Multiple sequence alignment - TraesCS5A01G522700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G522700 chr5A 100.000 2596 0 0 1 2596 683632595 683630000 0.000000e+00 4795.0
1 TraesCS5A01G522700 chr5A 99.347 2604 9 1 1 2596 681897923 681900526 0.000000e+00 4708.0
2 TraesCS5A01G522700 chr5A 79.708 1163 152 53 1 1143 684648850 684647752 0.000000e+00 763.0
3 TraesCS5A01G522700 chr5A 89.339 469 46 2 1163 1631 684647208 684646744 1.040000e-163 586.0
4 TraesCS5A01G522700 chr5A 94.118 374 21 1 123 496 12880476 12880104 3.750000e-158 568.0
5 TraesCS5A01G522700 chr5A 93.357 286 18 1 123 408 52524526 52524242 3.090000e-114 422.0
6 TraesCS5A01G522700 chr5A 93.793 145 9 0 123 267 296678065 296677921 4.350000e-53 219.0
7 TraesCS5A01G522700 chr5A 94.697 132 7 0 123 254 591608172 591608041 3.390000e-49 206.0
8 TraesCS5A01G522700 chr4D 90.815 2515 141 46 1 2459 500717156 500719636 0.000000e+00 3282.0
9 TraesCS5A01G522700 chr4D 90.213 470 43 1 1163 1632 502013806 502013340 6.140000e-171 610.0
10 TraesCS5A01G522700 chr4D 79.072 927 115 51 1 904 502015153 502014283 4.850000e-157 564.0
11 TraesCS5A01G522700 chr4D 82.741 197 29 3 961 1152 502014050 502013854 1.240000e-38 171.0
12 TraesCS5A01G522700 chr4B 90.290 1102 50 27 769 1848 644680942 644682008 0.000000e+00 1389.0
13 TraesCS5A01G522700 chr4B 92.286 700 46 4 8 702 644680213 644680909 0.000000e+00 987.0
14 TraesCS5A01G522700 chr4B 91.048 458 41 0 1175 1632 646113160 646112703 1.020000e-173 619.0
15 TraesCS5A01G522700 chr4B 79.344 915 116 45 20 911 646114842 646113978 2.240000e-160 575.0
16 TraesCS5A01G522700 chr4B 83.150 273 38 8 424 695 644289789 644289524 2.580000e-60 243.0
17 TraesCS5A01G522700 chr4B 87.143 140 18 0 961 1100 646113815 646113676 2.670000e-35 159.0
18 TraesCS5A01G522700 chr2D 80.788 1650 195 77 8 1625 483631416 483632975 0.000000e+00 1179.0
19 TraesCS5A01G522700 chr2D 80.427 843 115 32 802 1625 527492498 527491687 4.780000e-167 597.0
20 TraesCS5A01G522700 chr2A 79.529 1656 226 76 8 1625 627511968 627513548 0.000000e+00 1075.0
21 TraesCS5A01G522700 chr2A 81.807 841 107 31 802 1625 672369093 672368282 0.000000e+00 664.0
22 TraesCS5A01G522700 chr2A 79.619 682 90 28 8 671 672369740 672369090 6.590000e-121 444.0
23 TraesCS5A01G522700 chr2B 83.158 855 93 36 790 1625 568468270 568469092 0.000000e+00 734.0
24 TraesCS5A01G522700 chr7D 94.444 198 10 1 67 263 134508277 134508080 1.170000e-78 303.0
25 TraesCS5A01G522700 chr7A 88.976 127 13 1 2469 2595 26687820 26687695 3.460000e-34 156.0
26 TraesCS5A01G522700 chr3D 85.470 117 14 3 2469 2584 352929722 352929836 4.540000e-23 119.0
27 TraesCS5A01G522700 chr3D 85.470 117 14 3 2469 2584 411870017 411870131 4.540000e-23 119.0
28 TraesCS5A01G522700 chr3D 85.345 116 15 2 2469 2584 442751493 442751380 4.540000e-23 119.0
29 TraesCS5A01G522700 chr6B 83.898 118 15 4 2469 2584 668715807 668715922 2.730000e-20 110.0
