Multiple sequence alignment - TraesCS5A01G521300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G521300 chr5A 100.000 2596 0 0 1 2596 681897923 681900518 0.000000e+00 4795.0
1 TraesCS5A01G521300 chr5A 99.345 2596 9 1 1 2596 683632595 683630008 0.000000e+00 4693.0
2 TraesCS5A01G521300 chr5A 79.622 1163 153 56 1 1143 684648850 684647752 0.000000e+00 758.0
3 TraesCS5A01G521300 chr5A 89.339 469 46 2 1163 1631 684647208 684646744 1.040000e-163 586.0
4 TraesCS5A01G521300 chr5A 94.385 374 20 1 123 496 12880476 12880104 8.060000e-160 573.0
5 TraesCS5A01G521300 chr5A 93.706 286 17 1 123 408 52524526 52524242 6.640000e-116 427.0
6 TraesCS5A01G521300 chr5A 93.793 145 9 0 123 267 296678065 296677921 4.350000e-53 219.0
7 TraesCS5A01G521300 chr5A 94.697 132 7 0 123 254 591608172 591608041 3.390000e-49 206.0
8 TraesCS5A01G521300 chr4D 90.606 2523 139 47 1 2467 500717156 500719636 0.000000e+00 3256.0
9 TraesCS5A01G521300 chr4D 90.213 470 43 1 1163 1632 502013806 502013340 6.140000e-171 610.0
10 TraesCS5A01G521300 chr4D 79.072 927 115 51 1 904 502015153 502014283 4.850000e-157 564.0
11 TraesCS5A01G521300 chr4D 82.741 197 29 3 961 1152 502014050 502013854 1.240000e-38 171.0
12 TraesCS5A01G521300 chr4B 90.381 1102 49 27 769 1848 644680942 644682008 0.000000e+00 1395.0
13 TraesCS5A01G521300 chr4B 92.286 700 46 4 8 702 644680213 644680909 0.000000e+00 987.0
14 TraesCS5A01G521300 chr4B 91.048 458 41 0 1175 1632 646113160 646112703 1.020000e-173 619.0
15 TraesCS5A01G521300 chr4B 79.235 915 117 45 20 911 646114842 646113978 1.040000e-158 569.0
16 TraesCS5A01G521300 chr4B 87.143 140 18 0 961 1100 646113815 646113676 2.670000e-35 159.0
17 TraesCS5A01G521300 chr4B 82.906 117 19 1 2476 2592 64818062 64817947 1.270000e-18 104.0
18 TraesCS5A01G521300 chr2D 80.727 1650 196 77 8 1625 483631416 483632975 0.000000e+00 1173.0
19 TraesCS5A01G521300 chr2D 80.427 843 115 32 802 1625 527492498 527491687 4.780000e-167 597.0
20 TraesCS5A01G521300 chr2A 79.469 1656 227 79 8 1625 627511968 627513548 0.000000e+00 1070.0
21 TraesCS5A01G521300 chr2A 81.807 841 107 31 802 1625 672369093 672368282 0.000000e+00 664.0
22 TraesCS5A01G521300 chr2A 79.472 682 91 31 8 671 672369740 672369090 3.070000e-119 438.0
23 TraesCS5A01G521300 chr2B 83.158 855 93 36 790 1625 568468270 568469092 0.000000e+00 734.0
24 TraesCS5A01G521300 chr7D 94.444 198 10 1 67 263 134508277 134508080 1.170000e-78 303.0
25 TraesCS5A01G521300 chr7B 87.069 116 14 1 2477 2592 641595144 641595030 2.100000e-26 130.0
26 TraesCS5A01G521300 chr7B 83.871 93 15 0 2477 2569 468422278 468422186 3.560000e-14 89.8
27 TraesCS5A01G521300 chr3D 85.345 116 16 1 2477 2592 352929722 352929836 4.540000e-23 119.0
28 TraesCS5A01G521300 chr3D 85.345 116 16 1 2477 2592 411870017 411870131 4.540000e-23 119.0
29 TraesCS5A01G521300 chr3D 84.483 116 16 2 2477 2592 442751493 442751380 2.110000e-21 113.0
30 TraesCS5A01G521300 chr6B 83.761 117 17 2 2477 2592 668715807 668715922 2.730000e-20 110.0
31 TraesCS5A01G521300 chr5D 100.000 28 0 0 2477 2504 184041200 184041173 5.000000e-03 52.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G521300 chr5A 681897923 681900518 2595 False 4795.000000 4795 100.000000 1 2596 1 chr5A.!!$F1 2595
1 TraesCS5A01G521300 chr5A 683630008 683632595 2587 True 4693.000000 4693 99.345000 1 2596 1 chr5A.!!$R5 2595
2 TraesCS5A01G521300 chr5A 684646744 684648850 2106 True 672.000000 758 84.480500 1 1631 2 chr5A.!!$R6 1630
