Multiple sequence alignment - TraesCS5A01G544000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G544000 chr5A 100.000 2824 0 0 1 2824 699632971 699635794 0.000000e+00 5216
1 TraesCS5A01G544000 chr5A 99.363 2824 18 0 1 2824 699565374 699568197 0.000000e+00 5116
2 TraesCS5A01G544000 chr5A 99.321 2800 19 0 1 2800 700375470 700378269 0.000000e+00 5066
3 TraesCS5A01G544000 chr5A 98.867 2824 31 1 1 2824 699711616 699714438 0.000000e+00 5036
4 TraesCS5A01G544000 chr5A 98.996 2790 28 0 35 2824 700380988 700383777 0.000000e+00 4998
5 TraesCS5A01G544000 chr5A 88.722 2403 180 34 460 2824 699535937 699533588 0.000000e+00 2852
6 TraesCS5A01G544000 chr5A 88.691 1238 84 17 460 1667 699550892 699549681 0.000000e+00 1459
7 TraesCS5A01G544000 chr5A 82.630 1399 195 28 794 2170 699521143 699519771 0.000000e+00 1194
8 TraesCS5A01G544000 chrUn 95.729 2482 95 7 347 2824 110266321 110263847 0.000000e+00 3986
9 TraesCS5A01G544000 chrUn 95.165 2482 93 8 347 2824 156615801 156618259 0.000000e+00 3893
10 TraesCS5A01G544000 chrUn 99.178 1703 14 0 1122 2824 184202417 184204119 0.000000e+00 3068
11 TraesCS5A01G544000 chrUn 88.211 2621 217 42 240 2824 156680314 156682878 0.000000e+00 3044
12 TraesCS5A01G544000 chrUn 89.871 2251 165 29 605 2824 156734350 156736568 0.000000e+00 2835
13 TraesCS5A01G544000 chrUn 96.067 1017 34 5 347 1361 110203658 110202646 0.000000e+00 1652
14 TraesCS5A01G544000 chrUn 99.390 492 3 0 1 492 436720098 436720589 0.000000e+00 893
15 TraesCS5A01G544000 chrUn 85.687 531 67 7 1 529 110290334 110289811 4.110000e-153 551
16 TraesCS5A01G544000 chrUn 85.094 530 70 7 2 529 184209282 184209804 1.490000e-147 532
17 TraesCS5A01G544000 chrUn 84.717 530 72 7 2 529 184219409 184219931 3.220000e-144 521
18 TraesCS5A01G544000 chr4B 85.094 530 66 10 6 529 660398805 660398283 1.930000e-146 529


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G544000 chr5A 699632971 699635794 2823 False 5216 5216 100.0000 1 2824 1 chr5A.!!$F2 2823
1 TraesCS5A01G544000 chr5A 699565374 699568197 2823 False 5116 5116 99.3630 1 2824 1 chr5A.!!$F1 2823
2 TraesCS5A01G544000 chr5A 699711616 699714438 2822 False 5036 5036 98.8670 1 2824 1 chr5A.!!$F3 2823
3 TraesCS5A01G544000 chr5A 700375470 700383777 8307 False 5032 5066 99.1585 1 2824 2 chr5A.!!$F4 2823
4 TraesCS5A01G544000 chr5A 699533588 699535937 2349 True 2852 2852 88.7220 460 2824 1 chr5A.!!$R2 2364
5 TraesCS5A01G544000 chr5A 699549681 699550892 1211 True 1459 1459 88.6910 460 1667 1 chr5A.!!$R3 1207
6 TraesCS5A01G544000 chr5A 699519771 699521143 1372 True 1194 1194 82.6300 794 2170 1 chr5A.!!$R1 1376
7 TraesCS5A01G544000 chrUn 110263847 110266321 2474 True 3986 3986 95.7290 347 2824 1 chrUn.!!$R2 2477
8 TraesCS5A01G544000 chrUn 156615801 156618259 2458 False 3893 3893 95.1650 347 2824 1 chrUn.!!$F1 2477
9 TraesCS5A01G544000 chrUn 184202417 184204119 1702 False 3068 3068 99.1780 1122 2824 1 chrUn.!!$F4 1702
10 TraesCS5A01G544000 chrUn 156680314 156682878 2564 False 3044 3044 88.2110 240 2824 1 chrUn.!!$F2 2584
11 TraesCS5A01G544000 chrUn 156734350 156736568 2218 False 2835 2835 89.8710 605 2824 1 chrUn.!!$F3 2219
12 TraesCS5A01G544000 chrUn 110202646 110203658 1012 True 1652 1652 96.0670 347 1361 1 chrUn.!!$R1 1014
13 TraesCS5A01G544000 chrUn 110289811 110290334 523 True 551 551 85.6870 1 529 1 chrUn.!!$R3 528
14 TraesCS5A01G544000 chrUn 184209282 184209804 522 False 532 532 85.0940 2 529 1 chrUn.!!$F5 527
15 TraesCS5A01G544000 chrUn 184219409 184219931 522 False 521 521 84.7170 2 529 1 chrUn.!!$F6 527
16 TraesCS5A01G544000 chr4B 660398283 660398805 522 True 529 529 85.0940 6 529 1 chr4B.!!$R1 523

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
343 348 1.272769 GTGGAGCGAACAGGAGTAGTT 59.727 52.381 0.0 0.0 0.00 2.24 F
728 737 8.771920 AAACAATCATCGTTACTATTCAGTCA 57.228 30.769 0.0 0.0 36.14 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1331 1387 1.145571 TGTTGGTCACCCTAGGCTTT 58.854 50.000 2.05 0.0 0.0 3.51 R
2490 8041 1.079336 GTGGTCGTACCCTTCTGGC 60.079 63.158 2.23 0.0 37.5 4.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
343 348 1.272769 GTGGAGCGAACAGGAGTAGTT 59.727 52.381 0.0 0.0 0.00 2.24
721 730 8.964476 AATGGAGAAACAATCATCGTTACTAT 57.036 30.769 0.0 0.0 0.00 2.12
728 737 8.771920 AAACAATCATCGTTACTATTCAGTCA 57.228 30.769 0.0 0.0 36.14 3.41
1331 1387 1.600636 CAAGGCAGCCAACCTCGAA 60.601 57.895 15.8 0.0 36.14 3.71
1538 1594 1.686052 GGCTTTGTCACATCCAACCAA 59.314 47.619 0.0 0.0 0.00 3.67
1942 2000 0.389817 GTCATGCCGCTGTGTGTCTA 60.390 55.000 0.0 0.0 0.00 2.59
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
343 348 9.901172 TGACTACTAAAGACATATAGAGTGACA 57.099 33.333 0.00 0.0 0.0 3.58
721 730 7.343057 AGGAACTCTATGTGATGTATGACTGAA 59.657 37.037 0.00 0.0 0.0 3.02
1331 1387 1.145571 TGTTGGTCACCCTAGGCTTT 58.854 50.000 2.05 0.0 0.0 3.51
1538 1594 3.503839 TTTCTGTTGGGGGCGGGT 61.504 61.111 0.00 0.0 0.0 5.28
1772 1828 7.510685 TGAGCCTGGAGATAGTCTATTGTATTT 59.489 37.037 0.00 0.0 0.0 1.40
2490 8041 1.079336 GTGGTCGTACCCTTCTGGC 60.079 63.158 2.23 0.0 37.5 4.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.