Multiple sequence alignment - TraesCS5A01G545000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G545000 chr5A 100.000 2363 0 0 1 2363 700353232 700350870 0.000000e+00 4364
1 TraesCS5A01G545000 chr4B 99.571 1400 5 1 1 1399 581155227 581153828 0.000000e+00 2551
2 TraesCS5A01G545000 chr4B 82.059 1399 240 10 3 1397 96444469 96443078 0.000000e+00 1182
3 TraesCS5A01G545000 chr4B 94.437 737 36 4 1632 2363 660465528 660466264 0.000000e+00 1129
4 TraesCS5A01G545000 chr4B 95.067 223 11 0 1404 1626 660465248 660465470 3.740000e-93 351
5 TraesCS5A01G545000 chr2B 99.501 1403 6 1 1 1402 712834668 712836070 0.000000e+00 2551
6 TraesCS5A01G545000 chr3A 99.287 1402 9 1 1 1401 714546469 714547870 0.000000e+00 2532
7 TraesCS5A01G545000 chr2D 98.950 952 10 0 448 1399 91223041 91222090 0.000000e+00 1703
8 TraesCS5A01G545000 chr2D 98.911 459 4 1 1 458 91223675 91223217 0.000000e+00 819
9 TraesCS5A01G545000 chrUn 99.782 917 2 0 470 1386 460081766 460080850 0.000000e+00 1683
10 TraesCS5A01G545000 chrUn 95.016 963 43 5 1404 2363 110340880 110341840 0.000000e+00 1507
11 TraesCS5A01G545000 chr5B 99.217 766 5 1 1 765 267883291 267882526 0.000000e+00 1380
12 TraesCS5A01G545000 chr2A 99.217 766 5 1 1 765 756810387 756809622 0.000000e+00 1380
13 TraesCS5A01G545000 chr2A 81.571 1400 242 16 3 1397 768252747 768251359 0.000000e+00 1142
14 TraesCS5A01G545000 chr1A 99.834 601 1 0 803 1403 488243371 488242771 0.000000e+00 1105


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G545000 chr5A 700350870 700353232 2362 True 4364 4364 100.0000 1 2363 1 chr5A.!!$R1 2362
1 TraesCS5A01G545000 chr4B 581153828 581155227 1399 True 2551 2551 99.5710 1 1399 1 chr4B.!!$R2 1398
2 TraesCS5A01G545000 chr4B 96443078 96444469 1391 True 1182 1182 82.0590 3 1397 1 chr4B.!!$R1 1394
3 TraesCS5A01G545000 chr4B 660465248 660466264 1016 False 740 1129 94.7520 1404 2363 2 chr4B.!!$F1 959
4 TraesCS5A01G545000 chr2B 712834668 712836070 1402 False 2551 2551 99.5010 1 1402 1 chr2B.!!$F1 1401
5 TraesCS5A01G545000 chr3A 714546469 714547870 1401 False 2532 2532 99.2870 1 1401 1 chr3A.!!$F1 1400
6 TraesCS5A01G545000 chr2D 91222090 91223675 1585 True 1261 1703 98.9305 1 1399 2 chr2D.!!$R1 1398
7 TraesCS5A01G545000 chrUn 460080850 460081766 916 True 1683 1683 99.7820 470 1386 1 chrUn.!!$R1 916
8 TraesCS5A01G545000 chrUn 110340880 110341840 960 False 1507 1507 95.0160 1404 2363 1 chrUn.!!$F1 959
9 TraesCS5A01G545000 chr5B 267882526 267883291 765 True 1380 1380 99.2170 1 765 1 chr5B.!!$R1 764
10 TraesCS5A01G545000 chr2A 756809622 756810387 765 True 1380 1380 99.2170 1 765 1 chr2A.!!$R1 764
11 TraesCS5A01G545000 chr2A 768251359 768252747 1388 True 1142 1142 81.5710 3 1397 1 chr2A.!!$R2 1394
12 TraesCS5A01G545000 chr1A 488242771 488243371 600 True 1105 1105 99.8340 803 1403 1 chr1A.!!$R1 600

