Multiple sequence alignment - TraesCS5A01G538800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G538800 chr5A 100.000 2186 0 0 922 3107 697068344 697070529 0.000000e+00 4037.0
1 TraesCS5A01G538800 chr5A 99.451 2186 12 0 922 3107 697200306 697202491 0.000000e+00 3971.0
2 TraesCS5A01G538800 chr5A 98.856 2186 24 1 922 3107 697282864 697285048 0.000000e+00 3897.0
3 TraesCS5A01G538800 chr5A 99.631 1626 6 0 1482 3107 697132988 697134613 0.000000e+00 2970.0
4 TraesCS5A01G538800 chr5A 93.127 1295 85 4 929 2222 659172908 659171617 0.000000e+00 1895.0
5 TraesCS5A01G538800 chr5A 89.571 1189 103 8 968 2155 697552530 697553698 0.000000e+00 1489.0
6 TraesCS5A01G538800 chr5A 95.159 847 38 3 2263 3107 626163153 626163998 0.000000e+00 1334.0
7 TraesCS5A01G538800 chr5A 100.000 540 0 0 922 1461 697132117 697132656 0.000000e+00 998.0
8 TraesCS5A01G538800 chr5A 100.000 472 0 0 1 472 697067423 697067894 0.000000e+00 872.0
9 TraesCS5A01G538800 chr5A 100.000 472 0 0 1 472 697199437 697199908 0.000000e+00 872.0
10 TraesCS5A01G538800 chr5A 100.000 472 0 0 1 472 697281418 697281889 0.000000e+00 872.0
11 TraesCS5A01G538800 chr5A 95.745 47 2 0 408 454 659173887 659173841 3.320000e-10 76.8
12 TraesCS5A01G538800 chrUn 94.629 1266 63 3 982 2243 100314428 100313164 0.000000e+00 1956.0
13 TraesCS5A01G538800 chrUn 94.506 1256 61 7 971 2222 100284568 100283317 0.000000e+00 1930.0
14 TraesCS5A01G538800 chrUn 100.000 472 0 0 1 472 270872407 270871936 0.000000e+00 872.0
15 TraesCS5A01G538800 chrUn 91.489 47 1 2 310 356 100315596 100315553 9.300000e-06 62.1
16 TraesCS5A01G538800 chr4D 92.526 1271 73 6 971 2221 491003175 491001907 0.000000e+00 1801.0
17 TraesCS5A01G538800 chr4D 92.628 312 20 3 1 312 491005036 491004728 2.200000e-121 446.0
18 TraesCS5A01G538800 chr4D 98.000 50 1 0 311 360 491004569 491004520 1.530000e-13 87.9
19 TraesCS5A01G538800 chr4D 95.918 49 2 0 361 409 491004485 491004437 2.570000e-11 80.5
20 TraesCS5A01G538800 chr4B 91.238 1244 103 4 982 2221 671750969 671752210 0.000000e+00 1688.0
21 TraesCS5A01G538800 chr7A 95.862 870 33 2 2240 3107 720438688 720439556 0.000000e+00 1404.0
22 TraesCS5A01G538800 chr7A 95.637 871 34 3 2240 3107 720378040 720378909 0.000000e+00 1395.0
23 TraesCS5A01G538800 chr7A 95.046 868 37 4 2244 3107 586344244 586343379 0.000000e+00 1360.0
24 TraesCS5A01G538800 chr1A 94.925 867 36 4 2244 3107 560315796 560316657 0.000000e+00 1351.0
25 TraesCS5A01G538800 chr1A 94.688 866 38 5 2243 3107 528088992 528088134 0.000000e+00 1338.0
26 TraesCS5A01G538800 chr7D 84.795 1072 160 2 1011 2079 400184819 400183748 0.000000e+00 1074.0
27 TraesCS5A01G538800 chr2D 91.080 213 19 0 1 213 445746493 445746705 3.920000e-74 289.0
28 TraesCS5A01G538800 chr6B 89.623 212 21 1 1 212 149543173 149542963 5.110000e-68 268.0
29 TraesCS5A01G538800 chr1D 89.151 212 23 0 1 212 460410277 460410488 6.610000e-67 265.0
