.00 0.00 2.52
3264 3276 5.176223 CACCACAAAACATGCATTCTTTCTC 59.824 40.000 0.00 0.00 0.00 2.87
3265 3277 4.383649 CCACAAAACATGCATTCTTTCTCG 59.616 41.667 0.00 0.00 0.00 4.04
3266 3278 5.214417 CACAAAACATGCATTCTTTCTCGA 58.786 37.500 0.00 0.00 0.00 4.04
3267 3279 5.116074 CACAAAACATGCATTCTTTCTCGAC 59.884 40.000 0.00 0.00 0.00 4.20
3268 3280 3.729526 AACATGCATTCTTTCTCGACG 57.270 42.857 0.00 0.00 0.00 5.12
3269 3281 2.959516 ACATGCATTCTTTCTCGACGA 58.040 42.857 0.00 0.00 0.00 4.20
3270 3282 3.325870 ACATGCATTCTTTCTCGACGAA 58.674 40.909 0.00 0.00 0.00 3.85
3271 3283 3.745975 ACATGCATTCTTTCTCGACGAAA 59.254 39.130 0.00 8.92 39.23 3.46
3272 3284 4.213270 ACATGCATTCTTTCTCGACGAAAA 59.787 37.500 0.00 2.42 40.87 2.29
3273 3285 4.389664 TGCATTCTTTCTCGACGAAAAG 57.610 40.909 18.40 18.40 40.87 2.27
3274 3286 3.186409 TGCATTCTTTCTCGACGAAAAGG 59.814 43.478 21.47 8.98 40.87 3.11
3275 3287 3.432252 GCATTCTTTCTCGACGAAAAGGA 59.568 43.478 21.47 17.38 40.87 3.36
3276 3288 4.084013 GCATTCTTTCTCGACGAAAAGGAA 60.084 41.667 21.47 17.10 40.87 3.36
3277 3289 5.560183 GCATTCTTTCTCGACGAAAAGGAAA 60.560 40.000 21.47 16.01 40.87 3.13
3278 3290 6.603095 CATTCTTTCTCGACGAAAAGGAAAT 58.397 36.000 21.47 15.64 40.87 2.17
3279 3291 5.591643 TCTTTCTCGACGAAAAGGAAATG 57.408 39.130 21.47 12.37 40.87 2.32
3280 3292 4.451096 TCTTTCTCGACGAAAAGGAAATGG 59.549 41.667 21.47 9.65 40.87 3.16
3281 3293 2.695359 TCTCGACGAAAAGGAAATGGG 58.305 47.619 0.00 0.00 0.00 4.00
3282 3294 1.130561 CTCGACGAAAAGGAAATGGGC 59.869 52.381 0.00 0.00 0.00 5.36
3283 3295 0.179200 CGACGAAAAGGAAATGGGCG 60.179 55.000 0.00 0.00 0.00 6.13
3284 3296 0.879090 GACGAAAAGGAAATGGGCGT 59.121 50.000 0.00 0.00 0.00 5.68
3285 3297 2.078392 GACGAAAAGGAAATGGGCGTA 58.922 47.619 0.00 0.00 0.00 4.42
3286 3298 2.485038 GACGAAAAGGAAATGGGCGTAA 59.515 45.455 0.00 0.00 0.00 3.18
3287 3299 2.885894 ACGAAAAGGAAATGGGCGTAAA 59.114 40.909 0.00 0.00 0.00 2.01
3288 3300 3.508402 ACGAAAAGGAAATGGGCGTAAAT 59.492 39.130 0.00 0.00 0.00 1.40
3289 3301 4.102649 CGAAAAGGAAATGGGCGTAAATC 58.897 43.478 0.00 0.00 0.00 2.17
3290 3302 4.380023 CGAAAAGGAAATGGGCGTAAATCA 60.380 41.667 0.00 0.00 0.00 2.57
3291 3303 5.660460 GAAAAGGAAATGGGCGTAAATCAT 58.340 37.500 0.00 0.00 0.00 2.45
3292 3304 4.654091 AAGGAAATGGGCGTAAATCATG 57.346 40.909 0.00 0.00 0.00 3.07
3293 3305 2.958355 AGGAAATGGGCGTAAATCATGG 59.042 45.455 0.00 0.00 0.00 3.66
3294 3306 2.955660 GGAAATGGGCGTAAATCATGGA 59.044 45.455 0.00 0.00 0.00 3.41
3295 3307 3.573967 GGAAATGGGCGTAAATCATGGAT 59.426 43.478 0.00 0.00 0.00 3.41
3296 3308 4.549458 GAAATGGGCGTAAATCATGGATG 58.451 43.478 0.00 0.00 0.00 3.51
3297 3309 1.979855 TGGGCGTAAATCATGGATGG 58.020 50.000 0.00 0.00 0.00 3.51
3298 3310 1.492599 TGGGCGTAAATCATGGATGGA 59.507 47.619 0.00 0.00 0.00 3.41
3299 3311 2.092158 TGGGCGTAAATCATGGATGGAA 60.092 45.455 0.00 0.00 0.00 3.53
3300 3312 2.554032 GGGCGTAAATCATGGATGGAAG 59.446 50.000 0.00 0.00 0.00 3.46
3301 3313 2.030805 GGCGTAAATCATGGATGGAAGC 60.031 50.000 0.00 0.00 0.00 3.86
3302 3314 2.880890 GCGTAAATCATGGATGGAAGCT 59.119 45.455 0.00 0.00 0.00 3.74
3303 3315 4.065088 GCGTAAATCATGGATGGAAGCTA 58.935 43.478 0.00 0.00 0.00 3.32
3304 3316 4.083802 GCGTAAATCATGGATGGAAGCTAC 60.084 45.833 0.00 0.00 0.00 3.58
3305 3317 5.056480 CGTAAATCATGGATGGAAGCTACA 58.944 41.667 0.00 0.00 0.00 2.74
3306 3318 5.178252 CGTAAATCATGGATGGAAGCTACAG 59.822 44.000 0.00 0.00 0.00 2.74
3307 3319 2.627515 TCATGGATGGAAGCTACAGC 57.372 50.000 0.00 0.00 42.49 4.40
3308 3320 1.839354 TCATGGATGGAAGCTACAGCA 59.161 47.619 3.70 0.00 45.16 4.41
3309 3321 2.440627 TCATGGATGGAAGCTACAGCAT 59.559 45.455 3.70 0.00 45.16 3.79
3310 3322 2.336945 TGGATGGAAGCTACAGCATG 57.663 50.000 3.70 0.00 45.16 4.06
