Multiple sequence alignment - TraesCS5A01G523300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G523300 chr5A 100.000 2119 0 0 1 2119 684325622 684323504 0.000000e+00 3914
1 TraesCS5A01G523300 chr2D 97.609 2133 34 8 1 2119 628285701 628283572 0.000000e+00 3640
2 TraesCS5A01G523300 chr6D 96.916 2140 37 10 1 2119 431400060 431397929 0.000000e+00 3559
3 TraesCS5A01G523300 chr1D 96.868 2139 46 7 1 2119 254489735 254487598 0.000000e+00 3559
4 TraesCS5A01G523300 chr1D 96.798 1374 21 5 1 1351 394178946 394177573 0.000000e+00 2272
5 TraesCS5A01G523300 chr3D 96.539 2138 47 10 1 2119 21897588 21895459 0.000000e+00 3513
6 TraesCS5A01G523300 chr2A 96.204 2134 62 11 1 2119 335826313 335824184 0.000000e+00 3474
7 TraesCS5A01G523300 chr2A 95.948 2147 57 13 1 2119 276441040 276443184 0.000000e+00 3456
8 TraesCS5A01G523300 chr5D 95.775 2154 52 11 1 2119 329131670 329133819 0.000000e+00 3437
9 TraesCS5A01G523300 chr3B 95.634 2153 52 12 1 2119 201506612 201504468 0.000000e+00 3417
10 TraesCS5A01G523300 chr1A 97.314 1899 35 9 1 1886 256026133 256028028 0.000000e+00 3210
11 TraesCS5A01G523300 chr1A 96.164 1538 35 7 600 2119 554465601 554467132 0.000000e+00 2492
12 TraesCS5A01G523300 chr1A 94.002 867 39 2 436 1289 297884856 297885722 0.000000e+00 1301
13 TraesCS5A01G523300 chrUn 97.709 742 9 2 1 734 317473155 317473896 0.000000e+00 1269
14 TraesCS5A01G523300 chr6B 89.459 370 23 7 519 874 68913101 68913468 8.910000e-124 453


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G523300 chr5A 684323504 684325622 2118 True 3914 3914 100.000 1 2119 1 chr5A.!!$R1 2118
1 TraesCS5A01G523300 chr2D 628283572 628285701 2129 True 3640 3640 97.609 1 2119 1 chr2D.!!$R1 2118
2 TraesCS5A01G523300 chr6D 431397929 431400060 2131 True 3559 3559 96.916 1 2119 1 chr6D.!!$R1 2118
3 TraesCS5A01G523300 chr1D 254487598 254489735 2137 True 3559 3559 96.868 1 2119 1 chr1D.!!$R1 2118
4 TraesCS5A01G523300 chr1D 394177573 394178946 1373 True 2272 2272 96.798 1 1351 1 chr1D.!!$R2 1350
5 TraesCS5A01G523300 chr3D 21895459 21897588 2129 True 3513 3513 96.539 1 2119 1 chr3D.!!$R1 2118
6 TraesCS5A01G523300 chr2A 335824184 335826313 2129 True 3474 3474 96.204 1 2119 1 chr2A.!!$R1 2118
7 TraesCS5A01G523300 chr2A 276441040 276443184 2144 False 3456 3456 95.948 1 2119 1 chr2A.!!$F1 2118
8 TraesCS5A01G523300 chr5D 329131670 329133819 2149 False 3437 3437 95.775 1 2119 1 chr5D.!!$F1 2118
9 TraesCS5A01G523300 chr3B 201504468 201506612 2144 True 3417 3417 95.634 1 2119 1 chr3B.!!$R1 2118
10 TraesCS5A01G523300 chr1A 256026133 256028028 1895 False 3210 3210 97.314 1 1886 1 chr1A.!!$F1 1885
11 TraesCS5A01G523300 chr1A 554465601 554467132 1531 False 2492 2492 96.164 600 2119 1 chr1A.!!$F3 1519
12 TraesCS5A01G523300 chr1A 297884856 297885722 866 False 1301 1301 94.002 436 1289 1 chr1A.!!$F2 853
13 TraesCS5A01G523300 chrUn 317473155 317473896 741 False 1269 1269 97.709 1 734 1 chrUn.!!$F1 733

