Multiple sequence alignment - TraesCS5A01G523200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G523200 chr5A 100.000 2117 0 0 1 2117 684325481 684323365 0 3910
1 TraesCS5A01G523200 chr2D 97.701 2131 34 7 1 2117 628285562 628283433 0 3650
2 TraesCS5A01G523200 chr6D 97.100 2138 37 8 1 2117 431399923 431397790 0 3581
3 TraesCS5A01G523200 chr1D 96.818 2137 47 7 1 2117 254489594 254487459 0 3550
4 TraesCS5A01G523200 chr1D 94.497 2017 87 14 116 2117 244408395 244406388 0 3088
5 TraesCS5A01G523200 chr1D 94.348 2017 90 15 116 2117 244401944 244399937 0 3072
6 TraesCS5A01G523200 chr1D 93.465 2020 105 12 116 2117 244423932 244421922 0 2974
7 TraesCS5A01G523200 chr1D 96.751 1231 19 4 1 1210 394178803 394177573 0 2032
8 TraesCS5A01G523200 chr3D 96.676 2136 49 9 1 2117 21897452 21895320 0 3531
9 TraesCS5A01G523200 chr2A 95.944 2145 57 13 1 2117 276441180 276443322 0 3452
10 TraesCS5A01G523200 chr2A 96.106 2003 60 7 1 1989 335826172 335824174 0 3251
11 TraesCS5A01G523200 chr3B 95.490 2151 55 12 1 2117 201506472 201504330 0 3397
12 TraesCS5A01G523200 chr1A 97.213 1758 33 9 1 1745 256026274 256028028 0 2961
13 TraesCS5A01G523200 chr1A 96.303 1677 38 7 459 2117 554465601 554467271 0 2732
14 TraesCS5A01G523200 chr1A 94.002 867 39 2 295 1148 297884856 297885722 0 1301
15 TraesCS5A01G523200 chr7D 92.875 800 36 4 87 866 88596847 88597645 0 1142


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G523200 chr5A 684323365 684325481 2116 True 3910 3910 100.000 1 2117 1 chr5A.!!$R1 2116
1 TraesCS5A01G523200 chr2D 628283433 628285562 2129 True 3650 3650 97.701 1 2117 1 chr2D.!!$R1 2116
2 TraesCS5A01G523200 chr6D 431397790 431399923 2133 True 3581 3581 97.100 1 2117 1 chr6D.!!$R1 2116
3 TraesCS5A01G523200 chr1D 254487459 254489594 2135 True 3550 3550 96.818 1 2117 1 chr1D.!!$R4 2116
4 TraesCS5A01G523200 chr1D 244406388 244408395 2007 True 3088 3088 94.497 116 2117 1 chr1D.!!$R2 2001
5 TraesCS5A01G523200 chr1D 244399937 244401944 2007 True 3072 3072 94.348 116 2117 1 chr1D.!!$R1 2001
6 TraesCS5A01G523200 chr1D 244421922 244423932 2010 True 2974 2974 93.465 116 2117 1 chr1D.!!$R3 2001
7 TraesCS5A01G523200 chr1D 394177573 394178803 1230 True 2032 2032 96.751 1 1210 1 chr1D.!!$R5 1209
8 TraesCS5A01G523200 chr3D 21895320 21897452 2132 True 3531 3531 96.676 1 2117 1 chr3D.!!$R1 2116
9 TraesCS5A01G523200 chr2A 276441180 276443322 2142 False 3452 3452 95.944 1 2117 1 chr2A.!!$F1 2116
10 TraesCS5A01G523200 chr2A 335824174 335826172 1998 True 3251 3251 96.106 1 1989 1 chr2A.!!$R1 1988
11 TraesCS5A01G523200 chr3B 201504330 201506472 2142 True 3397 3397 95.490 1 2117 1 chr3B.!!$R1 2116
12 TraesCS5A01G523200 chr1A 256026274 256028028 1754 False 2961 2961 97.213 1 1745 1 chr1A.!!$F1 1744
13 TraesCS5A01G523200 chr1A 554465601 554467271 1670 False 2732 2732 96.303 459 2117 1 chr1A.!!$F3 1658
14 TraesCS5A01G523200 chr1A 297884856 297885722 866 False 1301 1301 94.002 295 1148 1 chr1A.!!$F2 853
15 TraesCS5A01G523200 chr7D 88596847 88597645 798 False 1142 1142 92.875 87 866 1 chr7D.!!$F1 779