3311 3323 1.134007 TGGATGGAAGCTACAGCATGG 60.134 52.381 3.70 0.00 43.62 3.66
3312 3324 1.602311 GATGGAAGCTACAGCATGGG 58.398 55.000 3.70 0.00 43.62 4.00
3313 3325 0.466922 ATGGAAGCTACAGCATGGGC 60.467 55.000 3.70 0.00 43.62 5.36
3314 3326 1.825622 GGAAGCTACAGCATGGGCC 60.826 63.158 3.70 0.00 43.62 5.80
3315 3327 1.077501 GAAGCTACAGCATGGGCCA 60.078 57.895 9.61 9.61 43.62 5.36
3316 3328 1.077212 AAGCTACAGCATGGGCCAG 60.077 57.895 13.78 5.44 43.62 4.85
3317 3329 2.517875 GCTACAGCATGGGCCAGG 60.518 66.667 15.10 15.10 43.62 4.45
3318 3330 3.047807 GCTACAGCATGGGCCAGGA 62.048 63.158 24.47 0.00 43.62 3.86
3319 3331 1.609239 CTACAGCATGGGCCAGGAA 59.391 57.895 24.47 2.48 43.62 3.36
3320 3332 0.749454 CTACAGCATGGGCCAGGAAC 60.749 60.000 24.47 4.84 43.62 3.62
3321 3333 2.535485 TACAGCATGGGCCAGGAACG 62.535 60.000 24.47 11.32 43.62 3.95
3322 3334 4.431131 AGCATGGGCCAGGAACGG 62.431 66.667 24.47 3.03 42.56 4.44
3323 3335 4.424711 GCATGGGCCAGGAACGGA 62.425 66.667 24.47 0.00 0.00 4.69
3324 3336 2.597340 CATGGGCCAGGAACGGAT 59.403 61.111 14.11 0.00 0.00 4.18
3325 3337 1.825191 CATGGGCCAGGAACGGATG 60.825 63.158 14.11 0.00 0.00 3.51
3326 3338 3.060614 ATGGGCCAGGAACGGATGG 62.061 63.158 13.78 0.00 39.73 3.51
3327 3339 3.407967 GGGCCAGGAACGGATGGA 61.408 66.667 4.39 0.00 39.02 3.41
3328 3340 2.757124 GGGCCAGGAACGGATGGAT 61.757 63.158 4.39 0.00 39.02 3.41
3329 3341 1.227973 GGCCAGGAACGGATGGATC 60.228 63.158 0.00 0.00 39.02 3.36
3330 3342 1.526887 GCCAGGAACGGATGGATCA 59.473 57.895 0.00 0.00 39.02 2.92
3331 3343 0.109342 GCCAGGAACGGATGGATCAT 59.891 55.000 0.00 0.00 39.02 2.45
3332 3344 1.879796 GCCAGGAACGGATGGATCATC 60.880 57.143 0.00 0.00 39.02 2.92
3333 3345 1.417517 CCAGGAACGGATGGATCATCA 59.582 52.381 9.68 0.00 42.13 3.07
3334 3346 2.039480 CCAGGAACGGATGGATCATCAT 59.961 50.000 9.68 0.00 42.13 2.45
3335 3347 3.072211 CAGGAACGGATGGATCATCATG 58.928 50.000 9.68 4.57 42.13 3.07
3336 3348 1.808945 GGAACGGATGGATCATCATGC 59.191 52.381 9.68 0.00 42.13 4.06
3337 3349 2.497138 GAACGGATGGATCATCATGCA 58.503 47.619 9.68 0.00 42.13 3.96
3338 3350 2.873094 ACGGATGGATCATCATGCAT 57.127 45.000 9.68 0.00 43.41 3.96
3339 3351 2.433436 ACGGATGGATCATCATGCATG 58.567 47.619 21.07 21.07 40.95 4.06
3340 3352 2.224695 ACGGATGGATCATCATGCATGT 60.225 45.455 25.43 10.91 40.95 3.21
3341 3353 2.161609 CGGATGGATCATCATGCATGTG 59.838 50.000 25.43 21.04 40.95 3.21
3342 3354 2.094700 GGATGGATCATCATGCATGTGC 60.095 50.000 25.43 12.55 40.95 4.57
3343 3355 2.556622 GATGGATCATCATGCATGTGCA 59.443 45.455 25.43 17.66 40.95 4.57
3354 3366 3.398694 CATGTGCATGCTCTAGCCT 57.601 52.632 20.33 0.00 41.18 4.58
3355 3367 1.676746 CATGTGCATGCTCTAGCCTT 58.323 50.000 20.33 0.00 41.18 4.35
3356 3368 2.842457 CATGTGCATGCTCTAGCCTTA 58.158 47.619 20.33 0.00 41.18 2.69
3357 3369 3.409570 CATGTGCATGCTCTAGCCTTAT 58.590 45.455 20.33 0.00 41.18 1.73
3358 3370 4.572909 CATGTGCATGCTCTAGCCTTATA 58.427 43.478 20.33 0.00 41.18 0.98
3359 3371 4.263018 TGTGCATGCTCTAGCCTTATAG 57.737 45.455 20.33 0.00 41.18 1.31
3360 3372 2.999355 GTGCATGCTCTAGCCTTATAGC 59.001 50.000 20.33 0.00 41.18 2.97
3361 3373 2.027745 TGCATGCTCTAGCCTTATAGCC 60.028 50.000 20.33 0.00 41.18 3.93
3362 3374 2.679349 GCATGCTCTAGCCTTATAGCCC 60.679 54.545 11.37 0.00 41.18 5.19
3363 3375 2.398754 TGCTCTAGCCTTATAGCCCA 57.601 50.000 0.00 0.00 41.18 5.36
3364 3376 1.971357 TGCTCTAGCCTTATAGCCCAC 59.029 52.381 0.00 0.00 41.18 4.61
3365 3377 2.252714 GCTCTAGCCTTATAGCCCACT 58.747 52.381 0.00 0.00 34.31 4.00
3366 3378 2.028567 GCTCTAGCCTTATAGCCCACTG 60.029 54.545 0.00 0.00 34.31 3.66
3367 3379 2.564947 CTCTAGCCTTATAGCCCACTGG 59.435 54.545 0.00 0.00 0.00 4.00
3368 3380 2.179204 TCTAGCCTTATAGCCCACTGGA 59.821 50.000 0.00 0.00 0.00 3.86
