Multiple sequence alignment - TraesCS5A01G553000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G553000 chr5A 100.000 3561 0 0 1 3561 705774031 705777591 0.000000e+00 6577.0
1 TraesCS5A01G553000 chr4B 98.990 3566 26 5 1 3561 665812083 665815643 0.000000e+00 6377.0
2 TraesCS5A01G553000 chrUn 92.835 3517 193 29 64 3560 108394034 108390557 0.000000e+00 5044.0
3 TraesCS5A01G553000 chrUn 100.000 142 0 0 3420 3561 477845162 477845021 2.730000e-66 263.0
4 TraesCS5A01G553000 chr2A 84.109 623 93 6 1921 2540 11308693 11308074 6.580000e-167 597.0
5 TraesCS5A01G553000 chr2A 82.653 98 14 3 55 151 657447403 657447498 2.280000e-12 84.2
6 TraesCS5A01G553000 chr1D 83.744 203 24 5 308 502 476842038 476842239 2.180000e-42 183.0
7 TraesCS5A01G553000 chr1D 79.433 141 27 2 63 203 485502498 485502636 8.140000e-17 99.0
8 TraesCS5A01G553000 chr1D 78.000 100 18 4 109 204 30690069 30689970 3.840000e-05 60.2
9 TraesCS5A01G553000 chr3A 77.247 356 48 24 305 629 721634460 721634813 1.020000e-40 178.0
10 TraesCS5A01G553000 chr3A 79.200 125 23 2 324 445 175883869 175883745 2.280000e-12 84.2
11 TraesCS5A01G553000 chr6B 83.590 195 23 7 314 502 19987599 19987408 1.310000e-39 174.0
12 TraesCS5A01G553000 chr7A 76.453 344 48 17 323 635 195519290 195519631 4.760000e-34 156.0
13 TraesCS5A01G553000 chr7A 86.842 76 10 0 203 278 247640836 247640911 6.330000e-13 86.1
14 TraesCS5A01G553000 chr7A 78.571 126 24 2 324 446 67809755 67809880 2.950000e-11 80.5
15 TraesCS5A01G553000 chr7A 81.818 99 15 3 54 150 661297626 661297723 2.950000e-11 80.5
16 TraesCS5A01G553000 chr7A 83.562 73 12 0 68 140 655549419 655549491 6.380000e-08 69.4
17 TraesCS5A01G553000 chr4A 78.818 203 34 6 308 502 572503774 572503975 1.040000e-25 128.0
18 TraesCS5A01G553000 chr4D 82.222 135 21 3 73 206 57471208 57471340 2.910000e-21 113.0
19 TraesCS5A01G553000 chr7D 78.000 150 29 4 54 203 180412107 180412252 1.360000e-14 91.6
20 TraesCS5A01G553000 chr2B 81.319 91 13 2 75 163 643687539 643687451 1.770000e-08 71.3
21 TraesCS5A01G553000 chr2B 97.059 34 0 1 2919 2952 29145226 29145258 4.970000e-04 56.5
22 TraesCS5A01G553000 chr7B 78.704 108 19 3 97 203 252169736 252169632 6.380000e-08 69.4
23 TraesCS5A01G553000 chr7B 94.872 39 1 1 2914 2952 733375860 733375823 3.840000e-05 60.2
24 TraesCS5A01G553000 chr2D 94.444 36 2 0 176 211 643040953 643040988 4.970000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G553000 chr5A 705774031 705777591 3560 False 6577 6577 100.000 1 3561 1 chr5A.!!$F1 3560
1 TraesCS5A01G553000 chr4B 665812083 665815643 3560 False 6377 6377 98.990 1 3561 1 chr4B.!!$F1 3560
2 TraesCS5A01G553000 chrUn 108390557 108394034 3477 True 5044 5044 92.835 64 3560 1 chrUn.!!$R1 3496
3 TraesCS5A01G553000 chr2A 11308074 11308693 619 True 597 597 84.109 1921 2540 1 chr2A.!!$R1 619

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