30 TraesCS5A01G538800 chr6D 88.732 213 24 0 4 216 75919628 75919416 8.550000e-66 261.0
31 TraesCS5A01G538800 chr7B 88.208 212 25 0 1 212 679687858 679688069 1.430000e-63 254.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G538800 chr5A 697067423 697070529 3106 False 2454.50 4037 100.0000 1 3107 2 chr5A.!!$F3 3106
1 TraesCS5A01G538800 chr5A 697199437 697202491 3054 False 2421.50 3971 99.7255 1 3107 2 chr5A.!!$F5 3106
2 TraesCS5A01G538800 chr5A 697281418 697285048 3630 False 2384.50 3897 99.4280 1 3107 2 chr5A.!!$F6 3106
3 TraesCS5A01G538800 chr5A 697132117 697134613 2496 False 1984.00 2970 99.8155 922 3107 2 chr5A.!!$F4 2185
4 TraesCS5A01G538800 chr5A 697552530 697553698 1168 False 1489.00 1489 89.5710 968 2155 1 chr5A.!!$F2 1187
5 TraesCS5A01G538800 chr5A 626163153 626163998 845 False 1334.00 1334 95.1590 2263 3107 1 chr5A.!!$F1 844
6 TraesCS5A01G538800 chr5A 659171617 659173887 2270 True 985.90 1895 94.4360 408 2222 2 chr5A.!!$R1 1814
7 TraesCS5A01G538800 chrUn 100283317 100284568 1251 True 1930.00 1930 94.5060 971 2222 1 chrUn.!!$R1 1251
8 TraesCS5A01G538800 chrUn 100313164 100315596 2432 True 1009.05 1956 93.0590 310 2243 2 chrUn.!!$R3 1933
9 TraesCS5A01G538800 chr4D 491001907 491005036 3129 True 603.85 1801 94.7680 1 2221 4 chr4D.!!$R1 2220
10 TraesCS5A01G538800 chr4B 671750969 671752210 1241 False 1688.00 1688 91.2380 982 2221 1 chr4B.!!$F1 1239
11 TraesCS5A01G538800 chr7A 720438688 720439556 868 False 1404.00 1404 95.8620 2240 3107 1 chr7A.!!$F2 867
12 TraesCS5A01G538800 chr7A 720378040 720378909 869 False 1395.00 1395 95.6370 2240 3107 1 chr7A.!!$F1 867
13 TraesCS5A01G538800 chr7A 586343379 586344244 865 True 1360.00 1360 95.0460 2244 3107 1 chr7A.!!$R1 863
14 TraesCS5A01G538800 chr1A 560315796 560316657 861 False 1351.00 1351 94.9250 2244 3107 1 chr1A.!!$F1 863
15 TraesCS5A01G538800 chr1A 528088134 528088992 858 True 1338.00 1338 94.6880 2243 3107 1 chr1A.!!$R1 864
16 TraesCS5A01G538800 chr7D 400183748 400184819 1071 True 1074.00 1074 84.7950 1011 2079 1 chr7D.!!$R1 1068

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1480 2581 2.013964 TCATGCCCATGGGACCCAT 61.014 57.895 36.0 24.13 46.37 4.0 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2653 4090 2.731571 GGCGGCCATCTAGGTGACA 61.732 63.158 15.62 0.0 40.61 3.58 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1480 2581 2.013964 TCATGCCCATGGGACCCAT 61.014 57.895 36.00 24.13 46.37 4.00
2653 4090 2.603008 CCCCCGCATTCCATTCCT 59.397 61.111 0.00 0.00 0.00 3.36
2675 4112 3.479203 CCTAGATGGCCGCCCACA 61.479 66.667 7.03 0.00 45.77 4.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1480 2581 1.816863 AAGAAGAGGCTTCGGACGCA 61.817 55.000 8.80 0.0 0.00 5.24
2653 4090 2.731571 GGCGGCCATCTAGGTGACA 61.732 63.158 15.62 0.0 40.61 3.58
2998 4439 4.039730 CCTCACGAGGTTCATCCATATTCT 59.960 45.833 4.83 0.0 43.61 2.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.