3369 3381 1.132500 AGCCTTATAGCCCACTGGAC 58.868 55.000 0.00 0.00 0.00 4.02
3370 3382 0.108774 GCCTTATAGCCCACTGGACC 59.891 60.000 0.00 0.00 0.00 4.46
3371 3383 1.507140 CCTTATAGCCCACTGGACCA 58.493 55.000 0.00 0.00 0.00 4.02
3372 3384 1.843851 CCTTATAGCCCACTGGACCAA 59.156 52.381 0.00 0.00 0.00 3.67
3373 3385 2.241176 CCTTATAGCCCACTGGACCAAA 59.759 50.000 0.00 0.00 0.00 3.28
3374 3386 3.308832 CCTTATAGCCCACTGGACCAAAA 60.309 47.826 0.00 0.00 0.00 2.44
3375 3387 4.536765 CTTATAGCCCACTGGACCAAAAT 58.463 43.478 0.00 0.00 0.00 1.82
3376 3388 2.214376 TAGCCCACTGGACCAAAATG 57.786 50.000 0.00 0.00 0.00 2.32
3377 3389 1.187567 AGCCCACTGGACCAAAATGC 61.188 55.000 0.00 0.00 0.00 3.56
3378 3390 1.974543 CCCACTGGACCAAAATGCC 59.025 57.895 0.00 0.00 0.00 4.40
3379 3391 0.542702 CCCACTGGACCAAAATGCCT 60.543 55.000 0.00 0.00 0.00 4.75
3380 3392 1.341080 CCACTGGACCAAAATGCCTT 58.659 50.000 0.00 0.00 0.00 4.35
3381 3393 1.273327 CCACTGGACCAAAATGCCTTC 59.727 52.381 0.00 0.00 0.00 3.46
3382 3394 1.273327 CACTGGACCAAAATGCCTTCC 59.727 52.381 0.00 0.00 0.00 3.46
3383 3395 1.133199 ACTGGACCAAAATGCCTTCCA 60.133 47.619 0.00 0.00 35.07 3.53
3384 3396 1.273327 CTGGACCAAAATGCCTTCCAC 59.727 52.381 0.00 0.00 32.79 4.02
3385 3397 0.608130 GGACCAAAATGCCTTCCACC 59.392 55.000 0.00 0.00 0.00 4.61
3386 3398 1.632589 GACCAAAATGCCTTCCACCT 58.367 50.000 0.00 0.00 0.00 4.00
3387 3399 1.546029 GACCAAAATGCCTTCCACCTC 59.454 52.381 0.00 0.00 0.00 3.85
3388 3400 1.133199 ACCAAAATGCCTTCCACCTCA 60.133 47.619 0.00 0.00 0.00 3.86
3389 3401 1.273327 CCAAAATGCCTTCCACCTCAC 59.727 52.381 0.00 0.00 0.00 3.51
3390 3402 2.242043 CAAAATGCCTTCCACCTCACT 58.758 47.619 0.00 0.00 0.00 3.41
3391 3403 1.915141 AAATGCCTTCCACCTCACTG 58.085 50.000 0.00 0.00 0.00 3.66
3392 3404 0.773644 AATGCCTTCCACCTCACTGT 59.226 50.000 0.00 0.00 0.00 3.55
3393 3405 0.773644 ATGCCTTCCACCTCACTGTT 59.226 50.000 0.00 0.00 0.00 3.16
3394 3406 0.179020 TGCCTTCCACCTCACTGTTG 60.179 55.000 0.00 0.00 0.00 3.33
3395 3407 0.179018 GCCTTCCACCTCACTGTTGT 60.179 55.000 0.00 0.00 0.00 3.32
3396 3408 1.750682 GCCTTCCACCTCACTGTTGTT 60.751 52.381 0.00 0.00 0.00 2.83
3397 3409 2.486548 GCCTTCCACCTCACTGTTGTTA 60.487 50.000 0.00 0.00 0.00 2.41
3398 3410 3.815809 CCTTCCACCTCACTGTTGTTAA 58.184 45.455 0.00 0.00 0.00 2.01
3399 3411 4.398319 CCTTCCACCTCACTGTTGTTAAT 58.602 43.478 0.00 0.00 0.00 1.40
3400 3412 4.827284 CCTTCCACCTCACTGTTGTTAATT 59.173 41.667 0.00 0.00 0.00 1.40
3401 3413 5.301805 CCTTCCACCTCACTGTTGTTAATTT 59.698 40.000 0.00 0.00 0.00 1.82
3402 3414 6.183360 CCTTCCACCTCACTGTTGTTAATTTT 60.183 38.462 0.00 0.00 0.00 1.82
3403 3415 7.013846 CCTTCCACCTCACTGTTGTTAATTTTA 59.986 37.037 0.00 0.00 0.00 1.52
3404 3416 8.472007 TTCCACCTCACTGTTGTTAATTTTAT 57.528 30.769 0.00 0.00 0.00 1.40
3405 3417 8.472007 TCCACCTCACTGTTGTTAATTTTATT 57.528 30.769 0.00 0.00 0.00 1.40
3406 3418 8.919145 TCCACCTCACTGTTGTTAATTTTATTT 58.081 29.630 0.00 0.00 0.00 1.40
3428 3440 7.517614 TTTACTGTATTTTCTTGGCACATCA 57.482 32.000 0.00 0.00 39.30 3.07
3429 3441 7.701539 TTACTGTATTTTCTTGGCACATCAT 57.298 32.000 0.00 0.00 39.30 2.45
3430 3442 5.957798 ACTGTATTTTCTTGGCACATCATG 58.042 37.500 0.00 0.00 39.30 3.07
3440 3452 3.465990 CACATCATGCTTCGGGTCT 57.534 52.632 0.00 0.00 0.00 3.85
3441 3453 1.742761 CACATCATGCTTCGGGTCTT 58.257 50.000 0.00 0.00 0.00 3.01
3442 3454 1.667724 CACATCATGCTTCGGGTCTTC 59.332 52.381 0.00 0.00 0.00 2.87
3443 3455 1.278985 ACATCATGCTTCGGGTCTTCA 59.721 47.619 0.00 0.00 0.00 3.02
3444 3456 2.290260 ACATCATGCTTCGGGTCTTCAA 60.290 45.455 0.00 0.00 0.00 2.69
3445 3457 2.099141 TCATGCTTCGGGTCTTCAAG 57.901 50.000 0.00 0.00 0.00 3.02
3446 3458 1.347707 TCATGCTTCGGGTCTTCAAGT 59.652 47.619 0.00 0.00 0.00 3.16
3447 3459 1.734465 CATGCTTCGGGTCTTCAAGTC 59.266 52.381 0.00 0.00 0.00 3.01