30 TraesCS5A01G522700 chr7B 84.946 93 14 0 2469 2561 468422278 468422186 7.650000e-16 95.3
31 TraesCS5A01G522700 chr5D 82.500 80 14 0 2468 2547 21669865 21669944 1.290000e-08 71.3


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G522700 chr5A 683630000 683632595 2595 True 4795.000000 4795 100.000000 1 2596 1 chr5A.!!$R5 2595
1 TraesCS5A01G522700 chr5A 681897923 681900526 2603 False 4708.000000 4708 99.347000 1 2596 1 chr5A.!!$F1 2595
2 TraesCS5A01G522700 chr5A 684646744 684648850 2106 True 674.500000 763 84.523500 1 1631 2 chr5A.!!$R6 1630
3 TraesCS5A01G522700 chr4D 500717156 500719636 2480 False 3282.000000 3282 90.815000 1 2459 1 chr4D.!!$F1 2458
4 TraesCS5A01G522700 chr4D 502013340 502015153 1813 True 448.333333 610 84.008667 1 1632 3 chr4D.!!$R1 1631
5 TraesCS5A01G522700 chr4B 644680213 644682008 1795 False 1188.000000 1389 91.288000 8 1848 2 chr4B.!!$F1 1840
6 TraesCS5A01G522700 chr4B 646112703 646114842 2139 True 451.000000 619 85.845000 20 1632 3 chr4B.!!$R2 1612
7 TraesCS5A01G522700 chr2D 483631416 483632975 1559 False 1179.000000 1179 80.788000 8 1625 1 chr2D.!!$F1 1617
8 TraesCS5A01G522700 chr2D 527491687 527492498 811 True 597.000000 597 80.427000 802 1625 1 chr2D.!!$R1 823
9 TraesCS5A01G522700 chr2A 627511968 627513548 1580 False 1075.000000 1075 79.529000 8 1625 1 chr2A.!!$F1 1617
10 TraesCS5A01G522700 chr2A 672368282 672369740 1458 True 554.000000 664 80.713000 8 1625 2 chr2A.!!$R1 1617
11 TraesCS5A01G522700 chr2B 568468270 568469092 822 False 734.000000 734 83.158000 790 1625 1 chr2B.!!$F1 835

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
357 397 6.651225 GCCTGTAAATAGGATGGTGAAGATAC 59.349 42.308 0.0 0.0 40.42 2.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1788 2976 6.480524 TGCTGCAATGTAGTAGTACAAAAG 57.519 37.5 14.26 10.15 42.54 2.27 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
357 397 6.651225 GCCTGTAAATAGGATGGTGAAGATAC 59.349 42.308 0.0 0.0 40.42 2.24
1788 2976 0.522076 CGGCTCTGCTTTTCATTCGC 60.522 55.000 0.0 0.0 0.00 4.70
1877 3073 2.761208 ACTCTATCCTTCCAACGACCAG 59.239 50.000 0.0 0.0 0.00 4.00
2484 3686 8.183830 TCACAGAAAAGTTAATTGCACAAAAG 57.816 30.769 0.0 0.0 0.00 2.27
2495 3697 9.250624 GTTAATTGCACAAAAGTACCACAATTA 57.749 29.630 0.0 0.0 37.42 1.40
2496 3698 7.945033 AATTGCACAAAAGTACCACAATTAG 57.055 32.000 0.0 0.0 35.22 1.73
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
357 397 4.630894 TTTAGCAGGTTTCATATTGGCG 57.369 40.909 0.00 0.00 0.00 5.69
1788 2976 6.480524 TGCTGCAATGTAGTAGTACAAAAG 57.519 37.500 14.26 10.15 42.54 2.27
2484 3686 7.822658 TGCTTTTAATGTCCTAATTGTGGTAC 58.177 34.615 0.00 0.00 0.00 3.34
2495 3697 6.830324 TGCTATCAATCTGCTTTTAATGTCCT 59.170 34.615 0.00 0.00 0.00 3.85
2496 3698 7.031226 TGCTATCAATCTGCTTTTAATGTCC 57.969 36.000 0.00 0.00 0.00 4.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.