Multiple sequence alignment - TraesCS5A01G543800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G543800 chr5A 100.000 2824 0 0 1 2824 699565374 699568197 0.000000e+00 5216
1 TraesCS5A01G543800 chr5A 99.363 2824 18 0 1 2824 699632971 699635794 0.000000e+00 5116
2 TraesCS5A01G543800 chr5A 99.429 2800 16 0 1 2800 700375470 700378269 0.000000e+00 5083
3 TraesCS5A01G543800 chr5A 98.902 2824 30 1 1 2824 699711616 699714438 0.000000e+00 5042
4 TraesCS5A01G543800 chr5A 99.104 2790 25 0 35 2824 700380988 700383777 0.000000e+00 5014
5 TraesCS5A01G543800 chr5A 88.722 2403 180 34 460 2824 699535937 699533588 0.000000e+00 2852
6 TraesCS5A01G543800 chr5A 82.630 1399 195 27 794 2170 699521143 699519771 0.000000e+00 1194
7 TraesCS5A01G543800 chrUn 95.729 2482 95 7 347 2824 110266321 110263847 0.000000e+00 3986
8 TraesCS5A01G543800 chrUn 95.205 2482 92 8 347 2824 156615801 156618259 0.000000e+00 3899
9 TraesCS5A01G543800 chrUn 99.237 1703 13 0 1122 2824 184202417 184204119 0.000000e+00 3073
10 TraesCS5A01G543800 chrUn 88.287 2621 215 42 240 2824 156680314 156682878 0.000000e+00 3055
11 TraesCS5A01G543800 chrUn 89.871 2251 165 29 605 2824 156734350 156736568 0.000000e+00 2835
12 TraesCS5A01G543800 chrUn 96.165 1017 33 4 347 1361 110203658 110202646 0.000000e+00 1657
13 TraesCS5A01G543800 chrUn 99.390 492 3 0 1 492 436720098 436720589 0.000000e+00 893
14 TraesCS5A01G543800 chrUn 86.064 531 65 7 1 529 110290334 110289811 1.900000e-156 562
15 TraesCS5A01G543800 chrUn 85.472 530 68 7 2 529 184209282 184209804 6.880000e-151 544
16 TraesCS5A01G543800 chr4B 87.593 2563 241 33 244 2772 660337912 660335393 0.000000e+00 2900
17 TraesCS5A01G543800 chr4B 85.472 530 64 10 6 529 660398805 660398283 8.900000e-150 540


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G543800 chr5A 699565374 699568197 2823 False 5216.0 5216 100.0000 1 2824 1 chr5A.!!$F1 2823
1 TraesCS5A01G543800 chr5A 699632971 699635794 2823 False 5116.0 5116 99.3630 1 2824 1 chr5A.!!$F2 2823
2 TraesCS5A01G543800 chr5A 700375470 700383777 8307 False 5048.5 5083 99.2665 1 2824 2 chr5A.!!$F4 2823
3 TraesCS5A01G543800 chr5A 699711616 699714438 2822 False 5042.0 5042 98.9020 1 2824 1 chr5A.!!$F3 2823
4 TraesCS5A01G543800 chr5A 699533588 699535937 2349 True 2852.0 2852 88.7220 460 2824 1 chr5A.!!$R2 2364
5 TraesCS5A01G543800 chr5A 699519771 699521143 1372 True 1194.0 1194 82.6300 794 2170 1 chr5A.!!$R1 1376
6 TraesCS5A01G543800 chrUn 110263847 110266321 2474 True 3986.0 3986 95.7290 347 2824 1 chrUn.!!$R2 2477
7 TraesCS5A01G543800 chrUn 156615801 156618259 2458 False 3899.0 3899 95.2050 347 2824 1 chrUn.!!$F1 2477
8 TraesCS5A01G543800 chrUn 184202417 184204119 1702 False 3073.0 3073 99.2370 1122 2824 1 chrUn.!!$F4 1702
9 TraesCS5A01G543800 chrUn 156680314 156682878 2564 False 3055.0 3055 88.2870 240 2824 1 chrUn.!!$F2 2584
10 TraesCS5A01G543800 chrUn 156734350 156736568 2218 False 2835.0 2835 89.8710 605 2824 1 chrUn.!!$F3 2219
11 TraesCS5A01G543800 chrUn 110202646 110203658 1012 True 1657.0 1657 96.1650 347 1361 1 chrUn.!!$R1 1014
12 TraesCS5A01G543800 chrUn 110289811 110290334 523 True 562.0 562 86.0640 1 529 1 chrUn.!!$R3 528
13 TraesCS5A01G543800 chrUn 184209282 184209804 522 False 544.0 544 85.4720 2 529 1 chrUn.!!$F5 527
14 TraesCS5A01G543800 chr4B 660335393 660337912 2519 True 2900.0 2900 87.5930 244 2772 1 chr4B.!!$R1 2528
15 TraesCS5A01G543800 chr4B 660398283 660398805 522 True 540.0 540 85.4720 6 529 1 chr4B.!!$R2 523

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1245 1307 6.89302 ACCTTAAATGTTACATCTCCTCCT 57.107 37.5 0.0 0.0 0.0 3.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2691 8275 1.003112 TTGCGGGTGTTTAGCGGAT 60.003 52.632 0.0 0.0 0.0 4.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1245 1307 6.893020 ACCTTAAATGTTACATCTCCTCCT 57.107 37.500 0.0 0.0 0.0 3.69
2691 8275 2.439701 CCTCCGTCGCACCCTAGA 60.440 66.667 0.0 0.0 0.0 2.43
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
935 984 1.832883 TGTGTTTGTTGCCTGAGTGT 58.167 45.000 0.00 0.00 0.0 3.55
1358 1420 3.603857 CGTTGATCAAAGTGACGTTGGAC 60.604 47.826 10.35 6.55 0.0 4.02
1921 2003 2.175184 GACACACAGCGGCATGACAC 62.175 60.000 10.76 0.00 0.0 3.67
2691 8275 1.003112 TTGCGGGTGTTTAGCGGAT 60.003 52.632 0.00 0.00 0.0 4.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.