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
620 646 2.027745 GGAGTTCAGCATGTCTGGAAGA 60.028 50.0 14.5 0.0 43.06 2.87 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1501 1541 9.017509 TGATCTCTTTTTCTTGTTGCTTCATAT 57.982 29.63 0.0 0.0 0.0 1.78 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
311 316 9.871238 GCTATTCCGAATTACTCTATTATTCCA 57.129 33.333 0.00 0.00 0.00 3.53
336 341 7.817418 AAGCCAATGAAAAGTAAGTAGAACA 57.183 32.000 0.00 0.00 0.00 3.18
369 374 4.098501 GGGGTTTTCTATTGATGCCTTGAG 59.901 45.833 0.00 0.00 0.00 3.02
385 390 7.361457 TGCCTTGAGTAACATATAGCTTACT 57.639 36.000 0.00 0.00 36.17 2.24
620 646 2.027745 GGAGTTCAGCATGTCTGGAAGA 60.028 50.000 14.50 0.00 43.06 2.87
650 676 8.064814 GGAGAACGTTCTTTTGCTGATATTATC 58.935 37.037 30.22 12.42 37.73 1.75
825 863 8.912988 ACCATTTTGATTCTTTAGAACAACTCA 58.087 29.630 0.00 0.00 36.80 3.41
1254 1294 1.222567 AGGGGAAATGGCCGATACTT 58.777 50.000 0.00 0.00 0.00 2.24
1255 1295 1.569072 AGGGGAAATGGCCGATACTTT 59.431 47.619 0.00 0.00 0.00 2.66
1322 1362 5.012251 TGCTGTGATTGGTTTAGTAGGTGTA 59.988 40.000 0.00 0.00 0.00 2.90
1475 1515 7.884354 ACCCGTGGAATTTTTACTCTTATAACA 59.116 33.333 0.00 0.00 0.00 2.41
1832 1883 6.239148 GCAAAAGAAAAAGAGGTCCAAGAGAT 60.239 38.462 0.00 0.00 0.00 2.75
2031 2082 6.209391 CCTTTGCCTTGGATTCTCTTCTTTTA 59.791 38.462 0.00 0.00 0.00 1.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
6 7 6.072286 ACTCGTCTTCGAATCTACTTTGGTTA 60.072 38.462 0.00 0.00 45.61 2.85
311 316 8.232913 TGTTCTACTTACTTTTCATTGGCTTT 57.767 30.769 0.00 0.00 0.00 3.51
336 341 9.889128 CATCAATAGAAAACCCCATTTTTGTAT 57.111 29.630 0.00 0.00 40.73 2.29
620 646 1.804748 GCAAAAGAACGTTCTCCCGAT 59.195 47.619 29.82 12.32 36.28 4.18
621 647 1.202604 AGCAAAAGAACGTTCTCCCGA 60.203 47.619 29.82 0.00 36.28 5.14
650 676 6.299141 AGTAATGCTATGAATAACCCTGGTG 58.701 40.000 0.00 0.00 0.00 4.17
890 928 0.758734 AATAGCCAGCCATCGCACTA 59.241 50.000 0.00 0.00 37.52 2.74
1005 1044 7.986320 ACATTTTGTTCATTCAGGTTTGATTGA 59.014 29.630 0.00 0.00 40.22 2.57
1278 1318 4.341520 AGCAATACCAGCTACAGTACCTAC 59.658 45.833 0.00 0.00 41.32 3.18
1344 1384 7.698550 CGATTACTATAGAGATGAACCCAATCG 59.301 40.741 6.78 0.00 35.52 3.34
1501 1541 9.017509 TGATCTCTTTTTCTTGTTGCTTCATAT 57.982 29.630 0.00 0.00 0.00 1.78
2031 2082 9.759473 CTGGAATTCCTTATTTATATCCCATGT 57.241 33.333 24.73 0.00 36.82 3.21


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.