Multiple sequence alignment - TraesCS5A01G523100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G523100 chr5A 100.000 2144 0 0 1 2144 684325260 684323117 0.000000e+00 3960
1 TraesCS5A01G523100 chr2D 97.637 2158 36 7 1 2144 628285341 628283185 0.000000e+00 3688
2 TraesCS5A01G523100 chr1D 96.765 2164 49 7 1 2144 254489373 254487211 0.000000e+00 3589
3 TraesCS5A01G523100 chr1D 94.118 2159 89 17 1 2144 244408289 244406154 0.000000e+00 3249
4 TraesCS5A01G523100 chr1D 93.840 2159 95 18 1 2144 244401838 244399703 0.000000e+00 3216
5 TraesCS5A01G523100 chr1D 93.201 2162 107 14 1 2144 244423826 244421687 0.000000e+00 3142
6 TraesCS5A01G523100 chr3D 96.718 2163 50 8 1 2144 21897232 21895072 0.000000e+00 3581
7 TraesCS5A01G523100 chr2A 95.994 2172 57 13 1 2144 276441401 276443570 0.000000e+00 3502
8 TraesCS5A01G523100 chr2A 95.791 1782 57 7 1 1768 335825951 335824174 0.000000e+00 2859
9 TraesCS5A01G523100 chr2A 86.385 213 22 3 1938 2144 747297845 747298056 2.140000e-55 226
10 TraesCS5A01G523100 chr2A 98.718 78 1 0 2066 2143 112916362 112916285 2.870000e-29 139
11 TraesCS5A01G523100 chr6D 97.029 2087 37 8 1 2066 431399702 431397620 0.000000e+00 3487
12 TraesCS5A01G523100 chr3B 95.455 2178 56 13 1 2144 201506251 201504083 0.000000e+00 3434
13 TraesCS5A01G523100 chr3B 98.758 161 2 0 1984 2144 10276122 10276282 9.680000e-74 287
14 TraesCS5A01G523100 chr3B 97.143 70 2 0 4 73 636831263 636831332 3.740000e-23 119
15 TraesCS5A01G523100 chr1A 96.416 1925 45 7 238 2144 554465601 554467519 0.000000e+00 3151
16 TraesCS5A01G523100 chr1A 96.877 1537 32 9 1 1524 256026495 256028028 0.000000e+00 2558
17 TraesCS5A01G523100 chr1A 94.002 867 39 2 74 927 297884856 297885722 0.000000e+00 1301
18 TraesCS5A01G523100 chr7D 91.429 665 36 4 1 645 88596982 88597645 0.000000e+00 893


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G523100 chr5A 684323117 684325260 2143 True 3960 3960 100.000 1 2144 1 chr5A.!!$R1 2143
1 TraesCS5A01G523100 chr2D 628283185 628285341 2156 True 3688 3688 97.637 1 2144 1 chr2D.!!$R1 2143
2 TraesCS5A01G523100 chr1D 254487211 254489373 2162 True 3589 3589 96.765 1 2144 1 chr1D.!!$R4 2143
3 TraesCS5A01G523100 chr1D 244406154 244408289 2135 True 3249 3249 94.118 1 2144 1 chr1D.!!$R2 2143
4 TraesCS5A01G523100 chr1D 244399703 244401838 2135 True 3216 3216 93.840 1 2144 1 chr1D.!!$R1 2143
5 TraesCS5A01G523100 chr1D 244421687 244423826 2139 True 3142 3142 93.201 1 2144 1 chr1D.!!$R3 2143
6 TraesCS5A01G523100 chr3D 21895072 21897232 2160 True 3581 3581 96.718 1 2144 1 chr3D.!!$R1 2143
7 TraesCS5A01G523100 chr2A 276441401 276443570 2169 False 3502 3502 95.994 1 2144 1 chr2A.!!$F1 2143
8 TraesCS5A01G523100 chr2A 335824174 335825951 1777 True 2859 2859 95.791 1 1768 1 chr2A.!!$R2 1767
9 TraesCS5A01G523100 chr6D 431397620 431399702 2082 True 3487 3487 97.029 1 2066 1 chr6D.!!$R1 2065
10 TraesCS5A01G523100 chr3B 201504083 201506251 2168 True 3434 3434 95.455 1 2144 1 chr3B.!!$R1 2143