3 TraesCS5A01G521300 chr4D 500717156 500719636 2480 False 3256.000000 3256 90.606000 1 2467 1 chr4D.!!$F1 2466
4 TraesCS5A01G521300 chr4D 502013340 502015153 1813 True 448.333333 610 84.008667 1 1632 3 chr4D.!!$R1 1631
5 TraesCS5A01G521300 chr4B 644680213 644682008 1795 False 1191.000000 1395 91.333500 8 1848 2 chr4B.!!$F1 1840
6 TraesCS5A01G521300 chr4B 646112703 646114842 2139 True 449.000000 619 85.808667 20 1632 3 chr4B.!!$R2 1612
7 TraesCS5A01G521300 chr2D 483631416 483632975 1559 False 1173.000000 1173 80.727000 8 1625 1 chr2D.!!$F1 1617
8 TraesCS5A01G521300 chr2D 527491687 527492498 811 True 597.000000 597 80.427000 802 1625 1 chr2D.!!$R1 823
9 TraesCS5A01G521300 chr2A 627511968 627513548 1580 False 1070.000000 1070 79.469000 8 1625 1 chr2A.!!$F1 1617
10 TraesCS5A01G521300 chr2A 672368282 672369740 1458 True 551.000000 664 80.639500 8 1625 2 chr2A.!!$R1 1617
11 TraesCS5A01G521300 chr2B 568468270 568469092 822 False 734.000000 734 83.158000 790 1625 1 chr2B.!!$F1 835

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
503 543 6.599638 CCCAGTGTCTTCCTAAGAATTTTAGG 59.4 42.308 15.07 15.07 42.21 2.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1870 3058 0.391597 GTCTGTGGTCGTTGGAAGGA 59.608 55.0 0.0 0.0 0.0 3.36 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
503 543 6.599638 CCCAGTGTCTTCCTAAGAATTTTAGG 59.400 42.308 15.07 15.07 42.21 2.69
1864 3052 3.521560 GACGACATGGCAAACTCTATCA 58.478 45.455 0.00 0.00 0.00 2.15
1865 3053 3.525537 ACGACATGGCAAACTCTATCAG 58.474 45.455 0.00 0.00 0.00 2.90
1866 3054 3.055819 ACGACATGGCAAACTCTATCAGT 60.056 43.478 0.00 0.00 36.64 3.41
1867 3055 3.553511 CGACATGGCAAACTCTATCAGTC 59.446 47.826 0.00 0.00 32.30 3.51
1868 3056 4.679106 CGACATGGCAAACTCTATCAGTCT 60.679 45.833 0.00 0.00 32.30 3.24
1869 3057 5.450550 CGACATGGCAAACTCTATCAGTCTA 60.451 44.000 0.00 0.00 32.30 2.59
1870 3058 6.491714 ACATGGCAAACTCTATCAGTCTAT 57.508 37.500 0.00 0.00 32.30 1.98
1871 3059 6.520272 ACATGGCAAACTCTATCAGTCTATC 58.480 40.000 0.00 0.00 32.30 2.08
2492 3686 8.539770 TCACAGAAAAGTTAATTGCACAAAAA 57.460 26.923 0.00 0.00 0.00 1.94
2503 3697 9.379811 GTTAATTGCACAAAAATACCACAATTG 57.620 29.630 3.24 3.24 37.00 2.32
2504 3698 7.798596 AATTGCACAAAAATACCACAATTGA 57.201 28.000 13.59 0.00 35.55 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
503 543 5.871524 TGACAGATATCACACTTCTTTCAGC 59.128 40.000 5.32 0.0 0.0 4.26
1864 3052 2.496470 GTGGTCGTTGGAAGGATAGACT 59.504 50.000 0.00 0.0 0.0 3.24
1865 3053 2.232941 TGTGGTCGTTGGAAGGATAGAC 59.767 50.000 0.00 0.0 0.0 2.59
1866 3054 2.496070 CTGTGGTCGTTGGAAGGATAGA 59.504 50.000 0.00 0.0 0.0 1.98
1867 3055 2.496070 TCTGTGGTCGTTGGAAGGATAG 59.504 50.000 0.00 0.0 0.0 2.08
1868 3056 2.232941 GTCTGTGGTCGTTGGAAGGATA 59.767 50.000 0.00 0.0 0.0 2.59
1869 3057 1.002087 GTCTGTGGTCGTTGGAAGGAT 59.998 52.381 0.00 0.0 0.0 3.24
1870 3058 0.391597 GTCTGTGGTCGTTGGAAGGA 59.608 55.000 0.00 0.0 0.0 3.36
1871 3059 0.393077 AGTCTGTGGTCGTTGGAAGG 59.607 55.000 0.00 0.0 0.0 3.46
2038 3226 5.537188 TGGTGCGCAATTTCTTCTTTTATT 58.463 33.333 14.00 0.0 0.0 1.40
2492 3686 8.121305 TGCTTTTAATGTCTCAATTGTGGTAT 57.879 30.769 5.13 0.0 0.0 2.73
2503 3697 7.923888 TGCTATCAATCTGCTTTTAATGTCTC 58.076 34.615 0.00 0.0 0.0 3.36
2504 3698 7.870509 TGCTATCAATCTGCTTTTAATGTCT 57.129 32.000 0.00 0.0 0.0 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.