3448 3460 1.048601 TGCTTCGGGTCTTCAAGTCT 58.951 50.000 0.00 0.00 0.00 3.24
3449 3461 2.244695 TGCTTCGGGTCTTCAAGTCTA 58.755 47.619 0.00 0.00 0.00 2.59
3450 3462 2.231478 TGCTTCGGGTCTTCAAGTCTAG 59.769 50.000 0.00 0.00 0.00 2.43
3451 3463 2.882324 CTTCGGGTCTTCAAGTCTAGC 58.118 52.381 0.00 0.00 0.00 3.42
3452 3464 1.919240 TCGGGTCTTCAAGTCTAGCA 58.081 50.000 0.00 0.00 0.00 3.49
3453 3465 1.819288 TCGGGTCTTCAAGTCTAGCAG 59.181 52.381 0.00 0.00 0.00 4.24
3454 3466 1.819288 CGGGTCTTCAAGTCTAGCAGA 59.181 52.381 0.00 0.00 0.00 4.26
3455 3467 2.231478 CGGGTCTTCAAGTCTAGCAGAA 59.769 50.000 0.00 0.00 0.00 3.02
3456 3468 3.591023 GGGTCTTCAAGTCTAGCAGAAC 58.409 50.000 0.00 0.00 0.00 3.01
3457 3469 3.006967 GGGTCTTCAAGTCTAGCAGAACA 59.993 47.826 0.00 0.00 0.00 3.18
3458 3470 4.503296 GGGTCTTCAAGTCTAGCAGAACAA 60.503 45.833 0.00 0.00 0.00 2.83
3459 3471 4.688413 GGTCTTCAAGTCTAGCAGAACAAG 59.312 45.833 0.00 0.00 0.00 3.16
3460 3472 5.509840 GGTCTTCAAGTCTAGCAGAACAAGA 60.510 44.000 0.00 0.00 0.00 3.02
3461 3473 5.404066 GTCTTCAAGTCTAGCAGAACAAGAC 59.596 44.000 0.00 0.00 39.95 3.01
3465 3477 4.946478 AGTCTAGCAGAACAAGACTTGT 57.054 40.909 15.23 15.23 45.94 3.16
3481 3493 9.167311 ACAAGACTTGTTATTATCCAATGAGAC 57.833 33.333 15.23 0.00 42.22 3.36
3482 3494 9.388506 CAAGACTTGTTATTATCCAATGAGACT 57.611 33.333 7.05 0.00 0.00 3.24
3483 3495 9.965902 AAGACTTGTTATTATCCAATGAGACTT 57.034 29.630 0.00 0.00 0.00 3.01
3484 3496 9.388506 AGACTTGTTATTATCCAATGAGACTTG 57.611 33.333 0.00 0.00 0.00 3.16
3485 3497 9.167311 GACTTGTTATTATCCAATGAGACTTGT 57.833 33.333 0.00 0.00 0.00 3.16
3488 3500 9.952030 TTGTTATTATCCAATGAGACTTGTACA 57.048 29.630 0.00 0.00 0.00 2.90
3489 3501 9.952030 TGTTATTATCCAATGAGACTTGTACAA 57.048 29.630 8.28 8.28 0.00 2.41
3494 3506 9.513906 TTATCCAATGAGACTTGTACAAAATGA 57.486 29.630 10.03 0.00 0.00 2.57
3495 3507 7.815840 TCCAATGAGACTTGTACAAAATGAA 57.184 32.000 10.03 0.00 0.00 2.57
3496 3508 8.231692 TCCAATGAGACTTGTACAAAATGAAA 57.768 30.769 10.03 0.00 0.00 2.69
3497 3509 8.134895 TCCAATGAGACTTGTACAAAATGAAAC 58.865 33.333 10.03 0.00 0.00 2.78
3498 3510 8.137437 CCAATGAGACTTGTACAAAATGAAACT 58.863 33.333 10.03 1.89 0.00 2.66
3499 3511 9.173939 CAATGAGACTTGTACAAAATGAAACTC 57.826 33.333 10.03 10.31 0.00 3.01
3500 3512 7.857734 TGAGACTTGTACAAAATGAAACTCA 57.142 32.000 10.03 12.33 0.00 3.41
3501 3513 8.450578 TGAGACTTGTACAAAATGAAACTCAT 57.549 30.769 10.03 0.00 39.09 2.90
3511 3523 4.853924 AATGAAACTCATTTGGTCGCTT 57.146 36.364 0.00 0.00 44.03 4.68
3512 3524 3.624326 TGAAACTCATTTGGTCGCTTG 57.376 42.857 0.00 0.00 0.00 4.01
3513 3525 2.287547 TGAAACTCATTTGGTCGCTTGC 60.288 45.455 0.00 0.00 0.00 4.01
3514 3526 1.609208 AACTCATTTGGTCGCTTGCT 58.391 45.000 0.00 0.00 0.00 3.91
3515 3527 0.877071 ACTCATTTGGTCGCTTGCTG 59.123 50.000 0.00 0.00 0.00 4.41
3516 3528 0.455633 CTCATTTGGTCGCTTGCTGC 60.456 55.000 0.00 0.00 38.57 5.25
3517 3529 1.444895 CATTTGGTCGCTTGCTGCC 60.445 57.895 0.00 0.00 38.78 4.85
3518 3530 2.981560 ATTTGGTCGCTTGCTGCCG 61.982 57.895 0.00 0.00 38.78 5.69
3526 3538 2.359107 CTTGCTGCCGCTGGAGAA 60.359 61.111 0.00 0.00 36.97 2.87
3527 3539 2.359107 TTGCTGCCGCTGGAGAAG 60.359 61.111 0.00 0.00 36.97 2.85
3528 3540 3.907260 TTGCTGCCGCTGGAGAAGG 62.907 63.158 0.00 0.00 36.97 3.46
3529 3541 4.087892 GCTGCCGCTGGAGAAGGA 62.088 66.667 0.00 0.00 0.00 3.36
3530 3542 2.665000 CTGCCGCTGGAGAAGGAA 59.335 61.111 0.00 0.00 0.00 3.36
3531 3543 1.003355 CTGCCGCTGGAGAAGGAAA 60.003 57.895 0.00 0.00 0.00 3.13
3532 3544 0.606401 CTGCCGCTGGAGAAGGAAAA 60.606 55.000 0.00 0.00 0.00 2.29
3533 3545 0.179004 TGCCGCTGGAGAAGGAAAAA 60.179 50.000 0.00 0.00 0.00 1.94
3550 3562 3.513566 AAAAAGGGGTGGGGGCGA 61.514 61.111 0.00 0.00 0.00 5.54
