Multiple sequence alignment - TraesCS5A01G552900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G552900 chr5A 100.000 3814 0 0 1 3814 705591923 705595736 0.000000e+00 7044.0
1 TraesCS5A01G552900 chr4B 99.292 3815 17 5 1 3814 665610167 665613972 0.000000e+00 6887.0
2 TraesCS5A01G552900 chrUn 91.864 1819 110 17 2032 3814 108414477 108412661 0.000000e+00 2505.0
3 TraesCS5A01G552900 chrUn 94.308 1142 51 10 903 2032 108415655 108414516 0.000000e+00 1736.0
4 TraesCS5A01G552900 chrUn 90.919 914 70 6 903 1808 134378140 134377232 0.000000e+00 1216.0
5 TraesCS5A01G552900 chrUn 82.000 350 41 7 195 542 134379017 134378688 1.040000e-70 278.0
6 TraesCS5A01G552900 chrUn 80.175 343 66 2 1147 1488 282501116 282500775 4.890000e-64 255.0
7 TraesCS5A01G552900 chrUn 80.175 343 66 2 1147 1488 282507888 282507547 4.890000e-64 255.0
8 TraesCS5A01G552900 chrUn 80.175 343 66 2 1147 1488 296566931 296566590 4.890000e-64 255.0
9 TraesCS5A01G552900 chrUn 89.394 66 4 3 623 686 92778883 92778947 3.160000e-11 80.5
10 TraesCS5A01G552900 chr2A 81.481 351 59 6 1117 1464 9058063 9058410 2.240000e-72 283.0
11 TraesCS5A01G552900 chr2A 87.500 64 5 2 626 688 726203105 726203044 1.900000e-08 71.3
12 TraesCS5A01G552900 chr2A 87.500 64 5 2 626 688 726214542 726214481 1.900000e-08 71.3
13 TraesCS5A01G552900 chr2A 89.091 55 4 2 546 598 86679066 86679012 2.460000e-07 67.6
14 TraesCS5A01G552900 chr4A 74.838 616 136 12 2171 2775 713522666 713523273 1.050000e-65 261.0
15 TraesCS5A01G552900 chr1D 91.549 71 4 1 529 599 311688920 311688852 3.140000e-16 97.1
16 TraesCS5A01G552900 chr1D 85.135 74 5 4 626 694 48193879 48193807 1.900000e-08 71.3
17 TraesCS5A01G552900 chr5D 91.667 60 4 1 624 683 385950466 385950524 8.780000e-12 82.4
18 TraesCS5A01G552900 chr1B 86.842 76 3 3 529 599 421538158 421538085 1.140000e-10 78.7
19 TraesCS5A01G552900 chr7D 88.710 62 5 2 627 687 92761947 92761887 1.470000e-09 75.0
20 TraesCS5A01G552900 chr6B 87.500 64 8 0 2552 2615 113589515 113589578 1.470000e-09 75.0
21 TraesCS5A01G552900 chr3B 90.909 55 4 1 631 685 223661961 223661908 5.290000e-09 73.1
22 TraesCS5A01G552900 chr2D 86.957 69 4 4 628 692 532427827 532427760 5.290000e-09 73.1
23 TraesCS5A01G552900 chr7A 89.091 55 4 2 546 598 47927966 47928020 2.460000e-07 67.6
24 TraesCS5A01G552900 chr6A 89.091 55 4 2 546 598 52030151 52030097 2.460000e-07 67.6


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G552900 chr5A 705591923 705595736 3813 False 7044.0 7044 100.0000 1 3814 1 chr5A.!!$F1 3813
1 TraesCS5A01G552900 chr4B 665610167 665613972 3805 False 6887.0 6887 99.2920 1 3814 1 chr4B.!!$F1 3813
2 TraesCS5A01G552900 chrUn 108412661 108415655 2994 True 2120.5 2505 93.0860 903 3814 2 chrUn.!!$R4 2911
3 TraesCS5A01G552900 chrUn 134377232 134379017 1785 True 747.0 1216 86.4595 195 1808 2 chrUn.!!$R5 1613
4 TraesCS5A01G552900 chr4A 713522666 713523273 607 False 261.0 261 74.8380 2171 2775 1 chr4A.!!$F1 604

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
192 193 0.752658 TGGACATGCTGGGTAGATCG 59.247 55.0 0.0 0.0 0.0 3.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2828 3282 6.894339 TGCACGAGGAACAGAATATATAGA 57.106 37.5 0.0 0.0 0.0 1.98 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
192 193 0.752658 TGGACATGCTGGGTAGATCG 59.247 55.000 0.00 0.00 0.00 3.69
489 491 4.440839 AAATGGAGAAAGCGACCAATTC 57.559 40.909 0.00 0.00 37.24 2.17
883 1260 6.791299 CCAAATAAAAACATGAAACATGCACG 59.209 34.615 0.00 0.00 0.00 5.34
1085 1463 2.912987 ATCCTCCTCGTCCCACTCGG 62.913 65.000 0.00 0.00 0.00 4.63
2495 2946 3.415087 GCCATCAGCAGGGACCCT 61.415 66.667 7.44 7.44 42.97 4.34
2885 3351 5.395325 TGTTGTTGTTGTTGTTGTTGTTG 57.605 34.783 0.00 0.00 0.00 3.33
2886 3352 4.870426 TGTTGTTGTTGTTGTTGTTGTTGT 59.130 33.333 0.00 0.00 0.00 3.32
2887 3353 5.351465 TGTTGTTGTTGTTGTTGTTGTTGTT 59.649 32.000 0.00 0.00 0.00 2.83
2888 3354 5.395325 TGTTGTTGTTGTTGTTGTTGTTG 57.605 34.783 0.00 0.00 0.00 3.33
2889 3355 4.870426 TGTTGTTGTTGTTGTTGTTGTTGT 59.130 33.333 0.00 0.00 0.00 3.32
2890 3356 5.351465 TGTTGTTGTTGTTGTTGTTGTTGTT 59.649 32.000 0.00 0.00 0.00 2.83
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
76 77 8.297470 ACTGCCAACATTGATTACAAATAGAT 57.703 30.769 0.0 0.0 39.54 1.98
192 193 4.646945 TGGATAGGATCGAATATGCCTCTC 59.353 45.833 0.0 0.0 32.04 3.20
489 491 6.215121 AGATATTCACGCTCTTCTCTTCATG 58.785 40.000 0.0 0.0 0.00 3.07
883 1260 1.338674 TGTACAGCACACTACCCATGC 60.339 52.381 0.0 0.0 39.74 4.06
2828 3282 6.894339 TGCACGAGGAACAGAATATATAGA 57.106 37.500 0.0 0.0 0.00 1.98
2933 3399 5.617252 ACCACATAATTTAGATGTACGGGG 58.383 41.667 0.0 0.0 35.75 5.73
3461 3940 6.840780 ACTAAATTAAGTTGGCAAGAGCAT 57.159 33.333 0.0 0.0 44.61 3.79


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.