Multiple sequence alignment - TraesCS5A01G544500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G544500 chr5A 100.000 2817 0 0 1 2817 699839817 699842633 0.000000e+00 5203
1 TraesCS5A01G544500 chr5A 99.078 2819 24 1 1 2817 699798470 699801288 0.000000e+00 5060
2 TraesCS5A01G544500 chr5A 93.462 1820 93 9 529 2330 699572812 699574623 0.000000e+00 2678
3 TraesCS5A01G544500 chr5A 86.111 468 62 3 2347 2811 699720911 699721378 4.190000e-138 501
4 TraesCS5A01G544500 chr5A 84.969 479 62 4 2347 2815 699642929 699643407 7.060000e-131 477
5 TraesCS5A01G544500 chr5A 84.937 478 63 4 2347 2815 699574612 699575089 2.540000e-130 475
6 TraesCS5A01G544500 chrUn 96.033 2445 83 9 11 2446 231251584 231254023 0.000000e+00 3965
7 TraesCS5A01G544500 chrUn 96.405 2253 70 7 11 2255 190742398 190744647 0.000000e+00 3701
8 TraesCS5A01G544500 chrUn 96.006 2153 78 6 667 2817 156743161 156745307 0.000000e+00 3493
9 TraesCS5A01G544500 chrUn 92.912 2328 150 14 11 2330 156635248 156637568 0.000000e+00 3371
10 TraesCS5A01G544500 chrUn 94.888 939 41 6 11 944 190749608 190750544 0.000000e+00 1461
11 TraesCS5A01G544500 chrUn 94.362 674 28 4 11 680 156740779 156741446 0.000000e+00 1026
12 TraesCS5A01G544500 chrUn 93.250 563 36 1 2255 2817 190746363 190746923 0.000000e+00 828
13 TraesCS5A01G544500 chrUn 91.515 495 36 5 11 500 354303502 354303995 0.000000e+00 676
14 TraesCS5A01G544500 chrUn 85.053 475 64 4 2347 2815 328174904 328175377 7.060000e-131 477
15 TraesCS5A01G544500 chr4B 92.080 2841 162 40 11 2817 660297868 660295057 0.000000e+00 3941
16 TraesCS5A01G544500 chr4B 91.116 2859 192 35 11 2817 660252793 660249945 0.000000e+00 3816
17 TraesCS5A01G544500 chr4B 91.044 2367 146 35 11 2336 660322388 660320047 0.000000e+00 3136
18 TraesCS5A01G544500 chr4B 91.466 2121 145 21 11 2125 660289531 660287441 0.000000e+00 2881


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G544500 chr5A 699839817 699842633 2816 False 5203.000000 5203 100.000000 1 2817 1 chr5A.!!$F4 2816
1 TraesCS5A01G544500 chr5A 699798470 699801288 2818 False 5060.000000 5060 99.078000 1 2817 1 chr5A.!!$F3 2816
2 TraesCS5A01G544500 chr5A 699572812 699575089 2277 False 1576.500000 2678 89.199500 529 2815 2 chr5A.!!$F5 2286
3 TraesCS5A01G544500 chrUn 231251584 231254023 2439 False 3965.000000 3965 96.033000 11 2446 1 chrUn.!!$F2 2435
4 TraesCS5A01G544500 chrUn 156635248 156637568 2320 False 3371.000000 3371 92.912000 11 2330 1 chrUn.!!$F1 2319
5 TraesCS5A01G544500 chrUn 156740779 156745307 4528 False 2259.500000 3493 95.184000 11 2817 2 chrUn.!!$F5 2806
6 TraesCS5A01G544500 chrUn 190742398 190750544 8146 False 1996.666667 3701 94.847667 11 2817 3 chrUn.!!$F6 2806
7 TraesCS5A01G544500 chr4B 660295057 660297868 2811 True 3941.000000 3941 92.080000 11 2817 1 chr4B.!!$R3 2806
8 TraesCS5A01G544500 chr4B 660249945 660252793 2848 True 3816.000000 3816 91.116000 11 2817 1 chr4B.!!$R1 2806
9 TraesCS5A01G544500 chr4B 660320047 660322388 2341 True 3136.000000 3136 91.044000 11 2336 1 chr4B.!!$R4 2325
10 TraesCS5A01G544500 chr4B 660287441 660289531 2090 True 2881.000000 2881 91.466000 11 2125 1 chr4B.!!$R2 2114

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
723 2502 1.354368 CTTTTCCTGGAACCAGCCCTA 59.646 52.381 9.04 0.0 42.35 3.53 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2412 5936 4.03296 TGATACAACAAGCCACCTCATT 57.967 40.909 0.0 0.0 0.0 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
304 310 1.872952 TCCTTGTTCACACAATCTGCG 59.127 47.619 0.00 0.00 42.21 5.18
357 363 7.248437 GCCAAATCTACCGGCAAATATATAAC 58.752 38.462 0.00 0.00 45.52 1.89
429 441 6.017192 TGGAAAGAACAGGAGTAGTAGTCAT 58.983 40.000 7.30 0.00 0.00 3.06
723 2502 1.354368 CTTTTCCTGGAACCAGCCCTA 59.646 52.381 9.04 0.00 42.35 3.53
865 2644 1.702401 TCTGTTGATGGGGTGCACTTA 59.298 47.619 17.98 3.67 0.00 2.24
1431 3212 1.220529 ATTGCACGCATCGACTATGG 58.779 50.000 0.00 0.00 35.99 2.74
1629 3410 1.895131 CCACTTCCAATTCAACCCCAG 59.105 52.381 0.00 0.00 0.00 4.45
2412 5936 6.885952 TGACGGTTTCTTTAATGGAAATCA 57.114 33.333 12.21 7.96 34.53 2.57
2446 5970 7.698130 GGCTTGTTGTATCAAGAAACATATGAC 59.302 37.037 10.38 0.64 45.11 3.06
2677 6217 4.867047 TCTTGAAACAAAATTTTGCTCGCA 59.133 33.333 26.94 17.79 41.79 5.10
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
304 310 1.331756 CCAGCAACATAAGATGACGCC 59.668 52.381 0.0 0.0 33.54 5.68
357 363 9.643652 GTCAATCGAGCTTTTCAATCTATAAAG 57.356 33.333 0.0 0.0 33.19 1.85
723 2502 2.216046 CTGAGTCGCCACAATGCATAT 58.784 47.619 0.0 0.0 0.00 1.78
865 2644 4.632153 ACTCGTGAGCAATAGACAAAGTT 58.368 39.130 0.0 0.0 0.00 2.66
2303 5827 8.166422 AGCTAACAACAACTAAAGCAAGTTAT 57.834 30.769 0.0 0.0 37.61 1.89
2412 5936 4.032960 TGATACAACAAGCCACCTCATT 57.967 40.909 0.0 0.0 0.00 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.