3551 3563 3.523374 AAAAAGGGGTGGGGGCGAG 62.523 63.158 0.00 0.00 0.00 5.03
3552 3564 4.995058 AAAGGGGTGGGGGCGAGA 62.995 66.667 0.00 0.00 0.00 4.04
3564 3576 4.187056 GCGAGAGGCTTACCACAC 57.813 61.111 0.00 0.00 39.06 3.82
3565 3577 1.805945 GCGAGAGGCTTACCACACG 60.806 63.158 0.00 0.00 41.98 4.49
3566 3578 1.880894 CGAGAGGCTTACCACACGA 59.119 57.895 0.00 0.00 41.72 4.35
3567 3579 0.456312 CGAGAGGCTTACCACACGAC 60.456 60.000 0.00 0.00 41.72 4.34
3568 3580 0.601558 GAGAGGCTTACCACACGACA 59.398 55.000 0.00 0.00 39.06 4.35
3569 3581 1.000506 GAGAGGCTTACCACACGACAA 59.999 52.381 0.00 0.00 39.06 3.18
3570 3582 1.145803 GAGGCTTACCACACGACAAC 58.854 55.000 0.00 0.00 39.06 3.32
3571 3583 0.756903 AGGCTTACCACACGACAACT 59.243 50.000 0.00 0.00 39.06 3.16
3572 3584 1.965643 AGGCTTACCACACGACAACTA 59.034 47.619 0.00 0.00 39.06 2.24
3573 3585 2.029290 AGGCTTACCACACGACAACTAG 60.029 50.000 0.00 0.00 39.06 2.57
3574 3586 1.725164 GCTTACCACACGACAACTAGC 59.275 52.381 0.00 0.00 0.00 3.42
3575 3587 2.864882 GCTTACCACACGACAACTAGCA 60.865 50.000 0.00 0.00 0.00 3.49
3576 3588 2.717580 TACCACACGACAACTAGCAG 57.282 50.000 0.00 0.00 0.00 4.24
3577 3589 1.037493 ACCACACGACAACTAGCAGA 58.963 50.000 0.00 0.00 0.00 4.26
3578 3590 1.618837 ACCACACGACAACTAGCAGAT 59.381 47.619 0.00 0.00 0.00 2.90
3579 3591 2.037251 ACCACACGACAACTAGCAGATT 59.963 45.455 0.00 0.00 0.00 2.40
3580 3592 3.067106 CCACACGACAACTAGCAGATTT 58.933 45.455 0.00 0.00 0.00 2.17
3581 3593 3.498397 CCACACGACAACTAGCAGATTTT 59.502 43.478 0.00 0.00 0.00 1.82
3582 3594 4.457810 CACACGACAACTAGCAGATTTTG 58.542 43.478 0.00 0.00 0.00 2.44
3593 3605 2.821307 CAGATTTTGCCGAGCTTCTC 57.179 50.000 0.00 0.00 0.00 2.87
3594 3606 2.354259 CAGATTTTGCCGAGCTTCTCT 58.646 47.619 0.00 0.00 0.00 3.10
3595 3607 2.095532 CAGATTTTGCCGAGCTTCTCTG 59.904 50.000 0.00 0.00 0.00 3.35
3596 3608 0.807496 ATTTTGCCGAGCTTCTCTGC 59.193 50.000 3.74 3.74 40.31 4.26
3611 3623 4.661461 TGCTCTGCAGTTCAGACG 57.339 55.556 14.67 0.00 46.34 4.18
3612 3624 1.742146 TGCTCTGCAGTTCAGACGT 59.258 52.632 14.67 0.00 46.34 4.34
3613 3625 0.319040 TGCTCTGCAGTTCAGACGTC 60.319 55.000 14.67 7.70 46.34 4.34
3614 3626 0.038709 GCTCTGCAGTTCAGACGTCT 60.039 55.000 13.58 13.58 46.34 4.18
3615 3627 1.604185 GCTCTGCAGTTCAGACGTCTT 60.604 52.381 17.26 0.00 46.34 3.01
3616 3628 2.057316 CTCTGCAGTTCAGACGTCTTG 58.943 52.381 17.26 13.04 46.34 3.02
3617 3629 1.409064 TCTGCAGTTCAGACGTCTTGT 59.591 47.619 17.26 0.00 46.34 3.16
3618 3630 1.524355 CTGCAGTTCAGACGTCTTGTG 59.476 52.381 17.26 11.65 45.72 3.33
3619 3631 0.233332 GCAGTTCAGACGTCTTGTGC 59.767 55.000 17.26 17.44 0.00 4.57
3620 3632 1.858091 CAGTTCAGACGTCTTGTGCT 58.142 50.000 17.26 8.99 0.00 4.40
3621 3633 1.789464 CAGTTCAGACGTCTTGTGCTC 59.211 52.381 17.26 3.77 0.00 4.26
3622 3634 1.140816 GTTCAGACGTCTTGTGCTCC 58.859 55.000 17.26 0.00 0.00 4.70
3623 3635 0.750249 TTCAGACGTCTTGTGCTCCA 59.250 50.000 17.26 0.00 0.00 3.86
3624 3636 0.969149 TCAGACGTCTTGTGCTCCAT 59.031 50.000 17.26 0.00 0.00 3.41
3625 3637 1.067565 TCAGACGTCTTGTGCTCCATC 60.068 52.381 17.26 0.00 0.00 3.51
3626 3638 0.247736 AGACGTCTTGTGCTCCATCC 59.752 55.000 13.58 0.00 0.00 3.51
3627 3639 0.037326 GACGTCTTGTGCTCCATCCA 60.037 55.000 8.70 0.00 0.00 3.41
3628 3640 0.615331 ACGTCTTGTGCTCCATCCAT 59.385 50.000 0.00 0.00 0.00 3.41
3629 3641 1.293924 CGTCTTGTGCTCCATCCATC 58.706 55.000 0.00 0.00 0.00 3.51
3630 3642 1.134580 CGTCTTGTGCTCCATCCATCT 60.135 52.381 0.00 0.00 0.00 2.90
3631 3643 2.286872 GTCTTGTGCTCCATCCATCTG 58.713 52.381 0.00 0.00 0.00 2.90
3632 3644 1.211212 TCTTGTGCTCCATCCATCTGG 59.789 52.381 0.00 0.00 37.66 3.86
3643 3655 1.062364 TCCATCTGGATCCCATCTGC 58.938 55.000 9.90 0.00 39.78 4.26
3644 3656 0.769247 CCATCTGGATCCCATCTGCA 59.231 55.000 9.90 0.00 37.39 4.41
