Multiple sequence alignment - TraesCS5A01G521100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G521100 chr5A 100.000 2243 0 0 1 2243 681746388 681748630 0.000000e+00 4143.0
1 TraesCS5A01G521100 chr5A 97.149 2245 56 5 1 2243 683753166 683750928 0.000000e+00 3784.0
2 TraesCS5A01G521100 chr5A 92.507 734 44 5 791 1520 173528241 173527515 0.000000e+00 1040.0
3 TraesCS5A01G521100 chr5A 90.598 117 10 1 1892 2007 165685389 165685505 1.070000e-33 154.0
4 TraesCS5A01G521100 chr4D 93.617 1457 87 4 791 2243 210025760 210024306 0.000000e+00 2170.0
5 TraesCS5A01G521100 chr3A 91.901 1457 113 3 791 2243 575150471 575151926 0.000000e+00 2032.0
6 TraesCS5A01G521100 chr3A 96.482 796 21 4 1 790 508692778 508691984 0.000000e+00 1308.0
7 TraesCS5A01G521100 chr3A 96.236 797 22 4 1 790 99413839 99414634 0.000000e+00 1299.0
8 TraesCS5A01G521100 chr3A 93.750 512 29 1 791 1299 433765328 433765839 0.000000e+00 765.0
9 TraesCS5A01G521100 chr1A 96.709 790 26 0 1 790 563629188 563629977 0.000000e+00 1315.0
10 TraesCS5A01G521100 chr1A 96.675 782 24 2 13 793 586087276 586086496 0.000000e+00 1299.0
11 TraesCS5A01G521100 chr1A 96.222 794 25 4 1 790 58760239 58761031 0.000000e+00 1295.0
12 TraesCS5A01G521100 chr7A 96.130 801 22 5 1 793 666066606 666065807 0.000000e+00 1299.0
13 TraesCS5A01G521100 chr7A 96.226 795 25 4 1 791 590388204 590388997 0.000000e+00 1297.0
14 TraesCS5A01G521100 chr7A 94.658 599 29 1 791 1386 617960207 617959609 0.000000e+00 926.0
15 TraesCS5A01G521100 chr4A 96.222 794 25 3 1 790 591172815 591172023 0.000000e+00 1295.0
16 TraesCS5A01G521100 chr4A 93.651 63 4 0 1808 1870 469883648 469883710 6.590000e-16 95.3
17 TraesCS5A01G521100 chr7B 91.814 904 70 2 791 1691 365875419 365874517 0.000000e+00 1256.0
18 TraesCS5A01G521100 chr7B 90.504 516 39 4 1728 2243 365874524 365874019 0.000000e+00 673.0
19 TraesCS5A01G521100 chr7B 95.238 105 5 0 1903 2007 700855905 700856009 1.380000e-37 167.0
20 TraesCS5A01G521100 chr7B 98.182 55 1 0 1816 1870 456310160 456310106 1.830000e-16 97.1
21 TraesCS5A01G521100 chr1B 92.247 503 36 1 791 1290 40283315 40283817 0.000000e+00 710.0
22 TraesCS5A01G521100 chr6A 93.421 456 26 2 848 1299 616334899 616334444 0.000000e+00 673.0
23 TraesCS5A01G521100 chr5B 91.422 408 34 1 1639 2046 415395028 415394622 1.950000e-155 558.0
24 TraesCS5A01G521100 chr5B 95.238 105 5 0 1903 2007 37820942 37821046 1.380000e-37 167.0
25 TraesCS5A01G521100 chr1D 95.238 105 5 0 1903 2007 475306658 475306762 1.380000e-37 167.0
26 TraesCS5A01G521100 chr2B 96.552 58 2 0 1813 1870 317548932 317548989 1.830000e-16 97.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G521100 chr5A 681746388 681748630 2242 False 4143.0 4143 100.000 1 2243 1 chr5A.!!$F2 2242
1 TraesCS5A01G521100 chr5A 683750928 683753166 2238 True 3784.0 3784 97.149 1 2243 1 chr5A.!!$R2 2242
2 TraesCS5A01G521100 chr5A 173527515 173528241 726 True 1040.0 1040 92.507 791 1520 1 chr5A.!!$R1 729
3 TraesCS5A01G521100 chr4D 210024306 210025760 1454 True 2170.0 2170 93.617 791 2243 1 chr4D.!!$R1 1452
4 TraesCS5A01G521100 chr3A 575150471 575151926 1455 False 2032.0 2032 91.901 791 2243 1 chr3A.!!$F3 1452
5 TraesCS5A01G521100 chr3A 508691984 508692778 794 True 1308.0 1308 96.482 1 790 1 chr3A.!!$R1 789
6 TraesCS5A01G521100 chr3A 99413839 99414634 795 False 1299.0 1299 96.236 1 790 1 chr3A.!!$F1 789
7 TraesCS5A01G521100 chr3A 433765328 433765839 511 False 765.0 765 93.750 791 1299 1 chr3A.!!$F2 508
8 TraesCS5A01G521100 chr1A 563629188 563629977 789 False 1315.0 1315 96.709 1 790 1 chr1A.!!$F2 789
9 TraesCS5A01G521100 chr1A 586086496 586087276 780 True 1299.0 1299 96.675 13 793 1 chr1A.!!$R1 780