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
213 214 6.013466 ACTTTTACCCCGGAAGATACAAAGTA 60.013 38.462 0.73 0.0 31.74 2.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1545 1733 0.59023 CGCGATCGAGTTCCTGAGAC 60.59 60.0 21.57 0.0 38.1 3.36 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
213 214 6.013466 ACTTTTACCCCGGAAGATACAAAGTA 60.013 38.462 0.73 0.0 31.74 2.24
1423 1611 1.901650 GAAACTCCTTGAGCGTGCGG 61.902 60.000 0.00 0.0 32.04 5.69
1453 1641 2.996395 CTGCCCATCAGCTCCACT 59.004 61.111 0.00 0.0 35.78 4.00
1590 1778 0.606604 TTGTAGTTCTCGGCCCTGAC 59.393 55.000 0.00 0.0 0.00 3.51
1593 1781 1.207329 GTAGTTCTCGGCCCTGACAAT 59.793 52.381 0.00 0.0 0.00 2.71
1597 1785 1.450312 CTCGGCCCTGACAATCCAC 60.450 63.158 0.00 0.0 0.00 4.02
1666 1909 3.650281 TTGCCACATCCAGATACACAT 57.350 42.857 0.00 0.0 0.00 3.21
1782 2025 8.837788 TTGATTTCAGCGACATGAATATATCT 57.162 30.769 0.00 0.0 38.90 1.98
1791 2034 4.886579 ACATGAATATATCTGCTGTCGCA 58.113 39.130 0.00 0.0 45.60 5.10
1970 2216 5.619981 GCAACCAACAATGAATACTGGACTC 60.620 44.000 0.00 0.0 0.00 3.36
2049 2297 6.480320 GTGGAGACCATCTGTATATGACAAAC 59.520 42.308 0.00 0.0 34.74 2.93
2089 2337 6.365970 TGAAAGGAGAAGCTCTTATCTTGT 57.634 37.500 4.53 0.0 31.92 3.16
2188 2436 1.342074 AGCTCTGGTACAAGTCTGCA 58.658 50.000 12.52 0.0 38.70 4.41
2245 2493 1.009829 CATAGTCGCCAACTTCCAGC 58.990 55.000 0.00 0.0 39.55 4.85
2257 2505 0.108329 CTTCCAGCGTCACCGGTATT 60.108 55.000 6.87 0.0 44.18 1.89
2344 2592 3.340814 ACCTGGAAGAATACAGTGCTG 57.659 47.619 0.00 0.0 34.07 4.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
213 214 5.853922 TCTTGGATTGGGATCTGAAGGATAT 59.146 40.000 0.00 0.00 34.33 1.63
1451 1639 1.202794 GCTACCGGTAGAGAGGCTAGT 60.203 57.143 39.65 1.27 35.21 2.57
1453 1641 0.841961 TGCTACCGGTAGAGAGGCTA 59.158 55.000 39.65 15.84 35.21 3.93
1545 1733 0.590230 CGCGATCGAGTTCCTGAGAC 60.590 60.000 21.57 0.00 38.10 3.36
1590 1778 6.448006 TGGTTAACGGTAAAATTGTGGATTG 58.552 36.000 0.00 0.00 0.00 2.67
1593 1781 7.230108 TGTTATGGTTAACGGTAAAATTGTGGA 59.770 33.333 0.00 0.00 40.55 4.02
1666 1909 4.036734 AGACGACGTGAGGTAAAACTAACA 59.963 41.667 4.58 0.00 0.00 2.41
1722 1965 2.497273 TGATGAGAACAAGGCGATGAGA 59.503 45.455 0.26 0.00 0.00 3.27
1881 2124 1.856265 CTGCAAGCGAAGTTGGGGAC 61.856 60.000 0.00 0.00 0.00 4.46
1906 2149 3.051081 ACTGGTGTGCTCATTTCTCTC 57.949 47.619 0.00 0.00 0.00 3.20
1910 2153 4.093556 GCTTACTACTGGTGTGCTCATTTC 59.906 45.833 0.00 0.00 0.00 2.17
1999 2245 4.287552 AGGGTTGTCCTATTCGTATGAGT 58.712 43.478 0.00 0.00 45.98 3.41
2049 2297 7.554118 TCTCCTTTCAGGTATTTTTCATGCTAG 59.446 37.037 0.00 0.00 36.53 3.42
2089 2337 4.159321 CCAGTGCTTCTGATAGAGTTCTCA 59.841 45.833 10.22 0.00 46.27 3.27
2146 2394 2.826128 TGCTTCTGGTCGTCTCTACAAT 59.174 45.455 0.00 0.00 0.00 2.71


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.