3645 3657 1.354705 CCATCTGGATCCCATCTGCAT 59.645 52.381 9.90 0.00 37.39 3.96
3646 3658 2.225041 CCATCTGGATCCCATCTGCATT 60.225 50.000 9.90 0.00 37.39 3.56
3647 3659 3.497332 CATCTGGATCCCATCTGCATTT 58.503 45.455 9.90 0.00 30.82 2.32
3648 3660 3.675348 TCTGGATCCCATCTGCATTTT 57.325 42.857 9.90 0.00 30.82 1.82
3649 3661 3.559069 TCTGGATCCCATCTGCATTTTC 58.441 45.455 9.90 0.00 30.82 2.29
3650 3662 2.292569 CTGGATCCCATCTGCATTTTCG 59.707 50.000 9.90 0.00 30.82 3.46
3651 3663 1.610522 GGATCCCATCTGCATTTTCGG 59.389 52.381 0.00 0.00 0.00 4.30
3652 3664 2.575532 GATCCCATCTGCATTTTCGGA 58.424 47.619 0.00 0.00 0.00 4.55
3653 3665 2.042686 TCCCATCTGCATTTTCGGAG 57.957 50.000 0.00 0.00 0.00 4.63
3654 3666 1.027357 CCCATCTGCATTTTCGGAGG 58.973 55.000 0.00 0.00 0.00 4.30
3655 3667 1.683011 CCCATCTGCATTTTCGGAGGT 60.683 52.381 0.00 0.00 0.00 3.85
3656 3668 1.402968 CCATCTGCATTTTCGGAGGTG 59.597 52.381 0.00 0.00 35.38 4.00
3657 3669 1.402968 CATCTGCATTTTCGGAGGTGG 59.597 52.381 0.00 0.00 32.22 4.61
3658 3670 0.322456 TCTGCATTTTCGGAGGTGGG 60.322 55.000 0.00 0.00 0.00 4.61
3659 3671 0.322456 CTGCATTTTCGGAGGTGGGA 60.322 55.000 0.00 0.00 0.00 4.37
3660 3672 0.322456 TGCATTTTCGGAGGTGGGAG 60.322 55.000 0.00 0.00 0.00 4.30
3661 3673 0.035439 GCATTTTCGGAGGTGGGAGA 60.035 55.000 0.00 0.00 0.00 3.71
3662 3674 1.408822 GCATTTTCGGAGGTGGGAGAT 60.409 52.381 0.00 0.00 0.00 2.75
3663 3675 2.292267 CATTTTCGGAGGTGGGAGATG 58.708 52.381 0.00 0.00 0.00 2.90
3664 3676 1.651737 TTTTCGGAGGTGGGAGATGA 58.348 50.000 0.00 0.00 0.00 2.92
3665 3677 1.195115 TTTCGGAGGTGGGAGATGAG 58.805 55.000 0.00 0.00 0.00 2.90
3666 3678 0.687757 TTCGGAGGTGGGAGATGAGG 60.688 60.000 0.00 0.00 0.00 3.86
3667 3679 1.075970 CGGAGGTGGGAGATGAGGA 60.076 63.158 0.00 0.00 0.00 3.71
3668 3680 1.112315 CGGAGGTGGGAGATGAGGAG 61.112 65.000 0.00 0.00 0.00 3.69
3669 3681 0.762461 GGAGGTGGGAGATGAGGAGG 60.762 65.000 0.00 0.00 0.00 4.30
3670 3682 0.263172 GAGGTGGGAGATGAGGAGGA 59.737 60.000 0.00 0.00 0.00 3.71
3671 3683 0.031616 AGGTGGGAGATGAGGAGGAC 60.032 60.000 0.00 0.00 0.00 3.85
3672 3684 0.325671 GGTGGGAGATGAGGAGGACA 60.326 60.000 0.00 0.00 0.00 4.02
3673 3685 1.118838 GTGGGAGATGAGGAGGACAG 58.881 60.000 0.00 0.00 0.00 3.51
3674 3686 1.010795 TGGGAGATGAGGAGGACAGA 58.989 55.000 0.00 0.00 0.00 3.41
3675 3687 1.063341 TGGGAGATGAGGAGGACAGAG 60.063 57.143 0.00 0.00 0.00 3.35
3676 3688 1.703411 GGAGATGAGGAGGACAGAGG 58.297 60.000 0.00 0.00 0.00 3.69
3677 3689 1.216678 GGAGATGAGGAGGACAGAGGA 59.783 57.143 0.00 0.00 0.00 3.71
3678 3690 2.158325 GGAGATGAGGAGGACAGAGGAT 60.158 54.545 0.00 0.00 0.00 3.24
3679 3691 3.575805 GAGATGAGGAGGACAGAGGATT 58.424 50.000 0.00 0.00 0.00 3.01
3680 3692 3.573967 GAGATGAGGAGGACAGAGGATTC 59.426 52.174 0.00 0.00 0.00 2.52
3681 3693 2.166907 TGAGGAGGACAGAGGATTCC 57.833 55.000 0.00 0.00 0.00 3.01
3682 3694 1.648568 TGAGGAGGACAGAGGATTCCT 59.351 52.381 4.44 4.44 45.49 3.36
3691 3703 3.635510 AGGATTCCTCACCTCGCC 58.364 61.111 0.00 0.00 0.00 5.54
3692 3704 1.306141 AGGATTCCTCACCTCGCCA 60.306 57.895 0.00 0.00 0.00 5.69
3693 3705 1.153349 GGATTCCTCACCTCGCCAC 60.153 63.158 0.00 0.00 0.00 5.01
3694 3706 1.519455 GATTCCTCACCTCGCCACG 60.519 63.158 0.00 0.00 0.00 4.94
3695 3707 2.907897 GATTCCTCACCTCGCCACGG 62.908 65.000 0.00 0.00 0.00 4.94
3713 3725 3.394836 GCGGAAGGCCTCCTCTGT 61.395 66.667 5.23 0.00 42.85 3.41
3714 3726 2.058595 GCGGAAGGCCTCCTCTGTA 61.059 63.158 5.23 0.00 42.85 2.74
3715 3727 1.817209 CGGAAGGCCTCCTCTGTAC 59.183 63.158 5.23 0.00 42.85 2.90
3716 3728 0.970937 CGGAAGGCCTCCTCTGTACA 60.971 60.000 5.23 0.00 42.85 2.90
3717 3729 1.276622 GGAAGGCCTCCTCTGTACAA 58.723 55.000 5.23 0.00 41.61 2.41
3718 3730 1.840635 GGAAGGCCTCCTCTGTACAAT 59.159 52.381 5.23 0.00 41.61 2.71