24 25 2.115695 GGGCGGGTGGTTGGTTTA 59.884 61.111 0.0 0.0 0.00 2.01 F
178 181 2.159184 TCCAGACACATGCGAGAGATTC 60.159 50.000 0.0 0.0 0.00 2.52 F
544 559 3.569701 TGGATTTGTGAGCAAGAAAGGAC 59.430 43.478 0.0 0.0 35.82 3.85 F
1114 1131 0.745845 AGCGACCCATGTCATTGCTC 60.746 55.000 0.0 0.0 41.85 4.26 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1088 1105 0.179000 GACATGGGTCGCTCCAAGAT 59.821 55.000 0.00 0.00 40.62 2.40 R
1114 1131 1.227089 CGATCTCCGGGCTTGTCAG 60.227 63.158 0.00 0.00 33.91 3.51 R
1543 1560 4.330894 CACACAGAAGCTGTATACATGGTG 59.669 45.833 5.91 10.55 43.43 4.17 R
2638 2656 4.449405 CACACCACATTACACGACATACAA 59.551 41.667 0.00 0.00 0.00 2.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
24 25 2.115695 GGGCGGGTGGTTGGTTTA 59.884 61.111 0.00 0.00 0.00 2.01
178 181 2.159184 TCCAGACACATGCGAGAGATTC 60.159 50.000 0.00 0.00 0.00 2.52
242 245 9.154632 TCTAAGCCAAAGAGATAATGTGGTATA 57.845 33.333 0.00 0.00 0.00 1.47
544 559 3.569701 TGGATTTGTGAGCAAGAAAGGAC 59.430 43.478 0.00 0.00 35.82 3.85
1088 1105 3.942351 CAGACATCCTGTGCCTTCA 57.058 52.632 0.00 0.00 38.10 3.02
1114 1131 0.745845 AGCGACCCATGTCATTGCTC 60.746 55.000 0.00 0.00 41.85 4.26
1191 1208 1.303236 CCGTCCCATCACCTTTGCA 60.303 57.895 0.00 0.00 0.00 4.08
1322 1339 1.619654 CAAAAGGTCCAGCACATCCA 58.380 50.000 0.00 0.00 0.00 3.41
1543 1560 1.355066 CGCGCTTTTCACTCTCCTCC 61.355 60.000 5.56 0.00 0.00 4.30
2325 2343 0.976641 CTCACTGAACCAGGCCTACA 59.023 55.000 3.98 2.76 35.51 2.74
2638 2656 4.500887 CGTACCCGGATGAATCTTACATGT 60.501 45.833 0.73 2.69 0.00 3.21
3183 3209 8.023128 CGAGACAATGAATGGTTGAGTTTTAAT 58.977 33.333 0.00 0.00 0.00 1.40
3327 3353 6.315642 CGTCTCACACTTGGTAGTATTCTAGA 59.684 42.308 0.00 0.00 31.96 2.43
3328 3354 7.148289 CGTCTCACACTTGGTAGTATTCTAGAA 60.148 40.741 7.82 7.82 31.96 2.10
3329 3355 8.521176 GTCTCACACTTGGTAGTATTCTAGAAA 58.479 37.037 9.71 0.00 31.96 2.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
24 25 0.603707 CTGACTGCCATGTTCCACGT 60.604 55.000 0.00 0.00 0.00 4.49
178 181 0.321671 ATCTCCAACACTGACCCACG 59.678 55.000 0.00 0.00 0.00 4.94
242 245 9.638176 ACATGCCTCTCTTTTCTCATTAATTAT 57.362 29.630 0.00 0.00 0.00 1.28
511 526 4.407365 CTCACAAATCCACCCCTTTTACT 58.593 43.478 0.00 0.00 0.00 2.24
544 559 6.032094 GTCATAATTGCATGTCCACTCTTTG 58.968 40.000 0.00 0.00 0.00 2.77
1088 1105 0.179000 GACATGGGTCGCTCCAAGAT 59.821 55.000 0.00 0.00 40.62 2.40
1114 1131 1.227089 CGATCTCCGGGCTTGTCAG 60.227 63.158 0.00 0.00 33.91 3.51
1322 1339 2.794760 AGATGGTCATACTCCTCCTCCT 59.205 50.000 0.00 0.00 0.00 3.69
1543 1560 4.330894 CACACAGAAGCTGTATACATGGTG 59.669 45.833 5.91 10.55 43.43 4.17
2325 2343 6.127253 CCTCCCAGTGCTAAATGAAATGAAAT 60.127 38.462 0.00 0.00 0.00 2.17
2638 2656 4.449405 CACACCACATTACACGACATACAA 59.551 41.667 0.00 0.00 0.00 2.41
3183 3209 1.270305 CCAGTCGTTCTTCTTCTGCCA 60.270 52.381 0.00 0.00 0.00 4.92


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.