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
761 793 2.027745 GGAGTTCAGCATGTCTGGAAGA 60.028 50.0 14.5 0.0 43.06 2.87 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1642 1696 9.017509 TGATCTCTTTTTCTTGTTGCTTCATAT 57.982 29.63 0.0 0.0 0.0 1.78 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
69 70 4.756084 AAGAGGAGAACAAAAGCATTCG 57.244 40.909 0.00 0.00 0.00 3.34
452 456 9.871238 GCTATTCCGAATTACTCTATTATTCCA 57.129 33.333 0.00 0.00 0.00 3.53
477 481 7.817418 AAGCCAATGAAAAGTAAGTAGAACA 57.183 32.000 0.00 0.00 0.00 3.18
510 514 4.098501 GGGGTTTTCTATTGATGCCTTGAG 59.901 45.833 0.00 0.00 0.00 3.02
526 530 7.361457 TGCCTTGAGTAACATATAGCTTACT 57.639 36.000 0.00 0.00 36.17 2.24
761 793 2.027745 GGAGTTCAGCATGTCTGGAAGA 60.028 50.000 14.50 0.00 43.06 2.87
791 823 8.064814 GGAGAACGTTCTTTTGCTGATATTATC 58.935 37.037 30.22 12.42 37.73 1.75
966 1010 8.912988 ACCATTTTGATTCTTTAGAACAACTCA 58.087 29.630 0.00 0.00 36.80 3.41
1395 1442 1.222567 AGGGGAAATGGCCGATACTT 58.777 50.000 0.00 0.00 0.00 2.24
1396 1443 1.569072 AGGGGAAATGGCCGATACTTT 59.431 47.619 0.00 0.00 0.00 2.66
1463 1510 5.012251 TGCTGTGATTGGTTTAGTAGGTGTA 59.988 40.000 0.00 0.00 0.00 2.90
1616 1670 7.884354 ACCCGTGGAATTTTTACTCTTATAACA 59.116 33.333 0.00 0.00 0.00 2.41
1973 2035 6.239148 GCAAAAGAAAAAGAGGTCCAAGAGAT 60.239 38.462 0.00 0.00 0.00 2.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
130 133 6.613755 TTGGTTAGAGTTCGAAAAAGGAAG 57.386 37.500 0.00 0.00 0.00 3.46
147 150 6.072286 ACTCGTCTTCGAATCTACTTTGGTTA 60.072 38.462 0.00 0.00 45.61 2.85
452 456 8.232913 TGTTCTACTTACTTTTCATTGGCTTT 57.767 30.769 0.00 0.00 0.00 3.51
477 481 9.889128 CATCAATAGAAAACCCCATTTTTGTAT 57.111 29.630 0.00 0.00 40.73 2.29
761 793 1.804748 GCAAAAGAACGTTCTCCCGAT 59.195 47.619 29.82 12.32 36.28 4.18
762 794 1.202604 AGCAAAAGAACGTTCTCCCGA 60.203 47.619 29.82 0.00 36.28 5.14
791 823 6.299141 AGTAATGCTATGAATAACCCTGGTG 58.701 40.000 0.00 0.00 0.00 4.17
1031 1075 0.758734 AATAGCCAGCCATCGCACTA 59.241 50.000 0.00 0.00 37.52 2.74
1146 1191 7.986320 ACATTTTGTTCATTCAGGTTTGATTGA 59.014 29.630 0.00 0.00 40.22 2.57
1419 1466 4.341520 AGCAATACCAGCTACAGTACCTAC 59.658 45.833 0.00 0.00 41.32 3.18
1485 1532 7.698550 CGATTACTATAGAGATGAACCCAATCG 59.301 40.741 6.78 0.00 35.52 3.34
1642 1696 9.017509 TGATCTCTTTTTCTTGTTGCTTCATAT 57.982 29.630 0.00 0.00 0.00 1.78


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.