3719 3731 2.420687 GGAAGGCCTCCTCTGTACAATG 60.421 54.545 5.23 0.00 41.61 2.82
3720 3732 2.254152 AGGCCTCCTCTGTACAATGA 57.746 50.000 0.00 0.00 0.00 2.57
3721 3733 2.551270 AGGCCTCCTCTGTACAATGAA 58.449 47.619 0.00 0.00 0.00 2.57
3722 3734 2.503356 AGGCCTCCTCTGTACAATGAAG 59.497 50.000 0.00 0.00 0.00 3.02
3723 3735 2.420687 GGCCTCCTCTGTACAATGAAGG 60.421 54.545 0.00 3.48 0.00 3.46
3724 3736 2.420687 GCCTCCTCTGTACAATGAAGGG 60.421 54.545 13.12 6.25 0.00 3.95
3725 3737 2.171448 CCTCCTCTGTACAATGAAGGGG 59.829 54.545 0.00 1.76 32.35 4.79
3726 3738 2.171448 CTCCTCTGTACAATGAAGGGGG 59.829 54.545 0.00 0.00 31.95 5.40
3727 3739 2.196595 CCTCTGTACAATGAAGGGGGA 58.803 52.381 0.00 0.00 0.00 4.81
3728 3740 2.171448 CCTCTGTACAATGAAGGGGGAG 59.829 54.545 0.00 0.00 0.00 4.30
3729 3741 2.171448 CTCTGTACAATGAAGGGGGAGG 59.829 54.545 0.00 0.00 0.00 4.30
3730 3742 1.916181 CTGTACAATGAAGGGGGAGGT 59.084 52.381 0.00 0.00 0.00 3.85
3731 3743 1.633432 TGTACAATGAAGGGGGAGGTG 59.367 52.381 0.00 0.00 0.00 4.00
3732 3744 1.913419 GTACAATGAAGGGGGAGGTGA 59.087 52.381 0.00 0.00 0.00 4.02
3733 3745 1.455822 ACAATGAAGGGGGAGGTGAA 58.544 50.000 0.00 0.00 0.00 3.18
3734 3746 1.075536 ACAATGAAGGGGGAGGTGAAC 59.924 52.381 0.00 0.00 0.00 3.18
3735 3747 1.075374 CAATGAAGGGGGAGGTGAACA 59.925 52.381 0.00 0.00 0.00 3.18
3736 3748 1.455822 ATGAAGGGGGAGGTGAACAA 58.544 50.000 0.00 0.00 0.00 2.83
3737 3749 0.771127 TGAAGGGGGAGGTGAACAAG 59.229 55.000 0.00 0.00 0.00 3.16
3738 3750 0.038310 GAAGGGGGAGGTGAACAAGG 59.962 60.000 0.00 0.00 0.00 3.61
3739 3751 0.402861 AAGGGGGAGGTGAACAAGGA 60.403 55.000 0.00 0.00 0.00 3.36
3740 3752 0.842467 AGGGGGAGGTGAACAAGGAG 60.842 60.000 0.00 0.00 0.00 3.69
3741 3753 1.685820 GGGGAGGTGAACAAGGAGG 59.314 63.158 0.00 0.00 0.00 4.30
3742 3754 1.685820 GGGAGGTGAACAAGGAGGG 59.314 63.158 0.00 0.00 0.00 4.30
3743 3755 1.685820 GGAGGTGAACAAGGAGGGG 59.314 63.158 0.00 0.00 0.00 4.79
3744 3756 0.840722 GGAGGTGAACAAGGAGGGGA 60.841 60.000 0.00 0.00 0.00 4.81
3745 3757 1.064825 GAGGTGAACAAGGAGGGGAA 58.935 55.000 0.00 0.00 0.00 3.97
3746 3758 1.003696 GAGGTGAACAAGGAGGGGAAG 59.996 57.143 0.00 0.00 0.00 3.46
3747 3759 0.771755 GGTGAACAAGGAGGGGAAGT 59.228 55.000 0.00 0.00 0.00 3.01
3748 3760 1.545651 GGTGAACAAGGAGGGGAAGTG 60.546 57.143 0.00 0.00 0.00 3.16
3749 3761 0.771127 TGAACAAGGAGGGGAAGTGG 59.229 55.000 0.00 0.00 0.00 4.00
3750 3762 1.064825 GAACAAGGAGGGGAAGTGGA 58.935 55.000 0.00 0.00 0.00 4.02
3751 3763 1.636003 GAACAAGGAGGGGAAGTGGAT 59.364 52.381 0.00 0.00 0.00 3.41
3752 3764 1.760405 ACAAGGAGGGGAAGTGGATT 58.240 50.000 0.00 0.00 0.00 3.01
3753 3765 2.929301 ACAAGGAGGGGAAGTGGATTA 58.071 47.619 0.00 0.00 0.00 1.75
3754 3766 2.576648 ACAAGGAGGGGAAGTGGATTAC 59.423 50.000 0.00 0.00 0.00 1.89
3755 3767 2.846827 CAAGGAGGGGAAGTGGATTACT 59.153 50.000 0.00 0.00 42.89 2.24
3756 3768 2.765502 AGGAGGGGAAGTGGATTACTC 58.234 52.381 0.00 0.00 39.18 2.59
3757 3769 2.045885 AGGAGGGGAAGTGGATTACTCA 59.954 50.000 0.00 0.00 39.18 3.41
3758 3770 2.170817 GGAGGGGAAGTGGATTACTCAC 59.829 54.545 0.00 0.00 39.18 3.51
3759 3771 2.170817 GAGGGGAAGTGGATTACTCACC 59.829 54.545 0.00 0.00 39.18 4.02
3760 3772 2.197465 GGGGAAGTGGATTACTCACCT 58.803 52.381 0.00 0.00 39.18 4.00
3761 3773 3.013648 AGGGGAAGTGGATTACTCACCTA 59.986 47.826 0.00 0.00 38.07 3.08
3762 3774 3.134262 GGGGAAGTGGATTACTCACCTAC 59.866 52.174 0.00 0.00 39.18 3.18
3763 3775 3.181478 GGGAAGTGGATTACTCACCTACG 60.181 52.174 0.00 0.00 39.18 3.51
3764 3776 3.698040 GGAAGTGGATTACTCACCTACGA 59.302 47.826 0.00 0.00 39.18 3.43
3765 3777 4.439837 GGAAGTGGATTACTCACCTACGAC 60.440 50.000 0.00 0.00 39.18 4.34
3766 3778 2.681848 AGTGGATTACTCACCTACGACG 59.318 50.000 0.00 0.00 33.17 5.12