10 TraesCS5A01G521100 chr1A 58760239 58761031 792 False 1295.0 1295 96.222 1 790 1 chr1A.!!$F1 789
11 TraesCS5A01G521100 chr7A 666065807 666066606 799 True 1299.0 1299 96.130 1 793 1 chr7A.!!$R2 792
12 TraesCS5A01G521100 chr7A 590388204 590388997 793 False 1297.0 1297 96.226 1 791 1 chr7A.!!$F1 790
13 TraesCS5A01G521100 chr7A 617959609 617960207 598 True 926.0 926 94.658 791 1386 1 chr7A.!!$R1 595
14 TraesCS5A01G521100 chr4A 591172023 591172815 792 True 1295.0 1295 96.222 1 790 1 chr4A.!!$R1 789
15 TraesCS5A01G521100 chr7B 365874019 365875419 1400 True 964.5 1256 91.159 791 2243 2 chr7B.!!$R2 1452
16 TraesCS5A01G521100 chr1B 40283315 40283817 502 False 710.0 710 92.247 791 1290 1 chr1B.!!$F1 499

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
120 130 3.006728 TAGGGGAACAGGCCGGTG 61.007 66.667 10.05 0.0 0.0 4.94 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1655 1675 0.031585 TCACGCGTGTTCTTGCTAGT 59.968 50.0 35.74 0.0 0.0 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
120 130 3.006728 TAGGGGAACAGGCCGGTG 61.007 66.667 10.05 0.00 0.00 4.94
199 211 3.063997 GCAGTAGCGCATGTACAGAAAAT 59.936 43.478 11.47 0.00 0.00 1.82
272 285 7.977490 GCTAATGGAAGCAGTTATTTCTTTC 57.023 36.000 0.00 0.00 42.30 2.62
451 464 3.129638 GTGCTCGAGATAGGTTGAGAAGT 59.870 47.826 18.75 0.00 0.00 3.01
658 671 9.197694 CAATTATAGTAGTAGCGCTCTTTTCAT 57.802 33.333 16.34 4.85 0.00 2.57
785 798 5.985911 TCTGTGTATAAGGTTTTCCCTAGC 58.014 41.667 0.00 0.00 45.47 3.42
1016 1031 2.225019 CAGCCATGGCATCGAATAGAAC 59.775 50.000 37.18 4.19 44.88 3.01
1146 1161 1.302832 CGACCTTGCCCTTGAGCTT 60.303 57.895 0.00 0.00 0.00 3.74
1541 1561 0.679505 TAACGGCAGCTCAGTCACTT 59.320 50.000 0.00 0.00 0.00 3.16
1542 1562 0.882042 AACGGCAGCTCAGTCACTTG 60.882 55.000 0.00 0.00 0.00 3.16
1603 1623 4.223477 CACTCCCCATGGTCAAAATCAAAT 59.777 41.667 11.73 0.00 0.00 2.32
1618 1638 0.515127 CAAATGAGTAACGCCACGCA 59.485 50.000 0.00 0.00 32.64 5.24
1677 1698 0.944386 AGCAAGAACACGCGTGAAAT 59.056 45.000 42.94 27.88 0.00 2.17
1683 1704 1.265905 GAACACGCGTGAAATCCCTTT 59.734 47.619 42.94 24.83 0.00 3.11
2084 2105 2.989639 CCCTTGGCAGATCCGTCA 59.010 61.111 0.00 0.00 37.80 4.35
2117 2138 0.109272 GAAGTCATGTCGCGTCCAGA 60.109 55.000 5.77 0.00 0.00 3.86
2196 2217 4.077300 TCATGAACAGAGCAACAAGTCT 57.923 40.909 0.00 0.00 0.00 3.24
2229 2250 0.317020 GTGTGCGTGAGAAAACTGCC 60.317 55.000 0.00 0.00 0.00 4.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
126 136 2.649331 TTCGCTAAGTCCTCCTTTCG 57.351 50.000 0.00 0.00 34.46 3.46
199 211 6.623114 GCTGTAGATAAGTTAGCTATAGCGCA 60.623 42.308 29.19 14.72 46.49 6.09
785 798 5.152623 TCTTGGTGTTCTTCCTATCACTG 57.847 43.478 0.00 0.00 0.00 3.66
870 883 7.339212 TGCACAATGAGCTTACCTTTGTATATT 59.661 33.333 4.08 0.00 32.78 1.28
1016 1031 3.062504 GCTTTTTCTTTGCACACCAACTG 59.937 43.478 0.00 0.00 31.97 3.16
1146 1161 0.677731 CCTTGCCTTTCAGATGCGGA 60.678 55.000 0.00 0.00 0.00 5.54
1603 1623 0.584396 CTTTTGCGTGGCGTTACTCA 59.416 50.000 0.00 0.00 0.00 3.41
1618 1638 0.187606 GGAACTGGGTGGGTCCTTTT 59.812 55.000 0.00 0.00 36.25 2.27
1655 1675 0.031585 TCACGCGTGTTCTTGCTAGT 59.968 50.000 35.74 0.00 0.00 2.57
1657 1677 1.573026 TTTCACGCGTGTTCTTGCTA 58.427 45.000 35.74 13.93 0.00 3.49
1658 1678 0.944386 ATTTCACGCGTGTTCTTGCT 59.056 45.000 35.74 13.89 0.00 3.91
1662 1682 0.034896 AGGGATTTCACGCGTGTTCT 59.965 50.000 35.74 21.90 0.00 3.01
2084 2105 4.421479 CTTCGAGCTCGCCACCGT 62.421 66.667 30.97 0.00 39.60 4.83
2117 2138 3.941188 CCACTCCACGTGCAGGGT 61.941 66.667 11.96 0.90 42.42 4.34
2196 2217 1.864082 CGCACACACATGACAACACTA 59.136 47.619 0.00 0.00 0.00 2.74


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.