11 TraesCS5A01G523100 chr1A 554465601 554467519 1918 False 3151 3151 96.416 238 2144 1 chr1A.!!$F3 1906
12 TraesCS5A01G523100 chr1A 256026495 256028028 1533 False 2558 2558 96.877 1 1524 1 chr1A.!!$F1 1523
13 TraesCS5A01G523100 chr1A 297884856 297885722 866 False 1301 1301 94.002 74 927 1 chr1A.!!$F2 853
14 TraesCS5A01G523100 chr7D 88596982 88597645 663 False 893 893 91.429 1 645 1 chr7D.!!$F1 644

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
399 436 2.027745 GGAGTTCAGCATGTCTGGAAGA 60.028 50.0 14.5 0.0 43.06 2.87 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1955 2022 6.942976 TGTACGAAATGAATTTCTAGGTCCT 58.057 36.0 12.61 0.0 42.96 3.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
90 95 9.871238 GCTATTCCGAATTACTCTATTATTCCA 57.129 33.333 0.00 0.00 0.00 3.53
115 120 7.817418 AAGCCAATGAAAAGTAAGTAGAACA 57.183 32.000 0.00 0.00 0.00 3.18
148 153 4.098501 GGGGTTTTCTATTGATGCCTTGAG 59.901 45.833 0.00 0.00 0.00 3.02
164 169 7.361457 TGCCTTGAGTAACATATAGCTTACT 57.639 36.000 0.00 0.00 36.17 2.24
399 436 2.027745 GGAGTTCAGCATGTCTGGAAGA 60.028 50.000 14.50 0.00 43.06 2.87
429 466 8.064814 GGAGAACGTTCTTTTGCTGATATTATC 58.935 37.037 30.22 12.42 37.73 1.75
604 653 8.912988 ACCATTTTGATTCTTTAGAACAACTCA 58.087 29.630 0.00 0.00 36.80 3.41
1033 1084 1.222567 AGGGGAAATGGCCGATACTT 58.777 50.000 0.00 0.00 0.00 2.24
1034 1085 1.569072 AGGGGAAATGGCCGATACTTT 59.431 47.619 0.00 0.00 0.00 2.66
1101 1152 5.012251 TGCTGTGATTGGTTTAGTAGGTGTA 59.988 40.000 0.00 0.00 0.00 2.90
1254 1305 7.884354 ACCCGTGGAATTTTTACTCTTATAACA 59.116 33.333 0.00 0.00 0.00 2.41
1611 1672 6.239148 GCAAAAGAAAAAGAGGTCCAAGAGAT 60.239 38.462 0.00 0.00 0.00 2.75
1810 1875 6.209391 CCTTTGCCTTGGATTCTCTTCTTTTA 59.791 38.462 0.00 0.00 0.00 1.52
1955 2022 5.016173 CCAACTTGATGGTAAGAAATCCCA 58.984 41.667 0.00 0.00 35.65 4.37
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
90 95 8.232913 TGTTCTACTTACTTTTCATTGGCTTT 57.767 30.769 0.00 0.00 0.00 3.51
115 120 9.889128 CATCAATAGAAAACCCCATTTTTGTAT 57.111 29.630 0.00 0.00 40.73 2.29
399 436 1.804748 GCAAAAGAACGTTCTCCCGAT 59.195 47.619 29.82 12.32 36.28 4.18
400 437 1.202604 AGCAAAAGAACGTTCTCCCGA 60.203 47.619 29.82 0.00 36.28 5.14
429 466 6.299141 AGTAATGCTATGAATAACCCTGGTG 58.701 40.000 0.00 0.00 0.00 4.17
669 718 0.758734 AATAGCCAGCCATCGCACTA 59.241 50.000 0.00 0.00 37.52 2.74
784 834 7.986320 ACATTTTGTTCATTCAGGTTTGATTGA 59.014 29.630 0.00 0.00 40.22 2.57
1057 1108 4.341520 AGCAATACCAGCTACAGTACCTAC 59.658 45.833 0.00 0.00 41.32 3.18
1123 1174 7.698550 CGATTACTATAGAGATGAACCCAATCG 59.301 40.741 6.78 0.00 35.52 3.34
1280 1331 9.017509 TGATCTCTTTTTCTTGTTGCTTCATAT 57.982 29.630 0.00 0.00 0.00 1.78
1810 1875 9.759473 CTGGAATTCCTTATTTATATCCCATGT 57.241 33.333 24.73 0.00 36.82 3.21
1955 2022 6.942976 TGTACGAAATGAATTTCTAGGTCCT 58.057 36.000 12.61 0.00 42.96 3.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.