3767 3779 2.679837 GTGGATTACTCACCTACGACGA 59.320 50.000 0.00 0.00 0.00 4.20
3768 3780 3.127548 GTGGATTACTCACCTACGACGAA 59.872 47.826 0.00 0.00 0.00 3.85
3769 3781 3.758023 TGGATTACTCACCTACGACGAAA 59.242 43.478 0.00 0.00 0.00 3.46
3770 3782 4.142534 TGGATTACTCACCTACGACGAAAG 60.143 45.833 0.00 0.00 0.00 2.62
3771 3783 4.095483 GGATTACTCACCTACGACGAAAGA 59.905 45.833 0.00 0.00 0.00 2.52
3772 3784 4.675190 TTACTCACCTACGACGAAAGAG 57.325 45.455 0.00 4.10 0.00 2.85
3773 3785 2.502295 ACTCACCTACGACGAAAGAGT 58.498 47.619 0.00 4.73 0.00 3.24
3774 3786 2.225963 ACTCACCTACGACGAAAGAGTG 59.774 50.000 0.00 8.99 33.96 3.51
3775 3787 1.068748 TCACCTACGACGAAAGAGTGC 60.069 52.381 0.00 0.00 0.00 4.40
3776 3788 0.956633 ACCTACGACGAAAGAGTGCA 59.043 50.000 0.00 0.00 0.00 4.57
3777 3789 1.544691 ACCTACGACGAAAGAGTGCAT 59.455 47.619 0.00 0.00 0.00 3.96
3778 3790 2.186076 CCTACGACGAAAGAGTGCATC 58.814 52.381 0.00 0.00 0.00 3.91
3779 3791 2.186076 CTACGACGAAAGAGTGCATCC 58.814 52.381 0.00 0.00 0.00 3.51
3780 3792 0.317160 ACGACGAAAGAGTGCATCCA 59.683 50.000 0.00 0.00 0.00 3.41
3781 3793 0.716108 CGACGAAAGAGTGCATCCAC 59.284 55.000 0.00 0.00 42.39 4.02
3782 3794 1.079503 GACGAAAGAGTGCATCCACC 58.920 55.000 0.00 0.00 43.09 4.61
3783 3795 0.670546 ACGAAAGAGTGCATCCACCG 60.671 55.000 0.00 0.00 43.09 4.94
3784 3796 0.670546 CGAAAGAGTGCATCCACCGT 60.671 55.000 0.00 0.00 43.09 4.83
3785 3797 1.079503 GAAAGAGTGCATCCACCGTC 58.920 55.000 0.00 0.00 43.09 4.79
3786 3798 0.670546 AAAGAGTGCATCCACCGTCG 60.671 55.000 0.00 0.00 43.09 5.12
3787 3799 2.507110 AAGAGTGCATCCACCGTCGG 62.507 60.000 10.48 10.48 43.09 4.79
3788 3800 3.296709 GAGTGCATCCACCGTCGGT 62.297 63.158 12.23 12.23 43.09 4.69
3789 3801 2.813908 GTGCATCCACCGTCGGTC 60.814 66.667 15.67 3.22 35.92 4.79
3790 3802 3.307108 TGCATCCACCGTCGGTCA 61.307 61.111 15.67 6.27 31.02 4.02
3791 3803 2.813908 GCATCCACCGTCGGTCAC 60.814 66.667 15.67 0.00 31.02 3.67
3792 3804 2.125673 CATCCACCGTCGGTCACC 60.126 66.667 15.67 0.00 31.02 4.02
3793 3805 3.387947 ATCCACCGTCGGTCACCC 61.388 66.667 15.67 0.00 31.02 4.61
3794 3806 3.899545 ATCCACCGTCGGTCACCCT 62.900 63.158 15.67 0.00 31.02 4.34
3795 3807 4.065281 CCACCGTCGGTCACCCTC 62.065 72.222 15.67 0.00 31.02 4.30
3796 3808 4.415332 CACCGTCGGTCACCCTCG 62.415 72.222 15.67 0.00 31.02 4.63
3797 3809 4.648626 ACCGTCGGTCACCCTCGA 62.649 66.667 12.23 0.00 0.00 4.04
3798 3810 3.138798 CCGTCGGTCACCCTCGAT 61.139 66.667 2.08 0.00 37.73 3.59
3799 3811 2.102357 CGTCGGTCACCCTCGATG 59.898 66.667 0.00 0.00 37.73 3.84
3800 3812 2.202756 GTCGGTCACCCTCGATGC 60.203 66.667 0.00 0.00 37.73 3.91
3801 3813 2.678580 TCGGTCACCCTCGATGCA 60.679 61.111 0.00 0.00 0.00 3.96
3802 3814 2.058001 TCGGTCACCCTCGATGCAT 61.058 57.895 0.00 0.00 0.00 3.96
3803 3815 1.884464 CGGTCACCCTCGATGCATG 60.884 63.158 2.46 0.00 0.00 4.06
3804 3816 2.182842 GGTCACCCTCGATGCATGC 61.183 63.158 11.82 11.82 0.00 4.06
3805 3817 1.450134 GTCACCCTCGATGCATGCA 60.450 57.895 25.04 25.04 0.00 3.96
3806 3818 0.816825 GTCACCCTCGATGCATGCAT 60.817 55.000 32.66 32.66 39.69 3.96
3807 3819 0.758123 TCACCCTCGATGCATGCATA 59.242 50.000 32.27 17.48 36.70 3.14
3808 3820 1.154197 CACCCTCGATGCATGCATAG 58.846 55.000 32.27 30.34 36.70 2.23
3809 3821 0.604780 ACCCTCGATGCATGCATAGC 60.605 55.000 32.27 19.81 36.70 2.97
3810 3822 0.321387 CCCTCGATGCATGCATAGCT 60.321 55.000 32.27 12.68 36.70 3.32
3811 3823 1.077123 CCTCGATGCATGCATAGCTC 58.923 55.000 32.27 19.86 36.70 4.09
3812 3824 1.337917 CCTCGATGCATGCATAGCTCT 60.338 52.381 32.27 11.41 36.70 4.09
3813 3825 1.727335 CTCGATGCATGCATAGCTCTG 59.273 52.381 32.27 17.57 36.70 3.35
3814 3826 0.166161 CGATGCATGCATAGCTCTGC 59.834 55.000 32.27 16.67 42.62 4.26
3815 3827 1.524848 GATGCATGCATAGCTCTGCT 58.475 50.000 32.27 8.91 42.75